CN104862394B - It is a kind of for detecting the primer and its methods and applications of Escherichia coli - Google Patents
It is a kind of for detecting the primer and its methods and applications of Escherichia coli Download PDFInfo
- Publication number
- CN104862394B CN104862394B CN201510236760.7A CN201510236760A CN104862394B CN 104862394 B CN104862394 B CN 104862394B CN 201510236760 A CN201510236760 A CN 201510236760A CN 104862394 B CN104862394 B CN 104862394B
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- primer
- detecting
- added
- adsorption column
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for detecting the primer and its methods and applications of Escherichia coli, the primer nucleotide sequences are as shown in SEQ ID NO:1 and SEQ ID NO:2, for related primer, establish the detection method of Escherichia coli, it has the characteristics that specificity is good, sensitive preferably, detection is fast and reliable, easy to operate, design includes the kit of the primer simultaneously, convenient for the detection of Escherichia coli.The present invention designs special primer for the specific gene LafF of Escherichia coli, which can quick, easy, accurate detection Escherichia coli.
Description
Technical field
The invention belongs to field of biotechnology, it is related to a kind of primer for detecting Escherichia coli and its application.
Background technique
Escherichia coli (Escherichia coli) habit is known as Escherichia coli, classifies in enterobacteriaceae, belongs to
Escherichia.Most of Escherichia coli are the bacterium that normally lives in people and various animal intestinal tracts, Escherichia coli in food or water
Detection mean direct or indirect recent fecal pollution.Excrement source contact scar health of the Escherichia coli as drinking-water, food etc.
Bacteriological Indexes；And it is close with some primary bowel pathogens in the extraneous time-to-live.Its appearance may also indicate certain
The presence of a little enteric pathogenic bacterias (such as salmonella, Shigella).Escherichia coli are monitoring of hygiene indicator bacterias generally acknowledged in the world,
Therefore the detection technique of Escherichia coli seems particularly significant.
The detection method of traditional Escherichia coli has routine smear Microscopical Method For Detection, cultivation etc., but there are one for these methods
Fixed defect, such as conventional smear for microscopic examination is most basic bacteriology checking method, but sensibility is low, poor specificity；Cultivation
It is the time for clinically finding the main path and means of the infection sources at present, but generally needing 4 to 7 days, cumbersome, much time
Power can not achieve quick purpose.
The present invention searches out Escherichia coli specific gene using bioinformatics, and is directed to its design primer, establishes big
The detection method of enterobacteria realizes purpose that is easy, fast and accurately detecting Escherichia coli.
Summary of the invention
The present invention in view of the drawbacks of the prior art, propose it is a kind of for detecting the gene of Escherichia coli, pass through biology letter
Breath, which learns to do section and obtains this, can be used for identifying the specific gene of Escherichia coli, and be related to primer for the gene.
Another object of the present invention is to be directed to related primer, the detection method of Escherichia coli is established, is had
The feature that specificity is good, sensitive preferably, detection is fast and reliable, easy to operate.
Third object of the present invention is to provide a kind of kit for detecting Escherichia coli, convenient for the inspection of Escherichia coli
It surveys.
The present invention is realized especially by following technical scheme:
It is a kind of for detecting the primer of Escherichia coli, including upstream primer and downstream primer, the upstream primer nucleosides
Acid sequence is as shown in SEQ ID NO:1, and the downstream primer nucleotide sequence is as shown in SEQ ID NO:2.
It is experimentally confirmed, detection primer provided by the invention has good specificity to Escherichia coli, which draws
The target fragment LafF gene that object is directed to.
A method of detection Escherichia coli, comprising the following steps:
1) template DNA of sample to be tested is extracted；
2) primer described above is designed；
3) PCR amplification:
Reaction system: 0.125 μ L of Taq, 10 × polymerase buffer 2.5 μ L, dNTP 2 μ L, Mg2+1.6 μ L, 1 μ L of template,
Each 1 μ L of upstream and downstream primer, adds ddH2O supplies 25 μ L；
Reaction condition: 95 DEG C of 5min；95 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 20s, 30 circulations；72℃1min；
4) testing result is judged using agarose gel electrophoresis method for detecting.
