CN102719535B

CN102719535B - Method for rapidly detecting listeria monocytogenes in food

Info

Publication number: CN102719535B
Application number: CN201210177173.1A
Authority: CN
Inventors: 魏华; 徐锋; 杨友均; 郭亮; 许恒毅; 赖卫华; 熊勇华
Original assignee: Nanchang University
Current assignee: Nanchang University
Priority date: 2012-06-01
Filing date: 2012-06-01
Publication date: 2014-02-26
Anticipated expiration: 2032-06-01
Also published as: CN102719535A

Abstract

The invention discloses a method for detecting listeria monocytogenes in food by loop-mediated isothermal amplification (LAMP). A set of specificity detecting primers are designed and screened for the listeria monocytogenes, a food sample to be detected is detected by LAMP, whether specific gene segments of the listeria monocytogenes exist or not is confirmed, and whether the food sample to be detected is polluted by the listeria monocytogenes or not is further determined. In addition, before the LAMP detection, the food sample is treated with azide propidium bromide to remove the disturbance of dead bacteria, and only the detection signals of live bacteria can exist in the follow-up LAMP detection. The detection method disclosed by the invention has high sensitivity, strong specificity and short detection time, an expensive experimental instrument is not needed, the operation process is simple and can not be disturbed by the residual DNA or the dead bacteria in the food sample, and the method is especially suitable for self detection in the open air, and in grass-roots detecting organizations and food enterprises.

Description

The method of listeria monocytogenes in rapid detection food

Technical field

The invention belongs to microorganism detection field, relate in particular to the method for listeria monocytogenes in a kind of rapid detection food.

Technical background

At present, listeria comprises 8 kinds altogether, and the listeria bacteria of most human infections all with listeria monocytogenes ( l. monocytogenes) relevant.For non-pregnant woman individuality, listeria monocytogenes infection can cause meningitis and meningoencephalitis; For pregnant woman, main infection is unborn baby also.In course of infection, listeria monocytogenes can be from a cellular invasion to other contiguous cells.Conventionally listeria monocytogenes can be found in rotten plant materials and earth, and it also can enter in the body of domestic animal also field planting at its gi tract by drinking-water and food simultaneously.People know from experience because of meat or the milk of edible infected domestic animal ill.The edible food that polluted by listeria monocytogenes, such as cheese, sausage, milk etc., is the main path of its infection, its lethality rate can be up to 30%.

Edible domestic animal and related products thereof are the main sources that listeria monocytogenes pollutes.Therefore,, in order to ensure food safety, at the links of foodstuffs production, control microbiological contamination quite important.At present, for listeria monocytogenes, detect main method or culture method and serological detection method, comprise that enrichment, selectivity are cultivated, biochemical identification.Serotype, also will carry out toxicity detection sometimes.As (Yang Ruijun, pathogenic microbes detect interpretation of result [J] Chinese Journal of Health Laboratory Technology .2009:19(9 in meat product) 2122-2125), traditional method has the shortcomings such as labour intensity is high, consuming time, expense is high.In addition, traditional technique in measuring remolding sensitivity is lower and specificity is not strong, and especially for the close bacterial strain in source, traditional method is difficult to be distinguished by the mode of Physiology and biochemistry.Therefore,, in order to ensure food safety, be badly in need of fast, simply, method detects the listeria monocytogenes in food accurately.

Summary of the invention

The present invention is that object is for the deficiencies in the prior art, provide a kind of testing cost low, easy to use, detect rapidly and efficiently, highly sensitive listeria monocytogenes method for quick.

Above-mentioned purpose of the present invention is achieved by following technical solution:

Comprise the steps:

(1) take food sample, with damping fluid, mill and make homogenate, the swill that centrifugal removal is large, gets supernatant and obtains bacteria suspension, has suffered Cheng Junwei aseptic technique; Damping fluid is PBS phosphate buffered saline buffer.

(2) get the bacteria suspension preparing and add nitrine bromination the third pyridine (PMA) solution, the whole mass concentration that makes PMA is 3 μ g/mL, mix rear room temperature lucifuge cultivation 3 ~ 8min(and be preferably 5min), halogen lamp exposure, when illumination is crosslinked, sample is placed on ice, suspension after crosslinked is centrifugal, and gained precipitation is extracted DNA with Boiling bath method; PMA solution preparation method is that PMA is dissolved in methyl-sulphoxide (DMSO), is mixed with the PMA solution of 0.5 mg/mL, and-20 ℃ keep in Dark Place.

