CN103848898A - Antigenic mimic epitope Ph3 of bisphenol A and application thereof - Google Patents
Antigenic mimic epitope Ph3 of bisphenol A and application thereof Download PDFInfo
- Publication number
- CN103848898A CN103848898A CN201410053340.0A CN201410053340A CN103848898A CN 103848898 A CN103848898 A CN 103848898A CN 201410053340 A CN201410053340 A CN 201410053340A CN 103848898 A CN103848898 A CN 103848898A
- Authority
- CN
- China
- Prior art keywords
- dihydroxyphenyl propane
- antigenic epitope
- bisphenol
- phage
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to the field of biotechnologies and relates to an antigenic mimic epitope of bisphenol A. The amino acid sequence of the antigenic mimic epitope is YPAYTYNNLMHN. The antigenic mimic epitope of bisphenol A, disclosed by the invention, can replace a bisphenol A standard which is expensive in price and strong in toxicity, is applied to the immunological detection of bisphenol A as a competitive antigen or solid-phase coating antigen, has the immunoreaction characteristics similar to those of natural bisphenol A molecules and has a very good effect, so that the injury to the health of a human body caused by bisphenol A is reduced, the cost is reduced, and the application value is very high.
Description
Technical field
The invention belongs to biological technical field, be specifically related to dihydroxyphenyl propane antigenic epitope and application thereof.
Background technology
Dihydroxyphenyl propane (Bisphenol A, BPA) is a kind of chemical materials, is used for producing breakage-proof plastics.Data shows, dihydroxyphenyl propane belongs to cytotoxic chemical thing.Animal experiment finds that dihydroxyphenyl propane has the estrogenic effect of simulation, even if very low dosage also can make animal produce the effect of female sexual prematurity, sperm count decline, prostate gland growth.In addition, according to the literature, dihydroxyphenyl propane has certain embryotoxicity and teratogenecity.Dihydroxyphenyl propane can cause endocrine disturbance, threatens fetus and children's health, and it is relevant therewith that the obesity that cancer and metabolic disturbance cause is also considered to.In human habitat, dihydroxyphenyl propane is ubiquitous, and from drink bottle, medicine equipment to food product pack inside, a lot of plastics all contain dihydroxyphenyl propane.Even if it is prevention and the effective means of controlling its harm that dihydroxyphenyl propane is carried out detecting.
At present the detection method of dihydroxyphenyl propane is had to liquid phase chromatography, vapor-phase chromatography, spectroscopic analysis, electrochemical methods, immunology detection etc.Although aforesaid method is sensitive, accurate, reliable, required equipment costliness and working cost are high, in being difficult to work in unit of primary level, carry out on a large scale.Immunological detection method is used widely in the detection of dihydroxyphenyl propane with its advantage such as highly sensitive, easy to detect, with low cost.But the method must be used standard substance, not only increase testing cost, and testing staff and environment have easily been worked the mischief, restrict to a certain extent application and the popularization of immunological method.In view of this, people start to adopt antiidiotypic antibody and antigenic epitope technology to realize substituting of harmful small-molecule substance standard substance, and make some progress.The principal feature of phage display peptide library technology is can effectively filter out and the phage-displayed polypeptides of target target body specific combination, this technology exploring the binding site that interacts between acceptor and part, seek the bioactive ligand molecular of high-affinity, the aspect such as development of exploring agnoprotein matter space structure epi-position, new generation vaccine is widely used.
This aspect is by using phage display peptide library technology, from peptide storehouse, filter out can with the polypeptide (antigenic epitope) of target molecule (anti-bisphenol A monoclonal antibody) specific binding.This antigenic epitope has the immune response characteristic with natural dihydroxyphenyl propane molecular mimicry, by the dihydroxyphenyl propane antigenic epitope obtaining, one substitutes the dihydroxyphenyl propane standard substance of expensive and strong toxicity, and is applied to the immunology detection of dihydroxyphenyl propane as competition antigen or solid-phase coating antigen.
Summary of the invention
The object of the present invention is to provide antigenic epitope and the application thereof of dihydroxyphenyl propane.