It is a kind of for detecting the kit of Escherichia coli, including primer SEQ ID NO:1 and SEQ ID NO:2, specifically:
10 × polymerase buffer 2.5 μ L, dNTP 2 μ L, Mg2+1.6 μ L, 1 μ L of template, upstream and downstream primer each 1 μ L, ddH2O 25μL。
The invention has the benefit that the specific gene LafF for Escherichia coli designs special primer, which can be with
Quickly, easy, accurate detection Escherichia coli.
Detailed description of the invention
Fig. 1 is the influence that different annealing temperature and MgCl2 concentration react colibacillus PCR；M:2000bp DNA
Marker；1:MgCl2Concentration 0.8mM；2:MgCl2Concentration 1.6mM；3:MgCl2Concentration 2.4mM；4:MgCl2Concentration 3.2mM；5:
MgCl2Concentration 4.0mM；
Fig. 2 is large intestine bar LafF bacterium gene specific detection electrophoretogram；M:2000bp DNAMarker；1~3: three plants are not
Same coli strain；4: Klebsiella Pneumoniae；5: not labor Di Shi citrobacter；6: typhoid bacillus swimming lane；7: Qiong Shi is not
Lever bacterium；8: staphylococcus epidermis；9: enterococcus faecalis；10: staphylococcus haemolyticus；11: staphylococcus aureus；12: Mo Shi rubs
Root fungus；
Fig. 3 is Escherichia coli LafF gene sensitivity technique electrophoretogram；M:2000bp DNAMarker；1~10: every microlitre
The number of plasmid in template, 1~10 respectively corresponds 109A/L~10 μ0A/μ L；11: negative control.
Specific embodiment
The present invention will be further explained with reference to the examples below, as described below, is only to preferable implementation of the invention
Example, not limits the present invention, any person skilled in the art is possibly also with the disclosure above
Technology contents be changed to the equivalent embodiment changed on an equal basis.Without departing from the concept of the present invention, according to the present invention
Technical spirit any simple modification or equivalent variations that following embodiment is made, fall within the scope of protection of the present invention.
The screening of 1 specific target gene of embodiment and design of primers:
1) Local BLAST is analyzed
From the Escherichia coli full-length genome sequence downloaded in NCBI (http://www.ncbi.nlm.nih.gov/genome/)
Column carry out Local BLAST retrieval to local nucleic acid database, acquire each sequence fragment of Escherichia coli and compare with database
As a result.
2) BLAST confirms again
Using online BLAST function, confirm that its strain specificity and Escherichia coli identify availability using 2 kinds of strategies.One
Kind strategy excludes Escherichia coli when being BLAST, is as the result is shown Escherichia coli specific gene without any similar sequences person；Second
Selection is retrieved in Escherichia coli when strategy is BLAST, and as a result returning to a large amount of similar sequences persons is different Escherichia coli bacterium
Strain consensus sequence.In conjunction with two kinds of strategies, finally show that gene LafF as shown in SEQ ID NO:3, meets two kinds of policy criterias.
3) design of primers
For Escherichia coli LafF gene, design special primer: gaagaaaatcgtggtggcgg and
gtcggttttccttttccggc。
The foundation of 2 detection method of embodiment
1) extraction of DNA
It is taken out with the bacterial genomes DNA Mini Kit of border biological gene Science and Technology Ltd. of Beijing village ally
Recycling is proposed, steps are as follows:
(1) inoculum 5mL, 12,000rpm centrifugations 1 minute, as far as possible exhaustion supernatant are taken.
(2) 500 μ L cell suspending liquids are added into the centrifuge tube there are bacterial sediment, use pipettor or turbula shaker
Thorough suspended bacterial cell precipitation, 37 DEG C warm bath 30 minutes.It was mixed by inversion for several times every 10 minutes.12,000rpm is centrifuged 2 points
Clock, as far as possible exhaustion supernatant.