(3) get DNA, carry out LAMP reaction, LAMP reacts primer used and is:

Upstream outer primer F3(5 ' → 3 '): AAGCTGCTTTTGATGCTG

Downstream outer primer B3(5 ' → 3 '): TCGATTAAAAGTAGCGCCTT

Upstream inner primer FIP(5 ' → 3 '): CGGCTTTGAAGGAAGAATTTTTGAT-CGTAAGCGGAAAATCTGTC

Downstream inner primer BIP(5 ' → 3 '): TACGGAGGTTCCGCAAAAGA-TTTTCAAAATATCGCGTAAGTCTC

Upper lantern primer LF(5 ' → 3 '): ATTTGTTAGTTCTACATCACCTG

Lower lantern primer LB(5 ' → 3 '): AAGTTCAAATCATCGACGGC

In order to reach better reaction effect, LAMP reaction conditions is: 0.8 M trimethyl-glycine, 2 mM MgSO4,1.4 mM dNTP, 1.6 uM inner primer FIP/BIP, 0.4 uM outer primer F3/B3,0.8 uM ring primer LF/LB; By amplification reaction system in 62 ^oc is hatched 45 min, 85 ^oc is hatched 5 min, termination reaction.

(4), after LAMP reaction finishes, extract reaction solution and detect listeria monocytogenes existence.Extract reaction solution and detect listeria monocytogenes and exist and can detect pcr amplification result for extracting reaction solution with agarose gel electrophoresis, if there is gradient band to be in, and minimum band is 180 bp, and explanation has listeria monocytogenes to exist; Or extract reaction solution and add SYBR green I fluoroscopic examination, green if reaction solution occurs, explanation has listeria monocytogenes to exist.

Compared with prior art, the present invention has following beneficial effect:

1, adopt the time of detection listeria monocytogenes of the present invention shorter, can in 2.5 hours, obtain result, the present invention has simultaneously overcome the defect that general molecular biology for detection cannot be distinguished dead bacterium and viable bacteria;

2, the present invention is directed to the specific gene design Auele Specific Primer of listeria monocytogenes, and specific reaction conditions, can be at 62 ° of C, in 45 min, go out result.

3, extract reaction solution and detect listeria monocytogenes existence, can directly can pass through Fluirescence observation without electrophoresis detection, easy and simple to handle, result is judged simple, has reduced testing cost.

Listeria monocytogenes is as a kind of main food-borne pathogens, in public health, food safety.Beast is herded detection index necessary in animal doctor and inspection and quarantining for import/export.Along with growing with each passing day of socioeconomic development and the quantum of international trade.Urgent need is set up a kind of a kind of quick, accurate, easy method of detecting bacterium from rural area to dining table.The LAMP detection technique that combines PMA processing has more significance.

Accompanying drawing explanation

Fig. 1 LAMP amplification, the positive contrast of PC, the negative contrast of NC.(A) there is white precipitate at the pipe end in PC under natural lighting condition, and NC reaction solution is clear liquor; (B) under natural lighting condition, add after SYBR green I, PC occurs green, it is faint yellow that NC is; (C) under ultraviolet lighting condition, add after SYBR green I, there is bright green in PC, it is faint yellow that NC is; (D) after 2% agarose gel electrophoresis, there is stepped band in PC, any band of NC thing.

Fig. 2 PMA processes the interference of removing dead listeria monocytogenes.(A) listeria monocytogenes alive and the dead Listeria monocytogenes group of the thermic DNA extraction result through PMA, processing or do not process; (B) result that (C) LAMP that each genome of extracting of combination carries out as template detects.Each concentration of organizing listeria monocytogenes is 10 ⁶cFU/mL.

The specificity checking that Fig. 3 LAMP detects.

The sensitivity checking that Fig. 4 LAMP detects.1-5 is non-is not the listeria monocytogenes of 10 gradient dilutions, and its concentration is from 1.2 * 10 ⁵to 1.2 * 10 ¹cFU/mL.

Specific embodiments

Below in conjunction with specific embodiment, further explain the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.In the following example, unreceipted actual conditions is experimental technique, conventionally according to the condition in normal condition, or according to the suggestion condition of manufacturer, the bacterial strain relating in embodiment all belongs to prior art, those skilled in the art can be at an easy rate from being openly commercial channel acquisition.