The present invention, take anti-bisphenol A monoclonal antibody as target molecule, on enzyme plate, drops into target molecule solid-phase coating phage random and shows dodecapeptide storehouse, carries out affine elutriation, has obtained the antigenic epitope Ph3 of dihydroxyphenyl propane.Aminoacid sequence is as follows: YPAYTYNNLMHN.
The nucleotide sequence that the invention still further relates to the above-mentioned antigenic epitope aminoacid sequence of coding, corresponds to respectively: TATCCTGCGTATACGTATAATAATCTTATGCATAAT.
In above-mentioned antigenic epitope (polypeptide) structure, capitalization English letter represents respectively the one of 21 kinds of known natural L-type amino-acid residues or its D-type isomer, be that C represents cysteine residues, D represents asparagicacid residue, P represents proline residue, R represents arginine residues, K represents lysine residue, H represents histidine residues, I represents Isoleucine residue, V represents α-amino-isovaleric acid residue, Y represents tyrosine residues, S represents serine residue, F represents phenylalanine residue, E represents glutaminic acid residue, M represents methionine residues, G represents glycine residue, L represents leucine residue, Q represents glutamine residue, W represents tryptophan residue, N represents asparagine residue, A represents alanine residue, T represents threonine residues.
The preparation method of described antigenic epitope, can prepare in a large number by the recombinant expressed mode of phage amplification, chemosynthesis or genetically engineered; Described phage amplification refers to the phage that displaying is had to dihydroxyphenyl propane antigenic epitope, the mode increasing by biology, and amount reproduction is produced and is shown the bacteriophage particles that has dihydroxyphenyl propane antigenic epitope; Described chemosynthesis refers to according to mimic epitopes mimic epitopes aminoacid sequence, carries out polypeptide synthesize by the mode of chemically synthesized polypeptide; The recombinant expressed mode of described genetically engineered refers to the gene of coding simulation epi-position, by being cloned into expression vector, carries out a large amount of preparations of dihydroxyphenyl propane antigenic epitope with the form of polypeptide-fusion rotein.
The invention still further relates to the application of described dihydroxyphenyl propane antigenic epitope in immunology detection is analyzed.The type of immunology detection comprises the immune analysis type of detection based on Ag-Ab specific reaction such as Enzyme-linked Immunosorbent Assay detection, colloidal gold immunochromatographimethod, immunodotting hybridization.
Dihydroxyphenyl propane antigenic epitope of the present invention (YPAYTYNNLMHN) is in the time of application, can be synthetic mimic epitopes for immunology detection analysis, there is the bacteriophage particles of dihydroxyphenyl propane antigenic epitope (polypeptide) to be directly used in analyzing and testing the displaying obtaining of increasing by phage, certainly, also dihydroxyphenyl propane antigenic epitope can be scaled off and replaces dihydroxyphenyl propane standard substance to carry out immunology detection analysis from phage.
Also relate to the application in immunology detection is analyzed with solid phase antigen or competition antigen of dihydroxyphenyl propane antigenic epitope.
Also relate to dihydroxyphenyl propane antigenic epitope and detect the application in analyzing as solid phase antigen at colloidal gold immunochromatographimethod.
Aforementioned dihydroxyphenyl propane antigenic epitope can replace the dihydroxyphenyl propane standard substance of expensive and strong toxicity, and be applied to the immunology detection of dihydroxyphenyl propane as competition antigen or solid-phase coating antigen, this antigenic epitope has the immune response characteristic of natural dihydroxyphenyl propane molecular mimicry, and effect is very good.
The invention has the beneficial effects as follows: dihydroxyphenyl propane antigenic epitope of the present invention can be replaced the dihydroxyphenyl propane standard substance of expensive and strong toxicity, and be applied to the immunology detection of dihydroxyphenyl propane as competition antigen or solid-phase coating antigen, this antigenic epitope has the immune response characteristic with natural dihydroxyphenyl propane molecular mimicry, and effect is very good.Reduce the harm of dihydroxyphenyl propane to HUMAN HEALTH, saved cost, there is very high using value.
