CN102719535A

CN102719535A - Method for rapidly detecting listeria monocytogenes in food

Info

Publication number: CN102719535A
Application number: CN2012101771731A
Authority: CN
Inventors: 魏华; 徐锋; 杨友均; 郭亮; 许恒毅; 赖卫华; 熊勇华
Original assignee: Nanchang University
Current assignee: Nanchang University
Priority date: 2012-06-01
Filing date: 2012-06-01
Publication date: 2012-10-10
Anticipated expiration: 2032-06-01
Also published as: CN102719535B

Abstract

The invention discloses a method for detecting listeria monocytogenes in food by loop-mediated isothermal amplification (LAMP). A set of specificity detecting primers are designed and screened for the listeria monocytogenes, a food sample to be detected is detected by LAMP, whether specific gene segments of the listeria monocytogenes exist or not is confirmed, and whether the food sample to be detected is polluted by the listeria monocytogenes or not is further determined. In addition, before the LAMP detection, the food sample is treated with azide propidium bromide to remove the disturbance of dead bacteria, and only the detection signals of live bacteria can exist in the follow-up LAMP detection. The detection method disclosed by the invention has high sensitivity, strong specificity and short detection time, an expensive experimental instrument is not needed, the operation process is simple and can not be disturbed by the residual DNA or the dead bacteria in the food sample, and the method is especially suitable for self detection in the open air, and in grass-roots detecting organizations and food enterprises.

Description

The method of listeria monocytogenes in the rapid detection food

Technical field

The invention belongs to the microorganism detection field, relate in particular to the method for listeria monocytogenes in a kind of rapid detection food.

Technical background

At present, listeria comprises 8 kinds altogether, and the listeria bacteria of most human infections all with listeria monocytogenes ( L. monocytogenes) relevant.For non-pregnant woman individuality, the listeria monocytogenes infection can cause meningitis and meningoencephalitis; For the pregnant woman, the main infection gone back the unborn baby.Listeria monocytogenes can be from a cellular invasion to other contiguous cells in course of infection.Usually listeria monocytogenes can be found in septic plant materials and earth, simultaneously it also can get into domestic animal through drinking-water and food the interior also field planting of body at its gi tract.The people know from experience because of meat or the milk of edible infected domestic animal ill.The edible food that polluted by listeria monocytogenes, for example cheese, sausage, milk etc. are the main paties of its infection, its lethality rate can be up to 30%.

Edible domestic animal and related prods thereof are the main sources that listeria monocytogenes pollutes.Therefore, in order to ensure food safety, quite important in the pollution of each link controlling microbial of foodstuffs prodn.At present, detecting main method for listeria monocytogenes still is culture method and serological detection method, comprises that enrichment, selectivity are cultivated, biochemical identification.Serotype also will carry out toxicity sometimes and detect.Like (Yang Ruijun, the pathogenic bacterium detected result is analyzed [J] Chinese sanitary inspection magazine .2009:19 (9) 2122-2125 in the meat product), traditional method has shortcomings such as labour intensity height, consuming time, expense height.In addition, the traditional technique in measuring remolding sensitivity is lower and specificity is not strong, and especially for the close bacterial strain in source, traditional method is difficult to distinguish through the mode of Physiology and biochemistry.Therefore, in order to ensure food safety, be badly in need of fast, simply, method detects the listeria monocytogenes in the food accurately.

Summary of the invention

The present invention is that purpose is the deficiency to prior art, provide a kind of detect cost low, easy to use, detect rapidly and efficiently, highly sensitive listeria monocytogenes method for quick.

Above-mentioned purpose of the present invention is achieved through following technical scheme:

Comprise the steps:

(1) get food sample, mill with damping fluid and process homogenate, the swill that centrifugal removal is big is got supernatant and is got bacteria suspension, has suffered the Cheng Junwei aseptic technique; Damping fluid is the PBS phosphate buffered saline buffer.

(2) get the bacteria suspension for preparing and add nitrine bromination third pyridine (PMA) solution; The whole mass concentration that makes PMA is 3 μ g/mL; The room temperature lucifuge is cultivated 3 ~ 8min (being preferably 5min) behind the mixing, the halogen lamp exposure, and sample placed on ice when illumination was crosslinked; Suspension-s after crosslinked is centrifugal, and the gained deposition is extracted DNA with the boiling water bath method; PMA solution compound method is that PMA is dissolved in the methyl-sulphoxide (DMSO), is mixed with the PMA solution of 0.5 mg/mL, and-20 ℃ keep in Dark Place.

