CN103866031A - PCR (polymerase chain reaction) detection primer and detection kit for escherichia coli 0157: H7 - Google Patents
PCR (polymerase chain reaction) detection primer and detection kit for escherichia coli 0157: H7 Download PDFInfo
- Publication number
- CN103866031A CN103866031A CN201410130211.7A CN201410130211A CN103866031A CN 103866031 A CN103866031 A CN 103866031A CN 201410130211 A CN201410130211 A CN 201410130211A CN 103866031 A CN103866031 A CN 103866031A
- Authority
- CN
- China
- Prior art keywords
- pcr
- escherichia coli
- primer
- detection
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241001646719 Escherichia coli O157:H7 Species 0.000 title claims abstract description 35
- 238000001514 detection method Methods 0.000 title claims abstract description 22
- 238000003752 polymerase chain reaction Methods 0.000 title abstract 4
- 238000000034 method Methods 0.000 claims abstract description 8
- 238000012360 testing method Methods 0.000 claims description 15
- 241001333951 Escherichia coli O157 Species 0.000 claims description 13
- 239000006228 supernatant Substances 0.000 claims description 13
- 239000007788 liquid Substances 0.000 claims description 10
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 10
- 238000006243 chemical reaction Methods 0.000 claims description 9
- 238000004519 manufacturing process Methods 0.000 claims description 8
- 238000001556 precipitation Methods 0.000 claims description 8
- 238000002360 preparation method Methods 0.000 claims description 8
- 210000004556 brain Anatomy 0.000 claims description 7
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 5
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 5
- 238000009835 boiling Methods 0.000 claims description 4
- 230000004087 circulation Effects 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 4
- 230000036425 denaturation Effects 0.000 claims description 4
- 239000012153 distilled water Substances 0.000 claims description 4
- 239000000047 product Substances 0.000 claims description 4
- 229920002684 Sepharose Polymers 0.000 claims description 3
- 239000000872 buffer Substances 0.000 claims description 3
- LOKCTEFSRHRXRJ-UHFFFAOYSA-I dipotassium trisodium dihydrogen phosphate hydrogen phosphate dichloride Chemical compound P(=O)(O)(O)[O-].[K+].P(=O)(O)([O-])[O-].[Na+].[Na+].[Cl-].[K+].[Cl-].[Na+] LOKCTEFSRHRXRJ-UHFFFAOYSA-I 0.000 claims description 3
- 238000001962 electrophoresis Methods 0.000 claims description 3
- 235000013305 food Nutrition 0.000 claims description 3
- 239000002953 phosphate buffered saline Substances 0.000 claims description 3
- 239000002689 soil Substances 0.000 claims description 3
- 108050009160 DNA polymerase 1 Proteins 0.000 claims description 2
- 230000009514 concussion Effects 0.000 claims description 2
- 230000001186 cumulative effect Effects 0.000 claims description 2
- 238000013016 damping Methods 0.000 claims description 2
- 239000012530 fluid Substances 0.000 claims description 2
- 229910021642 ultra pure water Inorganic materials 0.000 claims description 2
- 239000012498 ultrapure water Substances 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 5
- 238000011144 upstream manufacturing Methods 0.000 abstract description 2
- 239000002773 nucleotide Substances 0.000 abstract 2
- 125000003729 nucleotide group Chemical group 0.000 abstract 2
- 238000009004 PCR Kit Methods 0.000 abstract 1
- 241000894006 Bacteria Species 0.000 description 16
- 108090000623 proteins and genes Proteins 0.000 description 13
- 235000015278 beef Nutrition 0.000 description 7
- 238000013461 design Methods 0.000 description 5
- 230000000968 intestinal effect Effects 0.000 description 5
- 239000010865 sewage Substances 0.000 description 5
- 238000004088 simulation Methods 0.000 description 5
- 230000003321 amplification Effects 0.000 description 4
- 230000001580 bacterial effect Effects 0.000 description 4
- 239000003153 chemical reaction reagent Substances 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 230000008676 import Effects 0.000 description 4
- 244000005700 microbiome Species 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 238000012856 packing Methods 0.000 description 4
- 241000588724 Escherichia coli Species 0.000 description 3
- 238000000137 annealing Methods 0.000 description 3
- 244000052616 bacterial pathogen Species 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 241000283690 Bos taurus Species 0.000 description 2
- 101100410650 Escherichia coli O157:H7 purE gene Proteins 0.000 description 2