(3) 225 μ L buffer solution As are added into bacterial sediment, oscillation thoroughly suspends to thallus.
(4) 6 μ L RNaseA solution are added into pipe, vibrates 15 seconds, is placed at room temperature for 5 minutes.
(5) 10 μ L Proteinase K Solutions are added into pipe, are mixed by inversion.
(6) 25 μ L lysis buffer S are added, are mixed by inversion.
(7) 250 μ L buffer solution Bs are added, vibrate 10 seconds, 70 DEG C are placed 10 minutes.12,000rpm centrifugations 1 minute, take supernatant
It is put into a new pipe, discards precipitating.
(8) 250 μ L dehydrated alcohols are added, sufficiently oscillation mixes 15 seconds, at this time it is possible that flocculent deposit, brief centrifugation
To remove the droplet of cap wall.
(9) previous step acquired solution and flocculent deposit are all added in an adsorption column (adsorption column is put into collecting pipe),
12,000rpm centrifugations 30 seconds, outwell waste liquid, adsorption column are put into collecting pipe.
(10) 500 μ L buffer C are added into adsorption column, 12,000rpm centrifugations 30 seconds outwell waste liquid, adsorption column is put
Enter in collecting pipe.
(11) 700 μ L rinsing liquid W2 are added into adsorption column, 12,000rpm centrifugations 30 seconds outwell waste liquid, adsorption column is put into
In collecting pipe.
(12) 500 μ L rinsing liquid W2 are added into adsorption column, 12,000rpm, from 30 seconds, outwell waste liquid, and adsorption column is put back to
In collecting pipe.Then 12,000rpm is centrifuged 2 minutes.Adsorption column is placed in a new 1.5mL centrifuge tube, number is placed at room temperature for
Minute, thoroughly to dry rinsing liquid remaining in adsorbent material.
(13) adsorption column is transferred in a clean centrifuge tube, 100 μ L is vacantly added dropwise to the intermediate position of adsorbed film and wash
De- buffer TE, is placed at room temperature for 2 minutes, and solution is collected into centrifuge tube by 12,000rpm centrifugations 2 minutes.
2) PCR condition optimizing:
One, to annealing temperature and Mg2+It optimizes simultaneously.Annealing temperature be 6 gradients, 49,51,53,55,57,59 DEG C.
Mg2+Concentration is 5 gradients, 0.8,1.6,2.4,3.2 and 4.0mM.It is described that Escherichia coli item is detected by polymerase chain reaction
Piece optimization amplification system is 25 μ L.Specific reaction system are as follows: Taq DNA polymerase 0.125 μ L, 10 × polymerase buffer, 2.5 μ
L, dNTP 2 μ L, Mg2+Respectively 0.8,1.6,2.4,3.2 and 4.0mM, 1 μ L of template, each 1 μ L of upstream and downstream primer add ddH2O is mended
25 μ L of foot.
Two, it is expanded in PCR instrument by following procedure:
(1) initial denaturation
95 DEG C 5 minutes
(2) 30 circulations:
95 DEG C 30 seconds
49,51,53,55,57,59 DEG C 30 seconds
72 DEG C 20 seconds
(3) it expands afterwards
72 DEG C 1 minute
It is final to establish Mg2+For 4.0M, annealing temperature is the optimal condition that 57 DEG C of conditions are detection.As a result as shown in Figure 1.
3 specific detection of embodiment
One, 3 plants of Escherichia coli clinical separation strain are collected, 9 plants of non-Escherichia coli.These bacterial strains are raw with Beijing village ally border
The bacterial genomes DNA Mini Kit of object Gene Tech. Company Limited extracts genome, and steps are as follows:
(1) inoculum 5mL, 12,000rpm centrifugations 1 minute, as far as possible exhaustion supernatant are taken.