Embodiment

1. food sample pre-treatment

Take the food sample of 1 g, add the phosphate buffered saline buffer (PBS) of 9ml, mill and make homogenate, centrifugal 5 min of 900 g, remove large swill, get supernatant (the necessary aseptic technique of this process).

2.PMA processes

PMA is dissolved in methyl-sulphoxide (DMSO), is mixed with the PMA solution of 0.5 mg/mL, and-20 ℃ keep in Dark Place.Get the bacteria suspension that 500 μ L prepare and be placed in 1.5 mL Eppendorf tubes, add the PMA solution of 3 μ L 0.5 mg/mL, the whole mass concentration that makes PMA is 3 μ g/mL; PMA after mixing with bacteria suspension at ambient temperature lucifuge cultivate 5 min, utilize the halogen lamp of 500 W, 5 min that expose, when illumination is crosslinked, sample is placed on ice (avoiding overheated), and apart from light source 20 cm places, suspension after crosslinked is in centrifugal 5 min of 10000 g, and gained precipitation is for the extraction of DNA.

3. the extraction of genomic dna

The sample obtaining through step 2 is in 10000 g, 4 ^oCunder condition, centrifugal 5 min, abandon supernatant, and carefully siphon away residual liquid, add the aseptic deionized water 100 of 30 μ l ^oc boils 10 min, 12000 g after cooling, 4 ^oCcentrifugal 5 min under condition, get supernatant as LAMP reaction template, the template of preparation should be immediately for detection of.

4. choose target spot and design primer

(2) LAMP detects: by amplification reaction system in 62 ^oc is hatched 45 min, 85 ^oc is hatched 5 min, termination reaction:

Described 25 μ L amplification reaction systems comprise: 2.5 μ L 10 * thermal buffer (200 mM Tris – HCl, 100 mM KCl, 100 mM (NH ₄) ₂sO ₄, 80 mM MgSO ₄, 1% (w/v) Triton X-100, pH 8.8), 0.8 M trimethyl-glycine (Sigma, Santa Clara, CA), 2 mM MgSO ₄, 1.4 mM/dNTP (TaKaRa, Dalian, China), 1.6 uM FIP/BIP, 0.4 uM F3/B3,0.8 uM LF/LB, 1.0 μ L (8 U) bstdNA polysaccharase (8000 U/mL, New England Biolabs, Beijing, China), 5 μ L template DNAs, add sterilized water to 25 μ L.

LAMP react online software for primer pair used ( http:// primerexplorer.jp/e/index.html) design:

Upstream outer primer F3(5 ' → 3 '): AAGCTGCTTTTGATGCTG

Downstream outer primer B3(5 ' → 3 '): TCGATTAAAAGTAGCGCCTT

Upper lantern primer LF(5 ' → 3 '): ATTTGTTAGTTCTACATCACCTG

Lower lantern primer LB(5 ' → 3 '): AAGTTCAAATCATCGACGGC

The condition of groping LAMP reaction, comprises temperature of reaction, reaction times, Mg ²⁺concentration, trimethyl-glycine concentration etc.The optimal conditions that finally draws this LAMP reaction is: 0.8 M trimethyl-glycine, 2 mM MgSO4,1.4 mM dNTP, 1.6 uM inner primer FIP/BIP, 0.4 uM outer primer F3/B3,0.8 uM ring primer LF/LB, temperature of reaction is 62 ° of C, and the reaction times is 45 min.Choose optimum condition, and the bacterial strain of adopting table 1 and providing carries out primer specificity checking, the numbering of bacterial strain and source are in Table 1.

Table 1 strains tested and detected result

Figure 2012101771731100002DEST_PATH_IMAGE001

^ajX-CDC, disease prevention and control center, Jiangxi Province, China; ^bnCTC, national typical DSMZ, Britain

^caTCC, U.S. typical case DSMZ, the U.S.; ^dcMCC, Chinese medicine DSMZ, China

5.LAMP amplification detects

(1) after LAMP reaction finishes, with rifle head, draw 5 μ l reaction solutions, be added in the loading hole of 2% sepharose, 85 V electrophoresis 30 min, take out gel piece, in ultraviolet imagery system, observe electrophoretic band, and Taking Pictures recording.Determine and in sample, whether have the specific standards of object bacterium to be: with agarose gel electrophoresis, detect pcr amplification result, if there is gradient band to be in, and minimum band is 180 bp, and explanation has listeria monocytogenes to exist.