(3) get DNA, carry out the LAMP reaction, the used primer of LAMP reaction is:

Upper reaches outer primer F3 (5 ' → 3 '): AAGCTGCTTTTGATGCTG

Downstream outer primer B3 (5 ' → 3 '): TCGATTAAAAGTAGCGCCTT

Upper reaches inner primer FIP (5 ' → 3 '): CGGCTTTGAAGGAAGAATTTTTGAT-CGTAAGCGGAAAATCTGTC

Downstream inner primer BIP (5 ' → 3 '): TACGGAGGTTCCGCAAAAGA-TTTTCAAAATATCGCGTAAGTCTC

Upper reaches ring primer LF (5 ' → 3 '): ATTTGTTAGTTCTACATCACCTG

Downstream ring primer LB (5 ' → 3 '): AAGTTCAAATCATCGACGGC

In order to reach better reaction effect, the LAMP reaction conditions is: 0.8 M trimethyl-glycine, 2 mM MgSO4,1.4 mM dNTP, 1.6 uM inner primer FIP/BIP, 0.4 uM outer primer F3/B3,0.8 uM ring primer LF/LB; With amplification reaction system in 62 ^oC is hatched 45 min, 85 ^oC is hatched 5 min, termination reaction.

(4) after the LAMP reaction finishes, get reaction solution and detect the listeria monocytogenes existence.Get reaction solution and detect listeria monocytogenes and exist and can answer liquid for negate and detect the pcr amplification result with agarose gel electrophoresis, if there is the gradient band to be in, and minimum band is 180 bp, and then explanation has listeria monocytogenes to exist; Or get reaction solution adding SYBR green I fluoroscopic examination, green if reaction solution occurs, then explanation has the listeria monocytogenes existence.

Compared with prior art, the present invention has following beneficial effect:

1, adopt the time of detection listeria monocytogenes of the present invention shorter, can in 2.5 hours, obtain the result, the present invention has simultaneously overcome the defective that general molecular Biological Detection method can't be distinguished dead bacterium and viable bacteria;

2, the present invention is directed to the specific gene design specific primers of listeria monocytogenes, and specific reaction conditions, can be at 62 ° of C, go out the result in 45 min.

3, get reaction solution and detect the listeria monocytogenes existence, can need not electrophoresis detection, directly can pass through Fluirescence observation, easy and simple to handle, the result judges simply, has reduced the detection cost.

Listeria monocytogenes is as a kind of main food-borne pathogens, in public health, food safety.Beast is herded detection index necessary in animal doctor and the inspection and quarantining for import/export.Along with growing with each passing day of the The development in society and economy and the quantum of international trade.Urgent need is set up a kind of a kind of quick, accurate, easy method of detecting bacterium from the rural area to the dining table.In conjunction with the LAMP detection technique handled of PMA have more significance.

Description of drawings

Fig. 1 LAMP amplification, the positive contrast of PC, the negative contrast of NC.(A) PC white precipitate occurs at the pipe end under the natural lighting condition, and the NC reaction solution is a clear liquor; (B) under the natural lighting condition, behind the adding SYBR green I, PC occurs green, and it is faint yellow that NC is; (C) under the ultraviolet lighting condition, behind the adding SYBR green I, bright green appears in PC, and it is faint yellow that NC is; (D) behind 2% agarose gel electrophoresis, stepped band appears in PC, any band of NC thing.

Fig. 2 PMA handles the interference of removing dead listeria monocytogenes.(A) listeria monocytogenes alive and the dead Listeria monocytogenes group of the thermic DNA extraction result that handle or do not handle through PMA; (B) (C) result that detects of the LAMP that carries out as template of each genome of being extracted of combination.Each concentration of organizing listeria monocytogenes is 10 ⁶CFU/mL.

The specificity checking that Fig. 3 LAMP detects.

The sensitivity checking that Fig. 4 LAMP detects.1-5 is non-not to be the listeria monocytogenes of 10 gradient dilutions, and its concentration is from 1.2 * 10 ⁵To 1.2 * 10 ¹CFU/mL.

Specific embodiments

Below in conjunction with specific embodiment, further explain the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.Unreceipted actual conditions is an experimental technique in the following example; Usually according to the condition in the normal condition; Or according to the suggestion condition of manufacturer, the bacterial strain that relates among the embodiment all belongs to prior art, those skilled in the art can be at an easy rate from openly being that the commercial channel obtains.