Accompanying drawing explanation
The indirect competitive ELISA typical curve that Fig. 1 sets up with dihydroxyphenyl propane antigenic epitope.Dihydroxyphenyl propane antigenic epitope Ph-3(YPAYTYNNLMNH) be respectively 24pg/ml with the IC50 value of anti-bisphenol A antibody.
Embodiment
Affine elutriation and the evaluation thereof of embodiment 1. dihydroxyphenyl propane antigenic epitopes
The affine elutriation of dihydroxyphenyl propane antigenic epitope: concrete grammar is: with 10mM PBS(pH 7.4) dilution anti-bisphenol A monoclonal antibody, and with the coated 96 hole enzyme plates of final concentration 60 μ g/mL, 4 ℃ of overnight incubation.Within second day, use TBST(50mM NaCl, pH 7.5 comprises 0.1% Tween-20(v/v)) washing adds 4 ℃ of 300 μ L confining liquids (3% BSA-PBS) to hatch 2 hours after 10 times.After two hours, abandon confining liquid, with 10 times of dilution phage stostes of TBS, approximately 1.0 × 10
11pfu).22 ℃ of concussions are reacted 0.5 hour.Discard unconjugated phage, with TBST washing 10 times, in conjunction with 0.2 M Glycine-HCl(pH 2.2 for upper phage) wash-out, and use immediately 15 μ L 1M Tris-HCl(pH 9.1) neutralization.Get 10 μ L wash-out bacteriophages and survey titres, remaining grows to the E. Coli ER2738 bacterial strain in logarithm early stage and increases for infecting 20 mL.The 3rd day with PEG/NaCl deposition and purification phage, and measures the titre of phage after amplification.
In the elutriation process of taking turns at second, third, coated anti-bisphenol A monoclonal antibody concentration is respectively 45 μ g/mL and 35 μ g/mL, and TBST concentration used is 0.5% and 1.5%, and all the other steps are the same.
2) evaluation of positive phage clones: measure random 20 phage spots of picking in the flat board of phage titre from third round elutriation, carry out the amplification of phage, adopt indirect enzyme-linked immunosorbent absorption detection method (Indirect Enzyme Linked immunoasorbent assay, I-ELISA) carry out the evaluation of positive phage clones, concrete grammar is: first, with 10 mM PBS (pH 7.4) dilution anti-bisphenol A monoclonal antibody, 10 μ g/mL, coated 96 hole enzyme plates, 4 ℃ of overnight incubation.Second day with PBST(10 mM PBS, 0.05% Tween-20(v/v)) after washing 3 times, seal with the PBS that contains 3% skim-milk, hatch 1 hour for 37 ℃; Drop into 100 μ L phage spot amplification liquid (1.0 × 10
11pfu),, using original phage peptide library as negative control, hatch 1 hour for 37 ℃; The anti-100 μ L of the anti-M13 phage two of HRP mark that add 1:5000 doubly to dilute, hatch 1 hour for 37 ℃; Add 100 μ L tmb substrate liquid, lucifuge colour developing 5min, microplate reader (Thermo Scientific Multiskan FC) reads the absorption value at 450 nm places.Choose the positive clone of phage clone that OD450 is greater than 2 times of negative controls.
3) evaluation of dihydroxyphenyl propane antigenic epitope: adopt the method for indirect competitive ELISA to carry out the evaluation of dihydroxyphenyl propane antigenic epitope, concrete grammar is: with 10 mM PBS(pH 7.4) dilution anti-bisphenol A monoclonal antibody, 10 μ g/mL coated elisa plates, 4 ℃ of overnight incubation; Second day with PBST(10 mM PBS, 0.05% Tween-20(v/v)) after washing 3 times, seal with the PBS that contains 3% skim-milk, hatch 1 hour for 37 ℃; Drop into 50 μ L and be accredited as positive phage clone (1.0 × 10 through indirect ELISA
11pfu) and 50 μ L dihydroxyphenyl propane standard substance (concentration range is 0-2 ng/mL), hatch 1 hour for 37 ℃; The anti-100 μ L of the anti-M13 phage two of HRP mark that add 1:5000 doubly to dilute, hatch 1 hour for 37 ℃; Add 100 μ L tmb substrate liquid, lucifuge colour developing 5min, reads OD450, can be in conjunction with anti-bisphenol A monoclonal antibody, and the phage that can be blocked by dihydroxyphenyl propane standard substance, be accredited as the antigenic epitope of dihydroxyphenyl propane.