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L Magnesium chloride Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 235000003283 Pachira macrocarpa Nutrition 0.000 description 2
- 241000607142 Salmonella Species 0.000 description 2
- 244000300264 Spinacia oleracea Species 0.000 description 2
- 235000009337 Spinacia oleracea Nutrition 0.000 description 2
- 240000001085 Trapa natans Species 0.000 description 2
- 235000014364 Trapa natans Nutrition 0.000 description 2
- 239000011324 bead Substances 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 210000003608 fece Anatomy 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 235000013372 meat Nutrition 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 239000013641 positive control Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 235000009165 saligot Nutrition 0.000 description 2
- 238000005464 sample preparation method Methods 0.000 description 2
- 238000011895 specific detection Methods 0.000 description 2
- MEIRRNXMZYDVDW-MQQKCMAXSA-N (2E,4E)-2,4-hexadien-1-ol Chemical compound C\C=C\C=C\CO MEIRRNXMZYDVDW-MQQKCMAXSA-N 0.000 description 1
- 235000005254 Allium ampeloprasum Nutrition 0.000 description 1
- 240000006108 Allium ampeloprasum Species 0.000 description 1
- 241000193830 Bacillus <bacterium> Species 0.000 description 1
- 235000000318 Bindesalat Nutrition 0.000 description 1
- 244000106835 Bindesalat Species 0.000 description 1
- 206010012735 Diarrhoea Diseases 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 206010014896 Enterocolitis haemorrhagic Diseases 0.000 description 1
- 101100437498 Escherichia coli (strain K12) uidA gene Proteins 0.000 description 1
- 241000010756 Escherichia coli O157:H7 str. EDL933 Species 0.000 description 1
- 208000032759 Hemolytic-Uremic Syndrome Diseases 0.000 description 1
- 206010034107 Pasteurella infections Diseases 0.000 description 1
- 244000046052 Phaseolus vulgaris Species 0.000 description 1
- 235000010627 Phaseolus vulgaris Nutrition 0.000 description 1
- 108010079723 Shiga Toxin Proteins 0.000 description 1
- 241000607764 Shigella dysenteriae Species 0.000 description 1
- 241000147000 Shigella flexneri 2a Species 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000000740 bleeding effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000556 factor analysis Methods 0.000 description 1
- 239000001963 growth medium Substances 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000002008 hemorrhagic effect Effects 0.000 description 1
- 230000001524 infective effect Effects 0.000 description 1
- 239000002054 inoculum Substances 0.000 description 1
- 239000010871 livestock manure Substances 0.000 description 1
- 229910001629 magnesium chloride Inorganic materials 0.000 description 1
- 244000000010 microbial pathogen Species 0.000 description 1
- 238000009629 microbiological culture Methods 0.000 description 1
- 230000009871 nonspecific binding Effects 0.000 description 1
- 201000005115 pasteurellosis Diseases 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 230000005180 public health Effects 0.000 description 1
- 238000007789 sealing Methods 0.000 description 1
- 239000006152 selective media Substances 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 229940007046 shigella dysenteriae Drugs 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 235000013311 vegetables Nutrition 0.000 description 1
- 230000001018 virulence Effects 0.000 description 1
- 239000000304 virulence factor Substances 0.000 description 1
- 230000007923 virulence factor Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/10—Enterobacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a PCR (polymerase chain reaction) detection primer and detection kit for escherichia coli 0157: H7, belonging to the field of biotechnology. The kit is a rapid technique for detecting escherichia coli 0157: H7 in a sample by using specific primer pairs, which is implemented through the following steps: 1, extracting nucleotides in a sample to be detected; 2, detecting nucleotides in the sample by using the PCR kit, and judging whether the sample contains escherichia coli 0157: H7. The kit provided by the invention has strong pertinence, and is simple and convenient to operate. The primer pairs include a primer pair consisting of an upstream primer SEQ ID NO.1 with a sequence of 5-atgaataagaatctcatc-3 and a downstream primer SEQ ID NO.2 with a sequence of 5-tttcttctcgcagtttcg-3. The set of primer sequences is designed according to the unique conservative sequence of escherichia coli 0157: H7 on GenBank, and has extremely high specificity and sensitivity.