(2) in reaction solution, add 1 μ l SYBR green I, determine and in sample, whether have the specific standards of object bacterium to be: green if reaction solution occurs, explanation has listeria monocytogenes to exist.

The specificity checking that Fig. 3 LAMP detects.

The test of the strains tested by table 1 proves, implements detection method of the present invention and detects and have good specificity, has good detection effect.Detection completed in 2.5 hours.

SEQUENCE LISTING

<110> University Of Nanchang

The method of listeria monocytogenes in <120> rapid detection food

<130> 2012

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 18

<212> DNA

<213> artificial sequence

<400> 1

aagctgcttttgatgctg 18

<210> 2

<211> 20

<212> DNA

<213> artificial sequence TCGATTAAAAGTAGCGCCTT

<400> 2

aagttcaaatcatcgacggc 20

<210> 3

<211> 44

<212> DNA

<213> artificial sequence

<400> 3

cggctttgaaggaagaatttttgatcgtaagcggaaaatctgtc 44

<210> 4

<211> 44

<212> DNA

<213> artificial sequence

<400> 4

tacggaggttccgcaaaagattttcaaaatatcgcgtaagtctc 44

<210> 5

<211> 23

<212> DNA

<213> artificial sequence

Claims

The listeria monocytogenes of 1. living in a rapid detection food ( listeria monocytogenes) detection method, it is characterized in that comprising the steps:

(1) take food sample, with damping fluid, mill and make homogenate, the swill that centrifugal removal is large, gets supernatant and obtains bacteria suspension, and process is aseptic technique;

(2) get the bacteria suspension preparing and add nitrine bromination the third pyridine solution, the whole mass concentration that makes the third pyridine of nitrine bromination is 3 μ g/mL, mix rear room temperature lucifuge and cultivate 3 ~ 8min, halogen lamp exposure, when illumination is crosslinked, sample is placed on ice, suspension after crosslinked is centrifugal, and gained precipitation is extracted DNA with Boiling bath method;

(3) get DNA, carry out LAMP reaction, LAMP reacts primer used and is:

Upstream outer primer F3(5 ' → 3 '): AAGCTGCTTTTGATGCTG

Downstream outer primer B3(5 ' → 3 '): TCGATTAAAAGTAGCGCCTT

Upstream inner primer FIP(5 ' → 3 '): CGGCTTTGAAGGAAGAATTTTTGAT-CGTAAGCGGAAAATCTGTC

Downstream inner primer BIP(5 ' → 3 '): TACGGAGGTTCCGCAAAAGA-TTTTCAAAATATCGCGTAAGTCTC

Upper lantern primer LF(5 ' → 3 '): ATTTGTTAGTTCTACATCACCTG

Lower lantern primer LB(5 ' → 3 '): AAGTTCAAATCATCGACGGC

(4), after LAMP reaction finishes, extract reaction solution and detect listeria monocytogenes existence.
2. the method for claim 1, is characterized in that: the described damping fluid of step (1) is PBS phosphate buffered saline buffer.
3. the method for claim 1, it is characterized in that: described nitrine bromination the third pyridine solution preparation method of step (2) is that the third pyridine of nitrine bromination is dissolved in methyl-sulphoxide (DMSO), nitrine bromination the third pyridine solution that is mixed with 0.5 mg/mL ,-20 ℃ keep in Dark Place.
4. the method for claim 1, is characterized in that: in step (2), mix rear room temperature lucifuge and cultivate 5min.
5. the method for claim 1, is characterized in that: the described LAMP reaction conditions of step (3) is: 0.8 M trimethyl-glycine, 2 mM MgSO ₄, 1.4 mM dNTP, 1.6 uM inner primer FIP/BIP, 0.4 uM outer primer F3/B3,0.8 uM ring primer LF/LB; By amplification reaction system in 62 ^oc is hatched 45 min, 85 ^oc is hatched 5 min, termination reaction.
6. the method for claim 1, it is characterized in that: described in step (4), extract reaction solution and detect listeria monocytogenes and exist for to extract reaction solution with agarose gel electrophoresis and detect pcr amplification result, if there is gradient band to be in, and minimum band is 180 bp, explanation has listeria monocytogenes to exist; Or extract reaction solution and add SYBR green I fluoroscopic examination, green if reaction solution occurs, explanation has listeria monocytogenes to exist.