Determining of the order-checking of case study on implementation 2. dihydroxyphenyl propane antigenic epitope encoding genes and aminoacid sequence thereof
Embodiment 1 is identified and shows have the phage of dihydroxyphenyl propane antigenic epitope to increase through indirect competitive ELISA, extract the DNA sequencing template of phage.Concise and to the point process is as follows: carry out phage amplification, after First is centrifugal, 800 μ L are proceeded to a new centrifuge tube containing phage supernatant.Add 200 μ L PEG/NaCl precipitation phages.After centrifugal, precipitation is resuspended in to 100 μ L iodide damping fluids (10 mM Tris-HCl(pH 8.0), 1 mM EDTA, 4M NaCl), add 250 μ L dehydrated alcohols precipitations DNA, precipitate (DNA sequencing template) by 70% washing with alcohol again after centrifugal.Precipitation is finally resuspended in 20 μ L aqua sterilisas, gets 2 μ L and carries out agarose gel electrophoresis analysis; Get 5 μ L phage templates and carry out DNA sequencing, its-96 g III sequencing primer is: 5 '-HOCCC TCA TAG TTA GCG TAA CG-3 '.Can obtain the aminoacid sequence Ph3 of dihydroxyphenyl propane antigenic epitope according to DNA sequencing result and password sublist.Aminoacid sequence is as follows: YPAYTYNNLMHN.
Case study on implementation 3 dihydroxyphenyl propane antigenic epitopes are the application in ELISA as competition antigen
(1) sample extraction
Take 5g sample (cereal and relevant food thereof), add methyl alcohol-PBS solution of 25 milliliter 60%, 200rpm shakes 5min; After extracting solution is filtered with No. 1 filter paper of whatman, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mix after, be sample extracting solution, stand-by.
(2) coated and sealing
By 10 mM PBS (pH 7.4) dilution anti-bisphenol A monoclonal antibody, 10 μ g/mL coated elisa plates, 4 ℃ of overnight incubation.Second day with PBST(10 mM PBS, 0.05% Tween-20(v/v)) after washing 3 times, seal with the PBS that contains 3% skim-milk, hatch after 1 hour for 37 ℃, wash plate 6 times with PBST stand-by.
(3) foundation of typical curve
Take out the lath of handling well through step (2), every hole is dropped into respectively 50 μ L and is shown the phage (1.0 × 10 that has dihydroxyphenyl propane antigenic epitope
11pfu) and 50 μ L dihydroxyphenyl propane standard substance of a series of different concns, hatch 1 hour for 37 ℃.Add the anti-M13 phage two of 1:5000 dilution HRP mark anti-, hatch 1 hour for 37 ℃.Then with tmb substrate colour developing, read OD450.Take bisphenol A concentration to logarithm as X-coordinate, combination rate (adding the OD450/ in the hole of dihydroxyphenyl propane not add OD450 × 100% in the hole of dihydroxyphenyl propane) is ordinate zou, sets up indirect competition typical curve.Result display standard curve is S-type, and linear dependence is (Fig. 1) better.As Fig. 1, the indirect competitive ELISA typical curve of setting up with dihydroxyphenyl propane antigenic epitope.Dihydroxyphenyl propane antigenic epitope Ph-3(YPAYTYNNLMNH) be respectively 24pg/ml with the IC50 value of anti-bisphenol A antibody.
(4) detection of sample
Take out the lath of handling well through step (2), every hole is dropped into respectively 50 μ L and is shown the phage (1.0 × 10 that has dihydroxyphenyl propane antigenic epitope
11pfu) and testing sample extracting solution, hatch 1 hour for 37 ℃.Add the anti-M13 phage two of 1:5000 dilution HRP mark anti-, hatch 1 hour for 37 ℃.Then with tmb substrate colour developing, read OD450, calculations incorporated rate, and according to typical curve, the content of the sample dihydroxyphenyl propane of retrodicting out.