Description
one, technical field
The PCR that the invention provides a kind of Escherichia coli O 157: H7 detects primer and detection kit, belongs to biological technical field.
two, background technology
Intestinal bacteria (
escherichia coli,
e.coli) O157:H7 is important foodborne bacterial pathogens, can in worldwide, cause that animal, poultry and the mankind break out infection.China is by Escherichia coli O 157: H7 classifies 21 century as may to compatriots' health one of 12 kinds of pathogenic micro-organisms of great effect, and strong to people's virulence, infective dose is low, and infection carrier bacteria containing amount reaches l0/g can cause infection above.After germs have invaded the human body, can causing bleeding property or non hemorrhagic diarrhoea, hemorrhagic colitis and hemolytic uremic syndrome.Escherichia coli O 157: H7 not only concerns food safety, and closely related with medical treatment and public health problem.Infect in order to monitor timely and effectively following possible outburst, setting up responsive, special and reliable technology is extremely necessary for detecting fast and optionally Escherichia coli O 157: H7.
Current, many reports are attempted method detection Escherichia coli O 157: the H7 that development is more suitable for.Traditional culture identification utilization selective medium or colour developing are dull and stereotyped detects Escherichia coli O 157: H7, but this method is time-consuming, effort, poor accuracy.Round pcr each detection field that has been widely used, is bringing into play very important effect.But, use round pcr to detect Escherichia coli O 157: the obstacle of H7 maximum is the unique special label gene establishment method of How to choose.Many scholars select shiga toxin gene
stx1 He
stx2,
uidA,
eae,
fimA,
rfbEwith
fliCidentification of escherichia coli O157:H7, although these genes provide some authentication information to a certain extent, most gene is not the exclusive gene of Escherichia coli O 157: H7, can not directly be judged to be Escherichia coli O 157: H7.Therefore, select more special and stable gene identification Escherichia coli O 157: H7, set up Fast Detection Technique, more meaningful and necessity.
In previous research work, by existing Escherichia coli O 157: H7 whole genome sequence information biology, compare of analysis, find new reading frame unique be present in Escherichia coli O 157: in H7 genome.We select Escherichia coli O 157: H7 reference strain EDL933, non-Escherichia coli O 157 bacterial strain and similar enteron aisle bacterial strain Salmonellas, Shigellae etc., set up PCR and detect and distinguish these pathogenic bacterias, result shows that this new reading frame is Escherichia coli O 157: the label gene that H7 is special and stable.These results of study impel us further to develop the novel PC R test kit for detection of Escherichia coli O 157: H7.
three, find content
technical problemthe object of the invention is to provide a kind of specific detection Escherichia coli O 157: H7 primer sequence and test kit.
technical schemespecific embodiment of the invention scheme is as follows:
1, design of primers: BLAST compares Escherichia coli O 157: H7 genome sequence, find its peculiar gene, and use DNAStar software design primer pair, formed by sequence SEQ ID NO.1 and SEQ ID NO.2.Amplified production is 354bp.
2, pcr amplification, comprises the following steps:
(1) Escherichia coli O 157: H7 microbial culture and template preparation: transfering loop dips-70 DEG C and preserves bacterial classification, streak inoculation is in sorbyl alcohol Mai Kangkai flat board, cultivate 20h for 37 DEG C, in single colony inoculation 5mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company); If sample to be checked is liquid, directly getting 1mL joins in 9mL heart and brain leach liquor substratum, in substratum, adding 100 uL concentration is that 50mg/mL Vulkamycin. PA-93 (Ameresco import packing) is cultivated 20h again, next day, get inoculum 1mL, the centrifugal 10min of 12000r, the resuspended bacterium mud of 100 μ L pure water, boil 10min, the centrifugal 10min of 12000r, supernatant is template to be checked;
(2) the primer pZF of pcr amplification: MgCl2 1.5 uL, 20pmol/uL base sequence that add respectively dNTPs 2.0uL, the 25mM of 10 × PCR damping fluid 2.5uL, 2.5mM in the PCR of 0.2mL reaction tubes as shown in SEQ ID NO.1 and SEQ ID NO.2 and each 0.2 uL of pZR, archaeal dna polymerase 1, DNA profiling 2uL, add ultrapure water 15.6 uL to cumulative volume 25uL.95 DEG C of denaturation 5min, 94 DEG C of 30s, 50 DEG C of-60 DEG C of Gradient annealing 30s, 72 DEG C of 40s, 29 circulations, 72 DEG C are extended 5min again, amplification PCR product, 1.2% agarose gel electrophoresis observations, only has the highest annealing temperature of object band, and optimum annealing temperature is 60 DEG C.