(2) 500 μ L cell suspending liquids are added into the centrifuge tube there are bacterial sediment, use pipettor or turbula shaker
Thorough suspended bacterial cell precipitation, 37 DEG C warm bath 30 minutes.It was mixed by inversion for several times every 10 minutes.12,000rpm is centrifuged 2 points
Clock, as far as possible exhaustion supernatant.
(3) 225 μ L buffer solution As are added into bacterial sediment, oscillation thoroughly suspends to thallus.
(4) 6 μ L RNaseA solution are added into pipe, vibrates 15 seconds, is placed at room temperature for 5 minutes.
(5) 10 μ L Proteinase K Solutions are added into pipe, are mixed by inversion.
(6) 25 μ L lysis buffer S are added, are mixed by inversion.
(7) 250 μ L buffer solution Bs are added, vibrate 10 seconds, 70 DEG C are placed 10 minutes.12,000rpm centrifugations 1 minute, take supernatant
It is put into a new pipe, discards precipitating.
(8) 250 μ L dehydrated alcohols are added, sufficiently oscillation mixes 15 seconds, at this time it is possible that flocculent deposit, brief centrifugation
To remove the droplet of cap wall.
(9) previous step acquired solution and flocculent deposit are all added in an adsorption column (adsorption column is put into collecting pipe),
12,000rpm centrifugations 30 seconds, outwell waste liquid, adsorption column are put into collecting pipe.
(10) 500 μ L buffer C are added into adsorption column, 12,000rpm centrifugations 30 seconds outwell waste liquid, adsorption column is put
Enter in collecting pipe.
(11) 700 μ L rinsing liquid W2 are added into adsorption column, 12,000rpm centrifugations 30 seconds outwell waste liquid, adsorption column is put into
In collecting pipe.
(12) 500 μ L rinsing liquid W2 are added into adsorption column, 12,000rpm, from 30 seconds, outwell waste liquid, and adsorption column is put back to
In collecting pipe.Then 12,000rpm is centrifuged 2 minutes.Adsorption column is placed in a new 1.5mL centrifuge tube, number is placed at room temperature for
Minute, thoroughly to dry rinsing liquid remaining in adsorbent material.
(13) adsorption column is transferred in a clean centrifuge tube, 100 μ L is vacantly added dropwise to the intermediate position of adsorbed film and wash
De- buffer TE, is placed at room temperature for 2 minutes, and solution is collected into centrifuge tube by 12,000rpm centrifugations 2 minutes.
Two, PCR reaction system:
The genome of each bacterial strain is used separately as template and carries out polymerase chain reaction.Reaction system is 25 μ L, Taq
0.125 μ L, 10 × polymerase buffer 2.5 μ L, dNTP 2 μ L, Mg2+1.6 μ L, 1 μ L of template, each 1 μ L of upstream and downstream primer add
ddH2O supplies 25 μ L.
Three, it is expanded in PCR instrument by following procedure:
(1) initial denaturation
95 DEG C 5 minutes
(2) 30 circulations:
95 DEG C 30 seconds
57 DEG C 30 seconds
72 DEG C 20 seconds
(3) it expands afterwards
72 DEG C 1 minute
In Mg2+For 4.0mM, under conditions of annealing temperature is 57 DEG C, what which can be specific detects large intestine
Bacillus, without being influenced by other strains, as shown in Figure 2.
4 sensitivity technique of embodiment
One, positive plasmid vector construction
1) using genome of E.coli as template, PCR amplification is carried out with above-mentioned special primer, reaction system is 100 μ L,
0.5 μ L of Taq, 10 × polymerase buffer 10 μ L, dNTP 8 μ L, Mg2+6.4 μ L, 4 μ L of template, each 4 μ L of upstream and downstream primer add
ddH2O supplies 100 μ L.
2) it is expanded in PCR instrument by following procedure:
(1) initial denaturation
95 DEG C 5 minutes
(2) 30 circulations:
95 DEG C 30 seconds
57 DEG C 30 seconds
72 DEG C 20 seconds
(3) it expands afterwards
72 DEG C 1 minute
3) after circulation terminates, by 1.5% agarose gel electrophoresis of PCR product, and with Beijing village ally border biological gene
A small amount of Ago-Gel DNA QIAquick Gel Extraction Kits of Science and Technology Ltd. are stripped recycling, and steps are as follows:
(1) single target DNA band is cut into (excision redundance as far as possible) from Ago-Gel
It is put into clean centrifuge tube, weighs weight.
(2) into blob of viscose be added 2 times of volume sol solutions, 55 DEG C water-bath 10 minutes, therebetween constantly leniently spin upside down from
Heart pipe, to ensure that blob of viscose sufficiently dissolves.
(3) previous step acquired solution is added in an adsorption column, 12,000rpm centrifugations 1 minute are outwelled in collecting pipe
Adsorption column is put into collecting pipe by waste liquid.
(4) 700 μ L rinsing liquid W2 are added into adsorption column, the waste liquid in collecting pipe is outwelled in 12,000rpm centrifugations 1 minute,
Adsorption column is put into collecting pipe.
(5) 50 μ L rinsing liquid W2 are added into adsorption column, the waste liquid in collecting pipe is outwelled in 12,000rpm centrifugations 1 minute,
Adsorption column is put into collecting pipe.
(6) adsorption column is put into collecting pipe, 12,000rpm centrifugations 2 minutes, as far as possible removing rinsing liquid.Adsorption column is set
In being placed at room temperature for several minutes, thoroughly dry.
(7) adsorption column is put into a clean centrifuge tube, the elution that 30 μ L are vacantly added dropwise to adsorbed film middle position is slow
Fliud flushing TE is placed at room temperature for 2 minutes.12,000rpm centrifugations 2 minutes, collect DNA solution.
4) preparation of bacillus coli DH 5 alpha competent cell:
(1) the single DH5 α bacterium colony of picking is inoculated in 3mL LB culture medium not with ampicillin, 37 DEG C of overnight incubations,
Next day takes above-mentioned bacterium solution, and 1:100 is inoculated in 50mLLB culture medium in proportion, and 37 DEG C vibrate 2 hours.When OD600 value reaches
When 0.35, bacterial cultures is harvested.
(2) bacterium is transferred in the sterile polypropylene tube of 50mL pre-cooling, places 10 minutes on ice, keeps culture cold
But.
(3) 4100rpm is centrifuged 10 minutes at 4 DEG C, culture solution is sucked out, and pipe is inverted l/min so that remaining culture
Base flow is most.
(4) every 50mL initial incubation liquid and the 0.1mol/L CaCl2-MgCl of 30mL pre-cooling2Molten (80mmol/L MgCl2,
20mmol/L CaCl2) cell precipitation is resuspended.
(5) 4100rpm is centrifuged 10 minutes at 4 DEG C, supernatant is sucked out, and pipe is inverted l/min so that residual liquid
It flows to end.
(6) the 0.1mol/L CaCl that every 50mL initial incubation object 2mL is pre-chilled2Cell precipitation is resuspended in solution, dispenses standby
With.
5) connection and the conversion of connection product:
(1) 1 μ L Takara pMD19-T simple carrier, 4 μ LLafF gene PCR products are added in microcentrifugal tube
And 5 μ L ligase buffer mixture.
(2) 16 DEG C are reacted 3 hours.
(3) full dose (10 μ L) is added into 100 μ L DH5 α competent cells, places 30 minutes in ice.
(4) 42 DEG C after heating 90 seconds, then place 1 minute in ice.
(5) the LB culture medium 890 μ L for being added that 37 DEG C of warm bath cross, 37 DEG C slow oscillation culture 60 minutes.
(6) 200 μ L are taken to be coated on the LB culture medium containing ampicillin, 37 DEG C of culture 16h are to form single colonie.
6) LafF gene pcr product screening and identification
The above-mentioned single bacterium of picking is fallen in LB culture medium with ampicillin, 37 DEG C of slow oscillation culture 4h, carries out PCR expansion
Increase.Amplimer and amplification condition are the same as aforementioned optimum reaction condition.After the positive colony confirmed through PCR is carried out plasmid extraction,
The measurement of nucleotide sequence is carried out with the full-automatic nucleotide sequencing instrument of U.S. Applied Biosyst ems3730A.Sequencing
Primer is BcaBESTTMSequencingPrimer ML3-47 (5 ' CGCCAGGGTTTTCCCAGTCACGAC 3 '), purpose piece
Section sequencing result is held from 5 ' to 3 ' terminal sequences are as follows: atgaagaaaatcgtggtggcgggcgtggtcagcgccgttctggcgtt
ggtggtgggggccggagctggatggggtgtctggcatcattatgccggaaaaggaaaaccg。
7) positive plasmid extracts:
(1) bacterium solution for taking 5mL to be incubated overnight is added in centrifuge tube, 12,000rpm centrifugations 1 minute, as far as possible absorption supernatant.
(2) 250 μ L solution 1 are added into the centrifuge tube there are bacterial sediment, it is thorough using pipettor or turbula shaker
Suspended bacterial precipitating.
(3) 250 μ L solution 2 are added into centrifuge tube, leniently spinning upside down 6-8 times cracks thallus sufficiently.
(4) 350 μ L solution 3 are added into centrifuge tube, leniently spins upside down immediately 6-8 times, mixes well, that is, occur white
Color flocculent deposit.12,000rpm centrifugations 10 minutes form precipitating in centrifugation bottom of the tube at this time.The supernatant that previous step is collected
It is transferred in adsorption column with pipettor, 12,000rpm centrifugations 60 seconds outwell the waste liquid in collecting pipe, adsorption column is put into collection
Guan Zhong.
(5) 700 μ L rinsing liquid W2 are added into adsorption column, 12,000rpm centrifugations 30-60 seconds are outwelled useless in collecting pipe
Adsorption column is put into collecting pipe by liquid.
(6) 500 μ L rinsing liquid W2 are added into adsorption column, the waste liquid in collecting pipe is outwelled in 12,000rpm centrifugations 60 seconds,
Adsorption column is put into collecting pipe.
(7) adsorption column is put into collecting pipe, 12,000rpm centrifugations 2 minutes are placed in and are placed at room temperature for several minutes, with thorough
Dry rinsing liquid remaining in adsorbent material.
(8) adsorption column is placed in a clean centrifuge tube, 60 μ L elution buffers is added dropwise to the intermediate position of adsorbed film
Liquid TE is placed at room temperature for 2 minutes, and plasmid solution is collected into centrifuge tube by 12,000rpm centrifugations for 1 minute.
Two, Escherichia coli sensitivity
1) plasmid number converts
Plasmid concentration is measured with ultraviolet specrophotometer are as follows: 158ng/ μ L.
Plasmid number reduction formula:(note: X is plasmid concentration；Y is purpose sequence alkali
Base logarithm；NA is Avgadro constant；2692 be carrier base logarithm；660 be base average molecular weight) obtain the number of plasmid
Mesh is 5.06 × 1010A/μ L.
2) 1 μ L LafF positive plasmid is taken to be diluted to 1.0 × 109A/μ L, the positive plasmid for taking 2 μ L to dilute carry out 10 times
Gradient dilution is diluted to 1.0 × 108To 1.0 × 1009 gradients.Taking each 2 μ L of gradient dilution liquid respectively is template.Reactant
System is 25 μ L, Taq0.125 μ L, 10 × polymerase buffer 2.5 μ L, dNTP 2 μ L, Mg2+1.6 μ L, 2 μ L of template, upstream and downstream are drawn
Each 1 μ L of object, adds ddH2O supplies 25 μ L.
3. being expanded in PCR instrument by following procedure:
(1) initial denaturation
95 DEG C 5 minutes
(2) 30 circulations:
95 DEG C 30 seconds
57 DEG C 30 seconds
72 DEG C 20 seconds
(3) it expands afterwards
72 DEG C 1 minute
In Mg2+For 4.0mM, under conditions of annealing temperature is 57 DEG C, which can detecte Escherichia coli most
Low concentration is 1/μ L, as shown in Figure 3.
Claims (3)
1. a kind of for detecting the primer of Escherichia coli, including upstream primer and downstream primer, it is characterised in that: the upstream
Primer nucleotide sequences are as shown in SEQ ID NO:1, and the downstream primer nucleotide sequence is as shown in SEQ ID NO:2；Institute
The primer stated for detecting Escherichia coli can quick, easy, accurate detection Escherichia coli.
2. it is a kind of detect Escherichia coli method, it is characterised in that: it is described detection Escherichia coli method not by diagnosis for the purpose of,
The following steps are included:
1) template DNA of sample to be tested is extracted；
2) primer described in claim 1 is designed；
3) PCR amplification:
Reaction system: 0.125 μ L of Taq, 10 × polymerase buffer 2.5 μ L, dNTP 2 μ L, Mg2+1.6 μ L, 1 μ L of template, up and down
Each 1 μ L of primer is swum, ddH is added2O supplies 25 μ L；
Reaction condition: 95 DEG C of 5min；95 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 20s, 30 circulations；72℃1min；
4) testing result is judged using agarose gel electrophoresis method for detecting.
3. a kind of for detecting the kit of Escherichia coli, it is characterised in that: including primer SEQ ID NO:1 and SEQ ID NO:
2；
10 × polymerase buffer 2.5 μ L, dNTP 2 μ L, Mg2+1.6 μ L, 1 μ L of template, upstream and downstream primer each 1 μ L, ddH2O 25μ
L。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510236760.7A CN104862394B (en) | 2015-05-11 | 2015-05-11 | It is a kind of for detecting the primer and its methods and applications of Escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510236760.7A CN104862394B (en) | 2015-05-11 | 2015-05-11 | It is a kind of for detecting the primer and its methods and applications of Escherichia coli |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104862394A CN104862394A (en) | 2015-08-26 |
| CN104862394B true CN104862394B (en) | 2019-02-12 |
Family
ID=53908564
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510236760.7A Expired - Fee Related CN104862394B (en) | 2015-05-11 | 2015-05-11 | It is a kind of for detecting the primer and its methods and applications of Escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104862394B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108796099A (en) * | 2018-06-13 | 2018-11-13 | 华南理工大学 | A kind of Escherichia coli O 157:PSR detection primers, kit and its detection method of H7 |
| CN110229916A (en) * | 2019-06-06 | 2019-09-13 | 昆明理工大学 | A kind of primer of Escherichia coli specific gene and the method for detecting Escherichia coli |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003062464A2 (en) * | 2002-01-23 | 2003-07-31 | Her Majesty, The Queen In Right Of Canada, As Represented By The Minister Of Health | Major virulence factor detection and verocytotoxin type 2 subtype from clinical e. coli isolates using a one-step multiplex pcr |
| CN101153331A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting bacillus coli O157:H7 |
| CN103451305A (en) * | 2013-09-17 | 2013-12-18 | 北京卓诚惠生生物科技有限公司 | Primers, probe, method and kit for detecting diffusely adherent Escherichia coli |
| CN103468797A (en) * | 2013-08-13 | 2013-12-25 | 无锡中德伯尔生物技术有限公司 | Kit for rapid and accurate detection of Escherichia coli O157:H7 live bacterium and its detection method |
| CN103866031A (en) * | 2014-04-02 | 2014-06-18 | 江苏省农业科学院 | PCR (polymerase chain reaction) detection primer and detection kit for escherichia coli 0157: H7 |
-
2015
- 2015-05-11 CN CN201510236760.7A patent/CN104862394B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003062464A2 (en) * | 2002-01-23 | 2003-07-31 | Her Majesty, The Queen In Right Of Canada, As Represented By The Minister Of Health | Major virulence factor detection and verocytotoxin type 2 subtype from clinical e. coli isolates using a one-step multiplex pcr |
| CN101153331A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting bacillus coli O157:H7 |
| CN103468797A (en) * | 2013-08-13 | 2013-12-25 | 无锡中德伯尔生物技术有限公司 | Kit for rapid and accurate detection of Escherichia coli O157:H7 live bacterium and its detection method |
| CN103451305A (en) * | 2013-09-17 | 2013-12-18 | 北京卓诚惠生生物科技有限公司 | Primers, probe, method and kit for detecting diffusely adherent Escherichia coli |
| CN103866031A (en) * | 2014-04-02 | 2014-06-18 | 江苏省农业科学院 | PCR (polymerase chain reaction) detection primer and detection kit for escherichia coli 0157: H7 |
Non-Patent Citations (3)
| Title |
|---|
| "A comparison of methods for the detection of Escherichia coli O157:H7 from artificially-contaminated dairy products using PCR";Mckillip J L等;《Journal of Applied Microbiology》;20000731;第89卷(第1期);第49-55页 |
| "Escherichia coli UMN026, complete genome";Genoscope -,C.E.A;《GenBank：NC_011751.1》;20081214;第1页 |
| "大肠杆菌O157:H7分子检测方法及部分耐药基因标识研究";衣洪岩;《中国博士学位论文全文数据库 农业科技辑》;20051015;正文第33-39页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104862394A (en) | 2015-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230183817A1 (en) | Crispr-based assay for detecting pathogens in samples | |
| Mourez et al. | Polyomaviruses KI and WU in immunocompromised patients with respiratory disease | |
| CN109266658B (en) | Acinetobacter baumannii specific gene and primer and application thereof | |
| CN110229916A (en) | A kind of primer of Escherichia coli specific gene and the method for detecting Escherichia coli | |
| CN102618655A (en) | Loop-mediated isotherm amplification (LAMP) kit for detecting mycoplasma pneumoniae (Mp) | |
| CN107164475A (en) | The IC LAMP detection primers group of Shigella and its application | |
| CN107365869B (en) | Method and primer for detecting Klebsiella pneumoniae by loop-mediated isothermal amplification technology | |
| CN104862394B (en) | It is a kind of for detecting the primer and its methods and applications of Escherichia coli | |
| CN101550452A (en) | Human bocavirus real-time fluorescence PCR detection reagent kit | |
| CN103981284B (en) | A kind of method and test kit detecting foot and mouth disease virus in aerosol | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| US11098380B2 (en) | Reagent and method for rapid detection of porcine adenovirus | |
| Pelosi et al. | Development of a Taqman real-time PCR assay for detection of Leifsonia xyli subsp xyli | |
| Kamusoko et al. | Purification and Amplification of DNA from cellulolytic Bacteria: Application for Biogas production from crop residues | |
| CN102952888A (en) | Method for detecting ureaplasma urealyticum and tiny urealyticum | |
| CN110511987A (en) | A kind of PCR detection method of the Listeria monocytogenes based on specific gene target lmo1341 | |
| Shulman et al. | Molecular characterization of polio from environmental samples: ISSP, the Israeli sewage surveillance protocol | |
| CN104726565A (en) | Method for fast detecting staphylococcus epidermidis | |
| CN107746893A (en) | The IC LAMP detection primers group of salmonella and its application | |
| CN104894235B (en) | A kind of purposes of staphylococcus aureus specific gene | |
| CN104894234B (en) | A kind of application of staphylococcus epidermis specific gene | |
| CN113755614A (en) | Rapid high-sensitivity differential diagnosis kit for Brucella vaccine strain and wild strain and use method thereof | |
| CN106636407A (en) | Distinguished sequence based salmonella detection primer, kit and detection method of salmonella | |
| CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
| CN111534611A (en) | Fluorescent quantitative PCR method for detecting toxigenic streptococcus suis and corresponding kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190212 Termination date: 20200511 |