The application in ELISA as solid phase antigen of embodiment 4. dihydroxyphenyl propane antigenic epitopes
Sample extraction
Take 5g sample (cereal and relevant food thereof), add methyl alcohol-PBS solution of 25 milliliter 60%, 200 rpm concussions 5 minutes; After extracting solution is filtered with No. 1 filter paper of whatman, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mix after, be sample extracting solution, stand-by.
(2) coated and sealing
With 10 mM PBS(pH 7.4) dilute and show the phage (2.0 × 10 that has dihydroxyphenyl propane antigenic epitope
11pfu), 100 microlitres are coated in enzyme plate, 4 ℃ of overnight incubation.Second day with PBST(10 mM PBS, 0.05%Tween-20(v/v)) after washing 3 times, seal with the PBS that contains 3% skim-milk, hatch after 1 hour for 37 ℃, wash plate 6 times with PBST stand-by.
(3) foundation of typical curve
Take out the lath of handling well through step (2), 50 μ L dihydroxyphenyl propane standard substance of 50 μ L anti-bisphenol A monoclonal antibodies (2ng/ml) and a series of different concns are dropped into respectively in every hole, hatch 1 hour for 37 ℃.Add the sheep anti-mouse igg two of 1:2000 dilution HRP mark anti-, hatch 1 hour for 37 ℃.Then with tmb substrate colour developing, read OD450.Take bisphenol A concentration logarithm as X-coordinate, combination rate (adding the OD450/ in the hole of the dihydroxyphenyl propane in the hole of dihydroxyphenyl propane not add OD450 × 100% in the hole of dihydroxyphenyl propane) is ordinate zou, sets up indirect competition typical curve.
(4) detection of sample
Take out the lath of handling well through step (2), 50 μ L dihydroxyphenyl propane standard substance of 50 μ L anti-bisphenol A monoclonal antibodies (2ng/ml) and a series of different concns are dropped into respectively in every hole, hatch 1 hour for 37 ℃.Add the sheep anti-mouse igg two of 1:2000 dilution HRP mark anti-, hatch 1 hour for 37 ℃.Then with tmb substrate colour developing, read OD450.Take bisphenol A concentration logarithm as X-coordinate, combination rate (adding the OD450/ in the hole of the dihydroxyphenyl propane in the hole of dihydroxyphenyl propane not add OD450 × 100% in the hole of dihydroxyphenyl propane) is ordinate zou, sets up indirect competition typical curve.
Embodiment 5. dihydroxyphenyl propane antigenic epitopes are the application in colloid gold immune series of strata are analyzed as solid phase antigen
(1) sample extraction
Take 5g sample (cereal and relevant food thereof), add methyl alcohol-PBS solution of 25 milliliter 60%, 200 rpm concussions 5 minutes; After extracting solution is filtered with No. 1 filter paper of whatman, get 1 milliliter of filtrate and add 4 milliliters of PBS(phosphate buffered saline buffers, pH=7.2) mix after, be sample extracting solution, stand-by.
(2) dot matrix of phage and control line
With 10 mM PBS(pH 7.4) dilute and show the phage (2.0 × 10 that has dihydroxyphenyl propane antigenic epitope
11pfu), phage is lined to (aperture 0.2-0.45 micron) on nitrocellulose filter with dot matrix instrument or micropipet, as detection line; By anti-the sheep anti-mouse igg of the HRP mark of 0.5 mg/ml two, line on same nitrocellulose filter and (be positioned at the top of detection line, apart from being greater than 5 millimeters) with dot matrix instrument or micropipette, as control line.
(3) colloid gold label dihydroxyphenyl propane antibody
Dihydroxyphenyl propane antibody is dropwise added in colloidal gold solution (pH=8.2), stir while dripping, after 30 minutes, getting 1%PEG adds in above-mentioned solution, continue to stir the 10% BSA solution that adds 1/10th volumes after 15 minutes, stir after 15 minutes, leave standstill 30 minutes, after centrifugal, remove supernatant, obtain the dihydroxyphenyl propane antibody-solutions of colloid gold label.