(3) sensitivity test: first select Escherichia coli O 157: H7 pure cultures of bacteria, then select the Escherichia coli O 157 of simulation preparation: H7 contaminated samples is analyzed the susceptibility of PCR.
(4) specific test: select very easily the bacterium of obscuring with Escherichia coli O 157: H7 to carry out specific detection.
(5) test kit assembling: PCR premixed liquid, archaeal dna polymerase, positive control, negative control and pure water.
beneficial effect
(1) the present invention is based on the discovery of early-stage Study, Escherichia coli O 157: there is exclusive gene fragment in H7 genome, be different from other intestinal bacteria.According to this fragment gene, design primer increases, and specificity is good.
(2) due to the selected peculiar gene design primer of Escherichia coli O 157: H7 of the present invention, the PCR method of setting up to the e. coli serotype O55 very easily obscuring and all negative amplifications of O26, there is very good specificity.
(3) primer provided by the invention, without secondary structure, avoids the non-specific binding of primer self, causes false negative amplification.
(4) primer detection sensitivity provided by the invention is high, to Escherichia coli O 157: H7 bacterial cultures lowest detectable limit 10
4cFU/mL, to simulating positive sewage sample and meat sample, detectability 10CFU/mL (g) after increasing bacterium.
four, brief description of the drawings
The PCR sensitivity test figure of Fig. 1: pZF and pZR primer pair
1-6: Escherichia coli O 157: H7 pollutes after beef sample increases bacterium and detects, and 10
4cFU/g, 10
3cFU/g, 10
2cFU/g, 10CFU/g, 1CFU/g and negative control.M:DL-2000 standard molecular weight; 8-15: Escherichia coli O 157: H7 pollutes beef sample direct-detection, positive control, 10
8cFU/g, 10
7cFU/g, 10
6cFU/g, 10
5cFU/g, 10
4cFU/g, 10
3cFU/g and 10
2cFU/g.
five, embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should illustrate, these embodiment are only not used in and limit the scope of the invention for the present invention.The test method of unreceipted specific experiment condition in embodiment below, conventionally according to normal condition, for example Sambrook equimolecular clone; Condition described in laboratory manual (New York:Cold Spring Harber Laboratory Press, 1989), or the condition of advising according to manufacturer.
embodiment 1
Design of primers
Escherichia coli O 157 according to delivering on GenBank: H7 EDL933(accession number: AE005174) exclusive conservative property gene order design primer, pZF and pZR primer sequence are SEQ ID NO.1 and SEQ ID NO.2.Amplification conservative gene fragment is 354bp, and its sequence is SEQ ID NO.3.SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 are as follows:
SEQ ID NO.1：5- atgaataagaatctcatc-3
SEQ ID NO.2：5- tttcttctcgcagtttcg-3
SEQ ID NO.3：atgaataagaatctcatcctcgcatttgcattattttccttacctgtatttgcagaagaagatctggggccaggcaaata
tgtttgtgacattaggatttccagcctggataccgctactcaaattctgtcaaaatccgcaacagttctcgataatggaa
acaatttcatcgttcaaatgccaaatggagatcaattgtactctccagatctggaaaatgttgatgatggtataaaacaa
aaagcaacaataggtggagtgacatttattcgtcgtccaacttttaacgatcgcttcatcgtggaagatggaaatacagg
attcttctataagatgcgaaactgcgagaagaaa
embodiment 2
The sensitivity test of test kit, detects simulation preparation O157:H7 positive by above-mentioned primer.
It is all through immunomagnetic beads enrichment (Dynabeads anti-that O157:H7 positive is prepared in all simulations below
e. colio157 immunomagnetic beads, purchased from Invitrogen company), color developing culture medium bacterium separates (method reference: the separation of ox source O157:H7 and virulence factor analysis, Chinese animal doctor's journal, 2012,32 (8): 1148-1153.) turn out to be O157:H7 feminine gender and just can select.