Embodiment

1. food sample pre-treatment

Take by weighing the food sample of 1 g, add the phosphate buffered saline buffer (PBS) of 9ml, mill and process homogenate, centrifugal 5 min of 900 g remove big swill, get supernatant (the necessary aseptic technique of this process).

2.PMA handle

PMA is dissolved in the methyl-sulphoxide (DMSO), is mixed with the PMA solution of 0.5 mg/mL, and-20 ℃ keep in Dark Place.Get the bacteria suspension that 500 μ L prepare and place 1.5 mL Eppendorf tubes, add the PMA solution of 3 μ L, 0.5 mg/mL, the whole mass concentration that makes PMA is 3 μ g/mL; After PMA and bacteria suspension mix at ambient temperature lucifuge cultivate 5 min; Utilize the halogen lamp of 500 W, 5 min that make public; Sample placed on ice (avoiding overheated) when illumination was crosslinked; And apart from light source 20 cm places, the suspension-s after crosslinked is in centrifugal 5 min of 10000 g, and the gained deposition is used for the extraction of DNA.

3. the extraction of genomic dna

The sample that obtains through step 2 is in 10000 g, 4 ^OCCentrifugal 5 min abandon supernatant, and carefully siphon away residual liquid under the condition, add the aseptic deionized water 100 of 30 μ l ^oC boils 10 min, 12000 g after cooling, 4 ^OCCentrifugal 5 min under the condition get supernatant as the LAMP reaction template, and the template of preparation should be used for detecting immediately.

4. choose target spot and design primer

(2) LAMP detects: with amplification reaction system in 62 ^oC is hatched 45 min, 85 ^oC is hatched 5 min, termination reaction:

Said 25 μ L amplification reaction systems comprise: 2.5 μ L, 10 * thermal buffer (200 mM Tris – HCl, 100 mM KCl, 100 mM (NH ₄) ₂SO ₄, 80 mM MgSO ₄, 1% (w/v) Triton X-100, pH 8.8), 0.8 M trimethyl-glycine (Sigma, Santa Clara, CA), 2 mM MgSO ₄, 1.4 mM/dNTP (TaKaRa, Dalian, China), 1.6 uM FIP/BIP, 0.4 uM F3/B3,0.8 uM LF/LB, 1.0 μ L (8 U) BstDNA polysaccharase (8000 U/mL, New England Biolabs, Beijing, China), 5 μ L template DNAs add sterilized water to 25 μ L.

The used primer of LAMP reaction to online software ( Http:// primerexplorer.jp/e/index.html) design:

Upper reaches outer primer F3 (5 ' → 3 '): AAGCTGCTTTTGATGCTG

Downstream outer primer B3 (5 ' → 3 '): TCGATTAAAAGTAGCGCCTT

Upper reaches ring primer LF (5 ' → 3 '): ATTTGTTAGTTCTACATCACCTG

Downstream ring primer LB (5 ' → 3 '): AAGTTCAAATCATCGACGGC

Grope the condition of LAMP reaction, comprise temperature of reaction, reaction times, Mg ²⁺Concentration, trimethyl-glycine concentration etc.The optimal conditions that finally draws this LAMP reaction is: 0.8 M trimethyl-glycine, 2 mM MgSO4,1.4 mM dNTP; 1.6 uM inner primer FIP/BIP, 0.4 uM outer primer F3/B3,0.8 uM ring primer LF/LB; Temperature of reaction is 62 ° of C, and the reaction times is 45 min.Choose optimum condition, and the bacterial strain of adopting table 1 and providing carries out the primer specificity checking, table 1 is seen in the numbering and the source of bacterial strain.

Table 1 strains tested and detected result

Figure 2012101771731100002DEST_PATH_IMAGE001

^aJX-CDC, Jiangxi Province's disease prevention and control center, China; ^bNCTC, national typical DSMZ, Britain

^cATCC, U.S. typical case DSMZ, the U.S.; ^dCMCC, Chinese medicine DSMZ, China

5.LAMP amplification detects

(1) after the LAMP reaction finishes, draw 5 μ l reaction solutions with the rifle head, be added in the upward appearance hole of 2% sepharose, 85 V electrophoresis, 30 min take out gel piece, in the ultraviolet imagery system, observe electrophoretic band, and Taking Pictures recording.Whether confirm to have in the sample the concrete standard of purpose bacterium to be: detect the pcr amplification result with agarose gel electrophoresis, if there is the gradient band to be in, and minimum band is 180 bp, and then explanation has listeria monocytogenes to exist.