(4) assembling of colloidal-gold detecting-card
The dihydroxyphenyl propane antibody point of colloid gold label is sprayed on to glue gold pad upper (1.0 mcg/ml), by sample pad, glue gold pad, dot matrix nitrocellulose filter and the blotter of detection line and control line assemble, be cut into test strip, pack in test card stand-by.
(5) detection of sample
Sample extracting solution is added in sample pad, leave standstill 10 minutes, if contain dihydroxyphenyl propane in sample and exceed the detection threshold of colloidal gold test, do not develop the color in detection line region, and the colour developing of control line region; If do not contain dihydroxyphenyl propane and the detection threshold lower than colloidal gold test in sample, detection line region colour developing, also develop the color in control line region.If do not develop the color in control line region, show that test strip lost efficacy.
A large amount of preparations of embodiment 5 dihydroxyphenyl propane antigenic epitopes
(1) mode increasing with phage
Having the phage of dihydroxyphenyl propane antigenic epitope to be added to 20 ml inoculations displaying has in the culture of ER 2738, and 37 ℃ of 220 rpm concussion cultivated 4.5 hours.Culture is proceeded in another centrifuge tube, and 4 ℃ of 1000 centrifugal 10 min of rpm, proceeds to the top of supernatant 80% in a fresh tube, adds the PEG/NaCl of 1/6 volume, leaves standstill 120 min at 4 ℃.4 ℃ of centrifugal PEG/NaCl of 10000rpm leave standstill solution 15min.Abandon supernatant, of short durationly suck residual supernatant liquor after centrifugal.Add 1mL TBS to carry out resuspended, be phage amplification liquid.
(2) be prepared in the mode of dihydroxyphenyl propane antigenic epitope-fusion rotein
A. use the external source encoding gene of pcr amplification dihydroxyphenyl propane antigenic epitope
PCR reaction system: (50 μ L)
10 × Pyrobest Buffer (Mg2+ plus) 5 μL
dNTP Mixture (each for 2.5 mM) 4 μL
M13KE insert extension primer (10 mM） 1 μL
-96 gIII sequencing primer (10 mM) 1 μL
Phage DNA template 1 μ L
Pyrobest DNA Polymerase 0.5 μL
Sterilizing ddH2O 37.5 μ L
PCR reaction conditions:
（1）95℃ 5 min；（2）30 cycles： 95℃ 30 sec，55℃ 30 sec，72℃ 40sec（3）72℃ 10 min。
Adopt PCR product to reclaim test kit purifying PCR product, trace dna quantitative instrument is quantitative.The coding gene sequence of dihydroxyphenyl propane antigenic epitope of the present invention corresponds to respectively:
TATCCTGCGTATACGTATAATAATCTTATGCATAAT。
B. the double digestion of external source encoding gene and expression vector
Adopt respectively the external source code gene of ACC65I and Eag I enzyme and expression vector (MBP fusion rotein can be expressed by pMAl-pIII, NEB company) to carry out double digestion.
C. enzyme is cut connection and the conversion of after product
By plasmid pMal-PIII and object fragment with 1: 10(mol ratio) mix, connect 12 h in 16 ℃ of water-baths, get 10 μ L and connect products and add in 100 μ L competent cell TB1, fully mix.After ice bath 30 min, 42 ℃ of water-bath heat shock 90 s, after ice bath 5 min, add immediately 600 μ L LB liquid mediums, 37 ℃, 200 rpm cultivate 1 h, centrifugal 2 min of 10000 rpm, suck supernatant and leave and take approximately 200 μ L, coat in LB-A solid (Ampr) substratum, 37 ℃ of incubated overnight, obtain positive colony.