2.1 sewage sample preparations: gather sewage from plant, 10mL/ pipe, adds Escherichia coli O 157: H7 culture, bacterium final concentration is respectively 10 successively
6cFU/mL, 10
5cFU/mL, 10
4cFU/mL, 10
3cFU/mL, 10
2cFU/mL, 10 CFU/mL and 1CFU/mL.
2.2 beef sample preparations: beef mud 200g is bought in supermarket, and every 10g joins in 90mL phosphate buffered saline buffer, then adds Escherichia coli O 157: H7 culture, bacterium final concentration is respectively 10
8cFU/g, 10
7cFU/g, 10
6cFU/g, 10
5cFU/g, 10
4cFU/g, 10
3cFU/g, 10
2cFU/g, 10 CFU/g and 1CFU/g.
The preparation of 2.3 templates to be checked:
By the positive beef mud sample of above-mentioned preparation, getting respectively 1mL joins in 9mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company), in substratum, adding 100 uL concentration is 50mg/mL Vulkamycin. PA-93 (Ameresco import packing) again, 37 DEG C are continued to cultivate 18h, draw 1mL culture, the centrifugal 15min of 500 r, abandon precipitation, draw supernatant to new centrifuge tube, the centrifugal 10min of 12000r, abandon supernatant, get precipitation and be resuspended in 1/10 volume distilled water, boiling water bath 10min, 4 DEG C 12000 leaves heart 10min, draw supernatant, i.e. detection template DNA.
Get the positive sewage sample of above-mentioned preparation, getting respectively 1mL joins in 9mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company), in substratum, adding 100 uL concentration is 50mg/mL Vulkamycin. PA-93 (Ameresco import packing) again, 37 DEG C are continued to cultivate 18h, draw 1mL culture, the centrifugal 15min of 500 r, abandon precipitation, draw supernatant to new centrifuge tube, the centrifugal 10min of 12000r, abandon supernatant, get precipitation and be resuspended in 1/10 volume distilled water, boiling water bath 10min, 4 DEG C of centrifugal 10min of 12000r, draw supernatant, i.e. detection template DNA.
2.4pcr amplification condition: add respectively 21 uL PCR premixed liquids in the PCR of 0.2mL reaction tubes, archaeal dna polymerase 1uL, DNA profiling 3 uL.
2.5by PCR pipe as for increasing in PCR instrument; Reaction conditions is: 95 DEG C of denaturation 5min, and 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 40s, 29 circulations, 72 DEG C are extended 5min again.Electrophoresis on the sepharose that is 1.2% in mass ratio by PCR product.
2.6result is judged: if amplified production has the band of 354bp, indicate the existence of Escherichia coli O 157: H7; If amplified production does not have the band of 354bp, indicate without Escherichia coli O 157: the existence of H7.PCR direct-detection Escherichia coli O 157: H7 pure growth template, lowest detection is limited to 10
4cFU/mL.PCR detects respectively each extent of dilution 1 CFU/mL-10 of the positive sewage sample of simulation
6cFU/mL, lowest detectable limit 10
4cFU/mL, lowest detectable limit 10CFU/mL after increasing bacterium; PCR detects respectively each extent of dilution 1 CFU/g-10 of the positive meat sample of simulation
8cFU/g, lowest detectable limit 10
5cFU/g, lowest detectable limit 10CFU/g after increasing bacterium.Fig. 1.
embodiment 3
The specific test of test kit, comprises the following steps:
Detect Escherichia coli O 157 according to test kit pcr amplification method in embodiment 2: H7 EDL933, intestinal bacteria O26, intestinal bacteria O55 and non-intestinal bacteria cause of disease (suis, Salmonella, pasteurellosis bacillus, Shigella dysenteriae, shigella flexneri 2a) (Li Li, etc.Foundation and the application of the double PCR of EHEC O157H7.North China agronomy report, 2011,26 (6): 61.) result all do not amplify any band, only has Escherichia coli O 157: H7 EDL933 amplifies the band of 354bp.
embodiment 4
Above-mentioned primer sequence and test kit detect clinical sample, comprise the following steps:
4.1sample collection: gather 20 parts of cow manures, 20 parts of Feces of Beef Cattles, 25-30g/ part; Different stands beef is bought in country fair, each 250g, totally 6 samples; Vegetables and fruit wholesale market, buy spinach, bean sprouts, leek, water chestnut and romaine lettuce, each 250g, totally 30 parts.All collections and purchase sample are stored in sample collection bag (Nanjing assistant research fellow company), sealing stored refrigerated.