Whether (2) in reaction solution, add 1 μ l SYBR green I, confirm to have in the sample the concrete standard of purpose bacterium to be: green if reaction solution occurs, then explanation has listeria monocytogenes to exist.

The specificity checking that Fig. 3 LAMP detects.

The test of the strains tested through table 1 proves that the detection method of embodiment of the present invention detects has excellent specificity, and good detection effect is arranged.Detection was accomplished in 2.5 hours.

SEQUENCE?LISTING

< 110>University Of Nanchang

< 120>method of listeria monocytogenes in the rapid detection food

<130> 2012

<160> 6

<170> PatentIn?version?3.3

<210> 1

<211> 18

<212> DNA

< 213>artificial sequence

<400> 1

aagctgcttttgatgctg 18

<210> 2

<211> 20

<212> DNA

< 213>artificial sequence TCGATTAAAAGTAGCGCCTT

<400> 2

aagttcaaatcatcgacggc 20

<210> 3

<211> 44

<212> DNA

< 213>artificial sequence

<400> 3

cggctttgaaggaagaatttttgatcgtaagcggaaaatctgtc 44

<210> 4

<211> 44

<212> DNA

< 213>artificial sequence

<400> 4

tacggaggttccgcaaaagattttcaaaatatcgcgtaagtctc 44

<210> 5

<211> 23

<212> DNA

< 213>artificial sequence

Claims

The listeria monocytogenes of 1. living in the rapid detection food ( Listeria monocytogenes) detection method, it is characterized in that comprising the steps:

(1) get food sample, mill with damping fluid and process homogenate, the swill that centrifugal removal is big is got supernatant and is got bacteria suspension, has suffered the Cheng Junwei aseptic technique;

(2) get the bacteria suspension for preparing and add the nitrine bromination third pyridine solution; The whole mass concentration that makes third pyridine of nitrine bromination is 3 μ g/mL; The room temperature lucifuge is cultivated 3 ~ 8min behind the mixing, the halogen lamp exposure, and sample placed on ice when illumination was crosslinked; Suspension-s after crosslinked is centrifugal, and the gained deposition is extracted DNA with the boiling water bath method;

(3) get DNA, carry out the LAMP reaction, the used primer of LAMP reaction is:

Upper reaches outer primer F3 (5 ' → 3 '): AAGCTGCTTTTGATGCTG

Downstream outer primer B3 (5 ' → 3 '): TCGATTAAAAGTAGCGCCTT

Upper reaches inner primer FIP (5 ' → 3 '): CGGCTTTGAAGGAAGAATTTTTGAT-CGTAAGCGGAAAATCTGTC

Downstream inner primer BIP (5 ' → 3 '): TACGGAGGTTCCGCAAAAGA-TTTTCAAAATATCGCGTAAGTCTC

Upper reaches ring primer LF (5 ' → 3 '): ATTTGTTAGTTCTACATCACCTG

Downstream ring primer LB (5 ' → 3 '): AAGTTCAAATCATCGACGGC

(4) after the LAMP reaction finishes, get reaction solution and detect the listeria monocytogenes existence.
2. the method for claim 1, it is characterized in that: the described damping fluid of step (1) is the PBS phosphate buffered saline buffer.
3. the method for claim 1, it is characterized in that: the said PMA solution of step (2) compound method is that PMA is dissolved in the methyl-sulphoxide (DMSO), is mixed with the PMA solution of 0.5 mg/mL, and-20 ℃ keep in Dark Place.
4. the method for claim 1 is characterized in that: room temperature lucifuge cultivation 5min behind the mixing in the step (2).
5. the method for claim 1, it is characterized in that: the said LAMP reaction conditions of step (3) is: 0.8 M trimethyl-glycine, 2 mM MgSO4; 1.4 mM dNTP; 1.6 uM inner primer FIP/BIP, 0.4 uM outer primer F3/B3,0.8 uM ring primer LF/LB; With amplification reaction system in 62 ^oC is hatched 45 min, 85 ^oC is hatched 5 min, termination reaction.
6. the method for claim 1; It is characterized in that: step (4) is said gets reaction solution and detects listeria monocytogenes and exist for and get reaction solution and detect the pcr amplification result with agarose gel electrophoresis; If there is the gradient band to be in; And minimum band is 180 bp, and then explanation has listeria monocytogenes to exist; Or get reaction solution adding SYBR green I fluoroscopic examination, green if reaction solution occurs, then explanation has the listeria monocytogenes existence.