D. the expression of dihydroxyphenyl propane antigenic epitope-MBP fusion rotein
By positive colony of above-mentioned acquisition, choose a single colony inoculation in 5 mL LB-A from flat board, in 0.2% sucrose, 37 ℃, 220 r/min, shaking culture is spent the night, overnight culture is inoculated in to the LB-A of 50 mL by 1 % inoculum size (v/v), in 0.2 % sucrose medium, inoculate respectively 3 bottles, 37 ℃, 220 r/min shaking culture, in the time that culture bacterial concentration OD600 reaches 0.6, to add in three bottles of cultures IPTG to final concentration be 0.2 mmol/L, 220 r/min shaking culture, by inductor (PEG solution) in 4 ℃, 4000 g, centrifugal 20 min collect bacterial sediment, abandon supernatant.Re-suspended cell is in 400 mL 30 mM Tris-HCl, 20% sucrose, pH 8.0 (80 mL/g wet cell weight), add EDTA to 1 mM, under room temperature, shake 5-10 min, 8000 g, 4 ℃, centrifugal 20 min, abandon supernatant, the 5 mM MgSO4 that precipitation is resuspended in 400 ml precoolings, shake 10 min on ice, 8000 g, 4 ℃, centrifugal 20 min, retain supernatant, in supernatant liquor, add 8 mL 1 M Tris-HCl, pH 7.4, obtains dihydroxyphenyl propane mimic epitopes-MBP fusion rotein.
SEQUENCE LISTING
<110> University Of Nanchang
Antigenic epitope Ph3 and the application thereof of <120> dihydroxyphenyl propane
<130> 2014
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 12
<212> PRT
<213> artificial sequence
<400> 1
Tyr Pro Ala Tyr Thr Tyr Asn Asn Leu Met His Asn
1 5 10
<210> 2
<211> 36
<212> DNA
<213> artificial sequence
<400> 2
tatcctgcgt atacgtataa taatcttatg cataat 36
Claims (7)
1. the antigenic epitope Ph3 of dihydroxyphenyl propane, is characterized in that aminoacid sequence is: YPAYTYNNLMHN.
2. the nucleotide sequence of antigenic epitope aminoacid sequence described in coding claim 1.
3. nucleotide sequence as claimed in claim 2 corresponds to: TATCCTGCGTATACGTATAATAATCTTATGCATAAT.
4. the preparation method of antigenic epitope as claimed in claim 1, is characterized in that preparing in a large number by the recombinant expressed mode of phage amplification, chemosynthesis or genetically engineered; Described phage amplification refers to the phage that displaying is had to dihydroxyphenyl propane antigenic epitope, the mode increasing by biology, and amount reproduction is produced and is shown the bacteriophage particles that has dihydroxyphenyl propane antigenic epitope; Described chemosynthesis refers to according to mimic epitopes mimic epitopes aminoacid sequence, carries out polypeptide synthesize by the mode of chemically synthesized polypeptide; The recombinant expressed mode of described genetically engineered refers to the gene of coding simulation epi-position, by being cloned into expression vector, carries out a large amount of preparations of dihydroxyphenyl propane antigenic epitope with the form of polypeptide-fusion rotein.
5. the application of antigenic epitope in immunology detection is analyzed described in claim 1.
6. application as claimed in claim 5, is characterized in that the application in immunology detection is analyzed with solid phase antigen or competition antigen of dihydroxyphenyl propane antigenic epitope.
7. application as claimed in claim 5, is characterized in that dihydroxyphenyl propane antigenic epitope detects the application in analyzing as solid phase antigen at colloidal gold immunochromatographimethod.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410053340.0A CN103848898B (en) | 2014-02-17 | 2014-02-17 | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410053340.0A CN103848898B (en) | 2014-02-17 | 2014-02-17 | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103848898A true CN103848898A (en) | 2014-06-11 |
| CN103848898B CN103848898B (en) | 2016-01-27 |
Family
ID=50857049
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410053340.0A Expired - Fee Related CN103848898B (en) | 2014-02-17 | 2014-02-17 | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103848898B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105440136A (en) * | 2014-08-25 | 2016-03-30 | 上海近岸科技有限公司 | A recombinant anti-bisphenol A monoclonal antibody, a preparing method thereof and uses of the antibody |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005082434A2 (en) * | 2004-02-28 | 2005-09-09 | Hemoteq Gmbh | Biocompatible coating, method, and use of medical surfaces |