4.2the preparation of template to be checked: take out 10 grams of ight soil or foods from sample collection bag, join in 90mL phosphate buffered saline buffer, after 37 DEG C of concussion 2h, getting 1mL joins in 9mL heart and brain leach liquor substratum (Hangzhou microorganism reagent goods company), in substratum, adding 100 uL concentration is 50mg/mL Vulkamycin. PA-93 (Ameresco import packing) again, 37 DEG C are continued to cultivate 18h, draw 1mL culture, the centrifugal 15min of 500 r, abandon precipitation, draw supernatant to new centrifuge tube, the centrifugal 10min of 12000r, abandon supernatant, getting precipitation is resuspended in 1/10 volume distilled water, boiling water bath 10min, 4 DEG C of centrifugal 10min of 12000r, draw supernatant, i.e. detection template DNA.
4.3pcr amplification condition: add respectively 22uL PCR premixed liquid in the PCR of 0.2mL reaction tubes, archaeal dna polymerase 1uL, DNA profiling 2uL.
4.4by PCR pipe as for increasing in PCR instrument; Reaction conditions is: 95 DEG C of denaturation 5min, and 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 40s, 29 circulations, 72 DEG C are extended 5min again.
4.5electrophoresis on the sepharose that is 1.2% in mass ratio by PCR product.
4.6result is judged: if amplified production has the band of 354bp, indicate the existence of Escherichia coli O 157: H7; If amplified production does not have the band of 354bp, indicate without Escherichia coli O 157: the existence of H7.
Result shows, 76 parts altogether of above-mentioned all samples, positive 12 parts of Escherichia coli O 157: H7, wherein positive 9 parts of ight soil, positive 1 part of water chestnut, positive 2 parts of spinach.
SEQUENCE LISTING
<110> Jiangsu Province Agriculture Science Institute
The PCR of <120> Escherichia coli O 157: H7 detects primer and detection kit
<130> 0
<160> 3
<170> PatentIn version 3.1
<210> 1
<211> 18
<212> DNA
<213> is artificial
<220>
<221> upstream primer pZF
<222> (1)..(18)
<223>
<400> 1
atgaataaga atctcatc 18
<210> 2
<211> 18
<212> DNA
<213> is artificial
<220>
<221> downstream primer pZR
<222> (1)..(18)
<223>
<400> 2
tttcttctcg cagtttcg 18
<210> 3
<211> 354
<212> DNA
<213> is artificial
<220>
<221> conservative gene fragment
<222> (1)..(354)
<223>
<400> 3
atgaataaga atctcatcct cgcatttgca ttattttcct tacctgtatt tgcagaagaa 60
gatctggggc caggcaaata tgtttgtgac attaggattt ccagcctgga taccgctact 120
caaattctgt caaaatccgc aacagttctc gataatggaa acaatttcat cgttcaaatg 180
ccaaatggag atcaattgta ctctccagat ctggaaaatg ttgatgatgg tataaaacaa 240
aaagcaacaa taggtggagt gacatttatt cgtcgtccaa cttttaacga tcgcttcatc 300
gtggaagatg gaaatacagg attcttctat aagatgcgaa actgcgagaa gaaa 354
Claims (3)
1. the PCR of Escherichia coli O 157: H7 detects a primer, it is characterized in that: be made up of sequence SEQ ID NO.1 and SEQ ID NO.2, amplified production is 354bp:
SEQ ID NO.1：5- atgaataagaatctcatc-3
SEQ ID NO.2：5- tttcttctcgcagtttcg-3。
2. contain the detection Escherichia coli O 157 of primer described in claim 1: the test kit of H7, it is characterized in that, test kit comprises PCR premixed liquid and archaeal dna polymerase, described PCR premixed liquid comprises:
The reaction system of every 22uL comprises the dNTPs 2.0uL of 10 × PCR damping fluid 2.5uL, 2.5mM, the MgCl of 25mM
21.5 uL, 20pmol/uL base sequence each 0.2 uL of primer, the ultrapure water 15.6uL as shown in SEQ ID NO.1 and SEQ ID NO.2;
Each detection reaction cumulative volume 25 uL, contain 22uLPCR premixed liquid, archaeal dna polymerase 1 uL, DNA profiling 2uL to be checked.
3. test kit according to claim 2, for detection of the PCR method of Escherichia coli O 157: H7, comprises the following steps:
(1) preparation of template to be checked: get 10 grams of ight soil or foods, join in 90mL phosphate buffered saline buffer, after 37 DEG C of concussion 2h, get 1mL and join in 9mL heart and brain leach liquor substratum; If sample to be checked is liquid, directly to get 1mL liquid sample and join in 9mL heart and brain leach liquor substratum, in substratum, adding 100 uL concentration is 50mg/mL Vulkamycin. PA-93 again, 37 DEG C are continued to cultivate 18h, draw 1mL culture, the centrifugal 15min of 500 r, abandon precipitation, draw supernatant to new centrifuge tube, the centrifugal 10min of 12000r, abandon supernatant, get precipitation and be resuspended in 1/10 volume distilled water, boiling water bath 10min, 4 DEG C 12000 leaves heart 10min, draw supernatant, i.e. detection template DNA;
(2) pcr amplification condition: add respectively 22uLPCR premixed liquid in the PCR of 0.2mL reaction tubes, archaeal dna polymerase 1uL, DNA profiling 2uL;
(3) by PCR pipe as for increasing in PCR instrument; Reaction conditions is: 95 DEG C of denaturation 5min, and 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 40s, 29 circulations, 72 DEG C are extended 5min again;
(4) electrophoresis on the sepharose that is 1.2% by PCR product in mass ratio;
(5) result is judged: if amplified production has the band of 354bp, indicate the existence of Escherichia coli O 157: H7; If amplified production does not have the band of 354bp, indicate without Escherichia coli O 157: the existence of H7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410130211.7A CN103866031B (en) | 2014-04-02 | 2014-04-02 | The PCR of Escherichia coli O 157: H7 detects primer and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410130211.7A CN103866031B (en) | 2014-04-02 | 2014-04-02 | The PCR of Escherichia coli O 157: H7 detects primer and detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103866031A true CN103866031A (en) | 2014-06-18 |
| CN103866031B CN103866031B (en) | 2016-02-10 |
Family
ID=50905032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410130211.7A Expired - Fee Related CN103866031B (en) | 2014-04-02 | 2014-04-02 | The PCR of Escherichia coli O 157: H7 detects primer and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103866031B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862394A (en) * | 2015-05-11 | 2015-08-26 | 昆明理工大学 | Primer for detecting Escherichia coli, and method and application of primer |
| CN109652574A (en) * | 2019-02-22 | 2019-04-19 | 华南理工大学 | Escherichia coli O 157: the CPA primer and kit and detection method of H7 |
| CN109988852A (en) * | 2019-04-17 | 2019-07-09 | 江苏省农业科学院 | A kind of enterohemorrhagic escherichia coli O157:H7 detection kit and its application |
| CN110923348A (en) * | 2019-12-23 | 2020-03-27 | 河北农业大学 | Primer and method for identifying five pilus genes of escherichia coli at one time |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845513A (en) * | 2009-12-25 | 2010-09-29 | 福建出入境检验检疫局检验检疫技术中心 | One-step RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection reagent kit for Cucumber green mottle mosaic virus and detection method thereof |
| CN102191315A (en) * | 2010-03-17 | 2011-09-21 | 山东出入境检验检疫局检验检疫技术中心 | Method for detecting provenance of tunny in fish product |
-
2014
- 2014-04-02 CN CN201410130211.7A patent/CN103866031B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845513A (en) * | 2009-12-25 | 2010-09-29 | 福建出入境检验检疫局检验检疫技术中心 | One-step RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection reagent kit for Cucumber green mottle mosaic virus and detection method thereof |
| CN102191315A (en) * | 2010-03-17 | 2011-09-21 | 山东出入境检验检疫局检验检疫技术中心 | Method for detecting provenance of tunny in fish product |
Non-Patent Citations (1)
| Title |
|---|
| 巢强国等: "PCR法检测食品中大肠杆菌O157：H7", 《食品科学》, vol. 31, no. 8, 15 April 2010 (2010-04-15) * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104862394A (en) * | 2015-05-11 | 2015-08-26 | 昆明理工大学 | Primer for detecting Escherichia coli, and method and application of primer |
| CN104862394B (en) * | 2015-05-11 | 2019-02-12 | 昆明理工大学 | It is a kind of for detecting the primer and its methods and applications of Escherichia coli |
| CN109652574A (en) * | 2019-02-22 | 2019-04-19 | 华南理工大学 | Escherichia coli O 157: the CPA primer and kit and detection method of H7 |
| CN109988852A (en) * | 2019-04-17 | 2019-07-09 | 江苏省农业科学院 | A kind of enterohemorrhagic escherichia coli O157:H7 detection kit and its application |
| CN110923348A (en) * | 2019-12-23 | 2020-03-27 | 河北农业大学 | Primer and method for identifying five pilus genes of escherichia coli at one time |
| CN110923348B (en) * | 2019-12-23 | 2022-09-16 | 河北农业大学 | Primer and method for identifying five pilus genes of escherichia coli at one time |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103866031B (en) | 2016-02-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434899A (en) | Method, primers and kit for quickly detecting bacillus cereus at constant temperature | |
| CN102154451B (en) | Loop-mediated isothermal amplification detection primer group, detection method and detection kit for enterobacter sakazakii | |
| CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
| Aklilu et al. | MCR‐1 Gene Encoded Colistin‐Resistant Escherichia coli in Raw Chicken Meat and Bean Sprouts in Malaysia | |
| CN103866031B (en) | The PCR of Escherichia coli O 157: H7 detects primer and detection kit | |
| CN109486972A (en) | A kind of CPA primer sets for detecting pseudomonas aeruginosa, CPA nucleic acid test strip kit and its application | |
| CN106591416A (en) | Coloring culture medium for detecting food-borne pathogenic Yersinia | |
| CN107663545A (en) | Detect primer sets and the application of yersinia enterocolitica | |
| CN104152546A (en) | Kit and method for simultaneously detecting salmonella, listeria monocytogenes and staphylococcus aureus | |
| CN102146478B (en) | PCR kit for identifying burkholderia pseudomallei | |
| Al-Dragy et al. | Detection of Escherichia coli O157: H7 in human patients stool and food by using multiplex PCR assays targeting the rfbE and the eaeAGenes compared with detection by biochemical test and serological assay | |
| CN103305613A (en) | PCR (Polymerase Chain Reaction) diagnostic kit for pathogenic aeromonas hydrophila of giant salamander | |
| CN108018364A (en) | A kind of kit and detection method of absolute quantitation detection vibrio parahemolyticus | |
| CN103602727B (en) | Detection primer set, detection kit and detection method for rapidly detecting Ralstonia solanacearum | |
| CN101591704B (en) | Detection kit for detecting three spore production bacteria in food and detection method thereof | |
| CN110846423A (en) | Fluorescent quantitative PCR (polymerase chain reaction) rapid detection method for pseudomonas fluorescens, kit and application | |
| CN103146827B (en) | Multiplex PCR (Polymerase Chain Reaction) primer for simultaneously detecting salmonella, citrobacter, proteus and Edwardsiellas and design method thereof | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN113512601B (en) | Molecular targets for screening for Proteus and quantitative detection methods | |
| Rotundo et al. | Evaluation of PCR-based methods for the identification of enteroaggregative hemorrhagic Escherichia coli in sprouts | |
| CN103866030B (en) | The LAMP detection primer of Escherichia coli O 157: H7 and detection kit | |
| CN103725771B (en) | Quick and precisely detect the product vomitoxin of living in food simultaneously and do not produce vomitoxin bacillus cereus test kit and detection method thereof | |
| CN106755411A (en) | The real-time fluorescence quantitative PCR quick detection primer and its kit of marine product vibrio parahemolyticus toxR genes | |
| CN100507005C (en) | Frequent pathogenic bacteria multiple PCR rapid detecting kit for domestic animal meat and aquatic product and its detecting method | |
| CN103981266A (en) | Method for detecting coliforms in dairy products and primer used thereby |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160210 |