| EP1774972A1 (en) * | 2005-10-14 | 2007-04-18 | Alltech, Inc. | Use of selenium compounds, especially selenium yeasts in the treatment of Alzheimer, neurodegenerative diseases and diabetes |
| CN101863981A (en) * | 2010-04-21 | 2010-10-20 | 广东工业大学 | Preparation method of anti-bisphenol A monoclonal antibody |
| CN102175846A (en) * | 2010-12-24 | 2011-09-07 | 江南大学 | Fluorescence polarization immunoassay method of bisphenol A |
| CN103018467A (en) * | 2012-09-27 | 2013-04-03 | 江苏维赛科技生物发展有限公司 | Colloidal gold immunochromatographic card for detecting bisphenol A (BPA) and preparation method thereof |
-
2014
- 2014-02-17 CN CN201410053340.0A patent/CN103848898B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005082434A2 (en) * | 2004-02-28 | 2005-09-09 | Hemoteq Gmbh | Biocompatible coating, method, and use of medical surfaces |
| EP1774972A1 (en) * | 2005-10-14 | 2007-04-18 | Alltech, Inc. | Use of selenium compounds, especially selenium yeasts in the treatment of Alzheimer, neurodegenerative diseases and diabetes |
| CN101863981A (en) * | 2010-04-21 | 2010-10-20 | 广东工业大学 | Preparation method of anti-bisphenol A monoclonal antibody |
| CN102175846A (en) * | 2010-12-24 | 2011-09-07 | 江南大学 | Fluorescence polarization immunoassay method of bisphenol A |
| CN103018467A (en) * | 2012-09-27 | 2013-04-03 | 江苏维赛科技生物发展有限公司 | Colloidal gold immunochromatographic card for detecting bisphenol A (BPA) and preparation method thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105440136A (en) * | 2014-08-25 | 2016-03-30 | 上海近岸科技有限公司 | A recombinant anti-bisphenol A monoclonal antibody, a preparing method thereof and uses of the antibody |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103848898B (en) | 2016-01-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104530194B (en) | Antigenic epitope for ochratoxin A and its application | |
| CN103044527B (en) | Antigenic mimic epitope of gentamycin and application thereof | |
| CN103848895B (en) | The linear dodecapeptide antigenic epitope of aflatoxin B1 and its application | |
| CN103145808B (en) | Antigen mimic epitope of ochratoxin A and application thereof | |
| CN103044526B (en) | Antigenic mimic epitope of vardenafil and application thereof | |
| CN103848898B (en) | The antigenic epitope Ph3 of dihydroxyphenyl propane and application thereof | |
| CN103848897B (en) | The antigenic epitope Ph1 of dihydroxyphenyl propane and application thereof | |
| CN104327166B (en) | The dodecapeptide antigenic epitope of ochratoxin A and its application | |
| CN103848896A (en) | Antigenic mimic epitope Ph5 of bisphenol A and application thereof | |
| CN105315346B (en) | Peptide molecule and its application of deoxynivalenol can be specifically bound | |
| CN103848899A (en) | Antigenic mimic epitope Ph15 of bisphenol A and application thereof | |
| CN104311634B (en) | Aflatoxin B1Antigenic epitope AM 1 and its application | |
| CN104530195B (en) | Simulate antigenic epitope and its application of ochratoxin A | |
| CN104311637B (en) | Simulation fumonisins B1Antigenic epitope and its application | |
| CN103342739B (en) | Antigenic mimic epitope of fumonisin B1 and application thereof | |
| CN103102391B (en) | Antigenic mimic epitope of norfloxacin and application thereof | |
| CN103059101B (en) | Antigenic mimic epitope of aflatoxin (AF) B1 and application thereof | |
| CN104356208B (en) | It is a kind of to be directed to fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN104311635B (en) | For fumonisins B1Antigenic epitope and its application | |
| CN104356207B (en) | Fumonisins B1Dodecapeptide antigenic epitope and its application | |
| CN104119425B (en) | The antigenic epitope of simulation norfloxacin and application thereof | |
| CN104311638B (en) | Fumonisins B can be simulated1Antigenic epitope and its application | |
| CN103965290B (en) | The heptapeptide antigenic epitope of norfloxacin and application thereof | |
| CN104311636A (en) | Antigen mimic epitope capable of mimicking fumonisins B1 and application of antigen mimic epitope | |
| CN104788543A (en) | Polypeptide-based zearalenone antibody mimics and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160127 Termination date: 20160217 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |