CN103834628B - A kind of acidic beta-mannase and gene thereof and application - Google Patents
A kind of acidic beta-mannase and gene thereof and application Download PDFInfo
- Publication number
- CN103834628B CN103834628B CN201410088929.4A CN201410088929A CN103834628B CN 103834628 B CN103834628 B CN 103834628B CN 201410088929 A CN201410088929 A CN 201410088929A CN 103834628 B CN103834628 B CN 103834628B
- Authority
- CN
- China
- Prior art keywords
- mannase
- beta
- man5db
- enzyme
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/2488—Mannanases
- C12N9/2494—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01078—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to genetic engineering field.In particular it relates to a kind of acidic beta mannase Man5DB and gene thereof and application, its aminoacid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.This enzyme has the property that optimum pH is 5.0, and in the range of pH3.5 6.0, this enzyme is able to maintain that its enzyme activity of more than 60%；Optimal reactive temperature is 65 DEG C, and the enzyme of more than 50% can be kept between 45 DEG C 70 DEG C to live；After this enzyme processes 60min at 37 DEG C, between pH4.0 pH9.0, it is able to maintain that the enzyme activity of more than 80%, illustrates that this enzyme has excellent pH stability；After processing 60min at 50 DEG C, enzyme is lived and is not lost, and 65 DEG C process 5min and remain to keep the enzyme of more than 20% to live.It addition, its Rate activity is 795U mg–1.This acidity mannase has good thermostability, can be applicable to the industry such as feedstuff, food, medicine.Just can realize utilizing the mannase of the excellent applicable commercial Application of genetic engineering means nature of production according to technical scheme.
Description
Technical field
The present invention relates to genetic engineering field, in particular it relates to a kind of produce acidity 'beta '-mannase and
Gene and application.
Background technology
Plant cell wall is mainly made up of materials such as cellulose, hemicellulose and lignins.Mannan is that plant half is fine
The important component of dimension element, is the wire polymer being formed by connecting by β-Isosorbide-5-Nitrae-D-MANNOSE, mainly has Portugal on the side chain of polysaccharide
The substituted radicals such as grape glycosyl, acetyl group and galactosyl.'beta '-mannase (β-mannanase EC3.2.1.78) is a kind of
The endo hydrolysis enzyme of hydrolyzing mannan, degrades mannose backbone β-l with internal-cutting way, and 4 glycosidic bonds discharge short β-l, and 4
Mannooligo saccharide.
In recent years, along with the discovery of mannooligo saccharide physiological function, the rise of green feed and the increasing of people's environmental consciousness
By force, the regeneration research of the energy, people have had been enter into the stage that a dew dextranase is new to β-sweet research and utilization.β-sweet
Dew dextranase has been widely used in food, medicine, feedstuff, papermaking, textile printing and dyeing, oil exploitation, fine chemistry industry and biological skill
The numerous areas such as art, are a kind of novel industrial enzymes, have the biggest potential using value.
'beta '-mannase is widely present in the biologies such as antibacterial, actinomycetes, fungus, plant, animal.Bacterial origin sweet
The mannase of dew dextranase mainly acid partial neutral.Its molecular weight is many between 35kDa～55kDa, optimal reaction effect
Temperature is 50 DEG C～70 DEG C.Most study is bacillus cereus at present, except the suitableeest action pH of Bacillus alcalophilus reaches
More than pH9.0, most optimal reaction pH is between 5.5～8.0.The 'beta '-mannase of fungus is typically acid, and molecular weight is big
About at 45kDa～55kDa, the suitableeest action pH is 4.0～6.0, and optimum temperature is 55 DEG C～75 DEG C.Relatively for antibacterial,
The 'beta '-mannase optimal reaction pH value of originated from fungus, pH stability is the most on the low side, and thermostability is poorer than antibacterial.The most both at home and abroad,
Although many 'beta '-mannases are cloned and separate and property testing, but the nature and characteristic of these enzymes, all there is some defects, example
As, pH sphere of action is improper, poor heat stability, and expression is low, all can not meet the needs of actual application.Therefore people wish
Prestige can find a kind of new 'beta '-mannase that disclosure satisfy that practical application request such that it is able to this β of further genralrlization-sweet
Dew dextranase is applied in the industries such as feedstuff, food, medicine.
The present invention has obtained a new β-sweet from Staphylotrichum coccosporum NBRC31817 bacterial strain
Dew xylanase gene, the mannase of its coding has several advantages that acidity, preferable heat stability, easily ferments
Produce.These advantages can mean that neoteric 'beta '-mannase is in the industries such as feedstuff, food, medicine, it will more having should
The 'beta '-mannase reported in the past with value ratio.
Summary of the invention
It is an object of the invention to provide a kind of acidity, the 'beta '-mannase of preferable heat stability.
Another object of the present invention is to provide the gene of above-mentioned 'beta '-mannase.
Another object of the present invention is to provide the recombinant vector comprising above-mentioned 'beta '-mannase.
Another object of the present invention is to provide the recombinant bacterial strain comprising above-mentioned beta-mannase gene.
Another object of the present invention is to provide a kind of method preparing 'beta '-mannase.
Another object of the present invention is to provide the application of above-mentioned 'beta '-mannase.
The most to be solved technical problem is that of the present invention overcomes the deficiencies in the prior art, it is provided that a kind of good properties,
It is suitable in the industries such as feedstuff, food, medicine the new 'beta '-mannase of application.This 'beta '-mannase Man5DB, its
Aminoacid sequence such as SEQ ID NO.1:
1MKSVTSLLLL AGAAAGQQAA YGQCGGIGYS GPSSCVSGYA CTSYNPYYYQ
51CVPGTATSAP ATTSKTSSSV KTTSTSSSVK TTSTSTVKTS TSSTKTTSST
101TAGPTATGFA KTNGLMFEID GVTKYFAGTN CYWCGFLTAN ADVDHVFADM
151AAAGFKVVRV WGFNDVNSIP GSGTVWYQYL SASGSQINTG ANGLQRMDYV
201VSSAAAHGLK LIINFVNNWN DYGGINAYVN AFGGSASTWY TNTAAQAQYQ
251KYIEAVVSRY KTSTAVFAWE LANEPRCSGC DASVIYNWAA KTSQYIKSLD
301SNHMVTIGDE GFGPLTGGDG SYPYQAGAGG YTWVDNLNIS TLDFGTLHLY
351PDSWGQPYSW GDLWVSTHAS ACVKANKPCI LEEYGGTNNC TIENPWQKTA
401LSSKGIAGDM FWQYGDTLPS CNCQTSQDGN TVFYNQGNWD CMVTQHVAAI
451NSS*
Wherein, 454 aminoacid of this enzyme total length, 16 aminoacid of N end are signal peptide sequence " MKSVTSLLLLAGAAAG ".
Therefore, the theoretical molecular of ripe 'beta '-mannase Man5D is 47kDa, its aminoacid sequence such as SEQID
NO.2:
1QQAAYGQCGG IGYSGPSSCV SGYACTSYNP YYYQCVPGTA TSAPATTSKT
51SSSVKTTSTS SSVKTTSTST VKTSTSSTKT TSSTTAGPTA TGFAKTNGLM
101FEIDGVTKYF AGTNCYWCGF LTANADVDHV FADMAAAGFK VVRVWGFNDV
151NSIPGSGTVW YQYLSASGSQ INTGANGLQR MDYVVSSAAA HGLKLIINFV
201NNWNDYGGIN AYVNAFGGSA STWYTNTAAQ AQYQKYIEAV VSRYKTSTAV
251FAWELANEPR CSGCDASVIY NWAAKTSQYI KSLDSNHMVT IGDEGFGPLT
301GGDGSYPYQA GAGGYTWVDN LNISTLDFGT LHLYPDSWGQ PYSWGDLWVS
351THASACVKAN KPCILEEYGG TNNCTIENPW QKTALSSKGI AGDMFWQYGD
401TLPSCNCQTS QDGNTVFYNQ GNWDCMVTQH VAAINSS*
This 'beta '-mannase Man5DB has the feature of acidity.Optimum pH is 5.0, in the range of pH3.5-pH6.0, and should
Enzyme is able to maintain that its enzyme activity of more than 60%；Optimum temperature 65 DEG C.Processing 60min at 50 DEG C, residual enzyme is lived and is not lost,
Even if this enzyme processes 60min at 60 DEG C, still can keep the enzyme activity of 50%, there is preferable stability；High density simultaneously
Fermentation enzyme activity is high, it is easy to industrialized production.
Present invention also offers the gene encoding above-mentioned 'beta '-mannase.The complete genome sequence of this enzyme such as SEQ IDNO.3
Shown in:
1ATGAAGTCTGTCACCTCCCTCCTCCTCCTGGCTGGCGCCGCCGCCGGCCAGCAAGCGGCC
61TACGGACAGTGCGGCGGCATCGGCTACTCCGGCCCTTCCAGCTGCGTGTCGGGGTACGCG
121TGTACCTCGTACAACCCGTACTACTACCAGTGCGTTCCGGGGACGGCCACTTCTGCCCCG
181GCCACGACGTCAAAGACTTCGTCGAGCGTGAAGACCACCTCGACGTCTTCCTCCGTGAAG
241ACCACCTCGACGTCGACTGTCAAGACGAGCACTTCGTCGACGAAGACCACCTCGTCCACC
301ACTGCCGGGCCGACGGCCACAGGCTTTGCGAAGACGAATGGTCTGATGTTTGAGATTGAC
361GGCGTCACCAAGTACTTTGCGGGCACCAACTGCTACTGTTTGTCACCTCTTTCACCTCCG
421GATGGCCCCGACACCATGACTGACCGTTGACCAGGGTGCGGCTTCCTGACCGCCAACGCC
481GATGTCGACCACGTCTTCGCCGACATGGCCGCCGCCGGCTTCAAGGTTGTCCGCGTGTGG
541GGCTTCAACGACGTCAACAGCATCCCCGGGTCCGGAACCGTCTGGTACCAGTACCTGTCC
601GCCAGCGGCTCGCAGATCAACACGGGCGCGAACGGCCTGCAGAGGATGGACTACGTCGTC
661TCGTCGGCGGCGGCCCACGGGCTGAAGCTGATCATCAACTTCGTCAACAACTGGAATGAT
721TATGGTGGAATCAACGCCTATGTGAACGCCTTTGGCGGATCAGCGTCGACGTGGTACACC
781AACACGGCCGCGCAGGCGCAGTACCAGAAATACATTGAGGCTGTCGTGAGCAGGTACAAG
841ACTTCGACGGCTGTGTTTGCCTGGGAGCTGGCGAACGAGCCGAGATGCAGCGGTTGCGAT
901GCGTAAGTCTGACGATCTACCCAAGTCGAACCCTTTAACGTTTCCAACACACTCCAGCTC
961CGTCATCTACAACTGGGCGGCCAAGACCTCCCAGTACATCAAGTCCCTCGACTCCAATCA
1021CATGGTCACCATCGGCGACGAAGGCTTCGGCCCCCTGACCGGCGGCGACGGCAGCTACCC
1081CTACCAGGCGGGCGCCGGTGGCTACACCTGGGTGGACAACCTGAATATCTCGACGCTGGA
1141CTTTGGCACGCTGCACCTGTATCCCGACAGCTGTGAGTATCAAGTACGCTCTATCAGGCA
1201GAGAGCGTCTCACTAACAGACTGTCAGGGGGCCAACCCTACAGCTGGGGCGACCTCTGGG
1261TCTCGACTCACGCCTCCGCGTGCGTCAAGGCCAACAAGCCGTGCATCCTGGAGGAGTGTA
1321AGTCCCGCCCCATCCCCTCCCCAGTCCCTAGACGTCCGGACAGTATCACTAACACCGAGA
1381ACAGACGGCGGTACAAACAACTGCACCATCGAGAACCCCTGGCAAAAGACGGCCCTCTCT
1441TCCAAGGGCATCGCCGGCGACATGTTCTGGCAGTACGGCGACACCCTCCCCAGCTGCAAC
1501TGCCAGACCTCGCAGGACGGGAACACCGTGTTTTACAACCAAGGCAACTGGGACTGCATG
1561GTCACGCAGCATGTGGCGGCTATCAACTCTTCGTGA
The present invention passes through the method separating clone of PCR this beta-mannase gene man5DB, DNA complete sequence analysis and ties
Fruit shows, 'beta '-mannase Man5DB structural gene total length 1596bp, containing 4 introns ,+399～455bp ,+903～
957bp ,+1174～1228bp ,+1318～1384bp, for its intron sequences, the long 1362bp of cDNA, its cDNA sequence such as SEQ
Shown in ID NO.4:
1ATGAAGTCTGTCACCTCCCTCCTCCTCCTGGCTGGCGCCGCCGCCGGCCAGCAAGCGGCC
61TACGGACAGTGCGGCGGCATCGGCTACTCCGGCCCTTCCAGCTGCGTGTCGGGGTACGCG
121TGTACCTCGTACAACCCGTACTACTACCAGTGCGTTCCGGGGACGGCCACTTCTGCCCCG
181GCCACGACGTCAAAGACTTCGTCGAGCGTGAAGACCACCTCGACGTCTTCCTCCGTGAAG
241ACCACCTCGACGTCGACTGTCAAGACGAGCACTTCGTCGACGAAGACCACCTCGTCCACC
301ACTGCCGGGCCGACGGCCACAGGCTTTGCGAAGACGAATGGTCTGATGTTTGAGATTGAC
361GGCGTCACCAAGTACTTTGCGGGCACCAACTGCTACTGGTGCGGCTTCCTGACCGCCAAC
421GCCGATGTCGACCACGTCTTCGCCGACATGGCCGCCGCCGGCTTCAAGGTTGTCCGCGTG
481TGGGGCTTCAACGACGTCAACAGCATCCCCGGGTCCGGAACCGTCTGGTACCAGTACCTG
541TCCGCCAGCGGCTCGCAGATCAACACGGGCGCGAACGGCCTGCAGAGGATGGACTACGTC
601GTCTCGTCGGCGGCGGCCCACGGGCTGAAGCTGATCATCAACTTCGTCAACAACTGGAAT
661GATTATGGTGGAATCAACGCCTATGTGAACGCCTTTGGCGGATCAGCGTCGACGTGGTAC
721ACCAACACGGCCGCGCAGGCGCAGTACCAGAAATACATTGAGGCTGTCGTGAGCAGGTAC
781AAGACTTCGACGGCTGTGTTTGCCTGGGAGCTGGCGAACGAGCCGAGATGCAGCGGTTGC
841GATGCCTCCGTCATCTACAACTGGGCGGCCAAGACCTCCCAGTACATCAAGTCCCTCGAC
901TCCAATCACATGGTCACCATCGGCGACGAAGGCTTCGGCCCCCTGACCGGCGGCGACGGC
961AGCTACCCCTACCAGGCGGGCGCCGGTGGCTACACCTGGGTGGACAACCTGAATATCTCG
1021ACGCTGGACTTTGGCACGCTGCACCTGTATCCCGACAGCTGGGGCCAACCCTACAGCTGG
1081GGCGACCTCTGGGTCTCGACTCACGCCTCCGCGTGCGTCAAGGCCAACAAGCCGTGCATC
1141CTGGAGGAGTACGGCGGTACAAACAACTGCACCATCGAGAACCCCTGGCAAAAGACGGCC
1201CTCTCTTCCAAGGGCATCGCCGGCGACATGTTCTGGCAGTACGGCGACACCCTCCCCAGC
1261TGCAACTGCCAGACCTCGCAGGACGGGAACACCGTGTTTTACAACCAAGGCAACTGGGAC
1321TGCATGGTCACGCAGCATGTGGCGGCTATCAACTCTTCGTGA
Wherein, the base sequence of signal peptide is:
“ATGAAGTCTGTCACCTCCCTCCTCCTCCTGGCTGGCGCCGCCGCCGGC”
Therefore, the coded sequence of ripe gene is
Shown in SEQ ID NO.5:
1CAGCAAGCGGCCTACGGACAGTGCGGCGGCATCGGCTACTCCGGCCCTTCCAGCTGCGTG
61TCGGGGTACGCGTGTACCTCGTACAACCCGTACTACTACCAGTGCGTTCCGGGGACGGCC
121ACTTCTGCCCCGGCCACGACGTCAAAGACTTCGTCGAGCGTGAAGACCACCTCGACGTCT
181TCCTCCGTGAAGACCACCTCGACGTCGACTGTCAAGACGAGCACTTCGTCGACGAAGACC
241ACCTCGTCCACCACTGCCGGGCCGACGGCCACAGGCTTTGCGAAGACGAATGGTCTGATG
301TTTGAGATTGACGGCGTCACCAAGTACTTTGCGGGCACCAACTGCTACTGGTGCGGCTTC
361CTGACCGCCAACGCCGATGTCGACCACGTCTTCGCCGACATGGCCGCCGCCGGCTTCAAG
421GTTGTCCGCGTGTGGGGCTTCAACGACGTCAACAGCATCCCCGGGTCCGGAACCGTCTGG
481TACCAGTACCTGTCCGCCAGCGGCTCGCAGATCAACACGGGCGCGAACGGCCTGCAGAGG
541ATGGACTACGTCGTCTCGTCGGCGGCGGCCCACGGGCTGAAGCTGATCATCAACTTCGTC
601AACAACTGGAATGATTATGGTGGAATCAACGCCTATGTGAACGCCTTTGGCGGATCAGCG
661TCGACGTGGTACACCAACACGGCCGCGCAGGCGCAGTACCAGAAATACATTGAGGCTGTC
721GTGAGCAGGTACAAGACTTCGACGGCTGTGTTTGCCTGGGAGCTGGCGAACGAGCCGAGA
781TGCAGCGGTTGCGATGCCTCCGTCATCTACAACTGGGCGGCCAAGACCTCCCAGTACATC
841AAGTCCCTCGACTCCAATCACATGGTCACCATCGGCGACGAAGGCTTCGGCCCCCTGACC
901GGCGGCGACGGCAGCTACCCCTACCAGGCGGGCGCCGGTGGCTACACCTGGGTGGACAAC
961CTGAATATCTCGACGCTGGACTTTGGCACGCTGCACCTGTATCCCGACAGCTGGGGCCAA
1021CCCTACAGCTGGGGCGACCTCTGGGTCTCGACTCACGCCTCCGCGTGCGTCAAGGCCAAC
1081AAGCCGTGCATCCTGGAGGAGTACGGCGGTACAAACAACTGCACCATCGAGAACCCCTGG
1141CAAAAGACGGCCCTCTCTTCCAAGGGCATCGCCGGCGACATGTTCTGGCAGTACGGCGAC
1201ACCCTCCCCAGCTGCAACTGCCAGACCTCGCAGGACGGGAACACCGTGTTTTACAACCAA
1261GGCAACTGGGACTGCATGGTCACGCAGCATGTGGCGGCTATCAACTCTTCGTGA
Maturation protein theoretical molecular is 47kDa, and this enzyme belongs to glycoside hydrolase the 5th family.By 'beta '-mannase base
Because the c DNA sequence of man5DB and the aminoacid sequence derived carry out BLAST comparison discovery in Gen Bank, determine
Man5DB is a kind of new mannase.
Present invention also offers the recombinant vector comprising above-mentioned beta-mannase gene, preferably pPIC9-man5DB.
The beta-mannase gene of the present invention is inserted between the suitable restriction enzyme site of expression vector so that it is nucleotides sequence
Arrange and exercisable be connected with expression regulation sequence.As the most preferred embodiment of the present invention, it is preferably β-sweet
Between EcoR I and Not I restriction enzyme site that dew xylanase gene plasmid is inserted on pPIC9, make this nucleotide sequence
It is positioned at the downstream of AOXl promoter and is regulated and controled by it, obtaining expression of recombinant yeast plasmid pPIC9-man5DB.
Present invention also offers the recombinant bacterial strain comprising above-mentioned beta-mannase gene, preferably recombinant bacterial strain GS115/
man5DB。
Present invention also offers a kind of method prepared addicted to acid 'beta '-mannase, comprise the following steps:
1) with above-mentioned recombinant vector transformed host cell, recombinant bacterial strain is obtained；
2) recombinant bacterial strain is cultivated, the expression of induction restructuring 'beta '-mannase；
3) 'beta '-mannase also expressed by purification is reclaimed.
Wherein, the most described host cell is pichia yeast (Pichia pastoris) cell, beer yeast
(Saccharomyces cerevisiae) cell or Hansenula polymorpha (Hansenula polymorpha) cell, preferably will
Expression of recombinant yeast Plastid transformation Pichia pastoris (Pichic pastoris) GS115, obtains recombinant bacterial strain GS115/
man5DB。
The invention provides a new mannase gene, mannase of its coding has acidity, preferably
Thermostability and protease resistance, can be applied to the industry such as feedstuff, food, medicine.Just may be used according to technical scheme
To realize utilizing the mannase of the excellent applicable commercial Application of genetic engineering means nature of production.
Accompanying drawing explanation
The SDS-PAGE of the 'beta '-mannase that Fig. 1 man5DB expresses in Pichia sp. analyzes, l, and the manna of expression gathers
Carbohydrase supernatant；2, the restructuring 'beta '-mannase of purification；3, the purification of Recombinant 'beta '-mannase after the process of desaccharide base.
Fig. 2 present invention recombinates the optimum pH of 'beta '-mannase.
The pH stability of Fig. 3 'beta '-mannase of the present invention.
Fig. 4 'beta '-mannase of the present invention optimal reactive temperature.
Fig. 5 beta-mannase of the present invention enzyme heat stability.
Detailed description of the invention
Test material and reagent
1, bacterial strain and carrier: Pichia sp. (Pichia pastoris GS115) is that this laboratory preserves；Pichia sp. table
Reach carrier pPIC9 and bacterial strain GS115 purchased from Invitrogen company.
2, enzyme and other biochemical reagents: restriction endonuclease is purchased from TaKaRa company, ligase is purchased from Invitrogen company.Swallow
Wheat xylan is purchased from Sigma company, and other is all domestic reagent (all can be commercially available from common biochemical Reagent Company).
3, culture medium:
(I) culture medium: 30g/L Testa Tritici, 30g/L maize cob meal, 30g/L bean cake, 5g/L Rhizoma amorphophalli powder, 5g/L (NH4)
SO4, 1g/L KH2PO4, 0.5g/L MgSO4·7H2O, 0.01g/L FeSO4·7H2O, 0.2g/LCaCl2In 1L deionized water
In, 121 DEG C, sterilization treatment 20min under the conditions of 15 pounds
(2) Escherichia coli culture medium LB (126 peptones, 0.5% yeast extract, 126NaCI, pH7.O).
(3) BMGY culture medium；1% yeast extract, 2% peptone, 1.34%YNB, 0.000049 < Biotin, 1% glycerol
(v/v)。
(4) BMMY culture medium: replacing glycerol divided by 0.5% methanol, remaining composition is all identical with BMGY, pH4.0.
Illustrate: following example are not made the experimental methods of molecular biology illustrated, all with reference to " Molecular Cloning: A Laboratory
Guide " concrete grammar listed in (third edition) J. Pehanorm Brooker one book carries out, or according to test kit and product description
Carry out.
The clone of embodiment 1 beta-mannase coding gene man5D
Extract Staphylotrichum coccosporum genomic DNA
Big spore circle spore mould Staphylotrichum coccosporum NBRC31817 is purchased from Japan's authority's culture presevation
Administrative center NBRC(NITE biological resource center).
Culture medium is cultivated the bacterium of 3 days, and 12,000rpm are centrifuged 10min, and the mycelium of collection adds high temperature sterilize
Mortar in, be ground to rapidly powder with liquid nitrogen, then ground thalline is transferred to one new, equipped with 15ml CTAB
In lysate 50mL centrifuge tube, soft turned upside down mixes, and is placed in 70 DEG C of water-bath insulation 3h, and every 20min, turned upside down is light
Soft mixing is once, in order to fully crack thalline.4 DEG C, 12,000rpm is centrifuged 10min, draws supernatant in new centrifuge tube, adds
Entering isopyknic chloroform, room temperature places 5min.4 DEG C, 12,000rpm be centrifuged 10min.Take supernatant and add isopyknic
Phenol/chloroform, room temperature places 5min.4 DEG C, 12,000rpm be centrifuged 10min.To remove foreign protein as far as possible, then take and reset and add
Entering equal-volume isopropanol, after room temperature stands 5min, at 4 DEG C, l0000rpm is centrifuged l0min.Abandon supernatant, precipitate the ethanol with 70%
Wash twice, vacuum drying, add appropriate TE dissolve, be placed in-20 DEG C standby.
Beta-mannase gene conserved sequence design according to having delivered has synthesized degenerate primer P1, and P2(is shown in Table 1).With
Staphylotrichum coccosporum genomic DNA is that template carries out PCR amplification.PCR response parameter is: 95 DEG C of 5min;
94 DEG C of 30sec, 50～45 DEG C of 30sec, 72 DEG C of 30sec, 12 circulations (after the most each circulation, renaturation temperature declines 1 DEG C);94
DEG C 30min, 45 DEG C of 30sec, 72 DEG C of 30sec, 30 circulations;72℃10min.Obtain an about 180bp fragment, this fragment is reclaimed
Hou Songsanbo Bioisystech Co., Ltd checks order.
The nucleotide sequence design TAIL-PCR primer uspl obtained according to order-checking, usp2, usp3；Dspl, dsp2, dsp3
(see Table 1).Obtained the flanking sequence of known sequence by TAIL-PCR, amplification obtains sending three rich biological skills after product reclaims
Art company limited checks order.Full-length gene is obtained after the sheet cracked ends splicing checking order correct.
Primer needed for the experiment of 1, table
The acquisition of embodiment 2 'beta '-mannase cDNA
Extract Staphylotrichum coccosporum total serum IgE, utilize Oligo (dT)20CDNA is obtained with reverse transcription
A chain, then design amplification open reading frame primers F and R(be shown in Table 1), expand this strand cDNA, it is thus achieved that manna gather
The cDNA sequence of carbohydrase, amplification obtains product and reclaims the order-checking of Hou Songsanbo Bioisystech Co., Ltd.
By including containing 4 finding after the genome sequence of mannase and cDNA sequence comparison that this gene has
Son, the long 1362bp of cDNA, encode 453 aminoacid and a termination codon, N end 16 aminoacid is its signal peptide sequence, warp
Comparison proves that the gene of the coding mannase that separating clone obtains from Staphylotrichum coccosporum is new
Gene.
The structure of embodiment 3 'beta '-mannase engineered strain
(1) expression vector structure and in the expression of yeast
With the cDNA of the correct mannase Man5DB of order-checking as template, design has synthesized with EcoR I and Not I
The expression primers F of restriction enzyme site and R(are shown in Table 1), the coding region of the maturation protein of Man5DB is expanded.And utilize
EcoR I and Not I enzyme action PCR primer, connect and enter expression vector pPIC9 (Invitrogen, San Diego), and β-manna gathers
The sequence of carbohydrase Man5DB maturation protein is inserted into the downstream of the signal peptide sequence of above-mentioned expression vector, is formed correctly with signal peptide
Reading frame, be built into Yeast expression carrier pPIC9-man5DB, convert competent escherichia coli cell JM109.Positive turn
Beggar carries out DNA sequencing, and order-checking shows that transformant that sequence is correct is for preparing recombiant plasmid in a large number.Use restricted enzyme
Bgl II carries out linearisation expression plasmid carrier DNA, electroporated yeast GS115 competent cell, coats histidine defect
Property RDB flat board, 30 DEG C cultivate 2-3 days, the transformant that picking grow on RDB flat board further expresses experiment, have
Gymnastics refer to Pichia anomala expression workbook.
Build the expression vector of the cDNA containing Man5DB signal peptide sequence in the same way, and convert.
(2) screening of high Mannanase Activity transformant
There is picking list bacterium colony the RDB plate of transformant with sterilized toothpick from long, first put on MM according to numbering, then point
On the MD flat board of corresponding numbering, each flat board is put 100 single bacterium colonies, altogether 200 transformants；Point there is transformant
MM, MD flat board is placed in 30 DEG C of incubators cultivation 1～2 day, grows to bacterium colony.Picking transformant inoculation from MD flat board by number
In the centrifuge tube equipped with 3mL BMGY culture medium, 30 DEG C, 220rpm shaking table cultivation 48h；Shaking table is cultivated the bacterium solution 3 of 48h,
000 × g is centrifuged 15min, removes supernatant, adds the BMMY culture medium that 1mL contains 0.5% methanol in centrifuge tube, 30 DEG C,
220rpm inducing culture；After inducing culture 48h, 3,000 × g is centrifuged 5min, takes supernatant for Enzyme assay, therefrom filters out
The transformant of high Mannanase Activity, concrete operations refer to Pichia anomala expression workbook.
Embodiment 4 is recombinated the preparation of 'beta '-mannase
(1) beta-mannase gene Man5DB great expression of shaking flask level in Pichia sp.
Filter out enzyme higher transformant alive, be inoculated in the 1L triangular flask of 400mL BMGY fluid medium, 30 DEG C,
220rpm shaking table shaken cultivation 48h；5,000rpm are centrifuged 5min, softly abandon supernatant, then contain 0.5% first to thalline addition 200mL
The BMMY fluid medium of alcohol, 30 DEG C, 220rpm inducing culture 72h.During inducing culture, it is molten that interval 24h adds a methanol
Liquid, to compensate the loss of methanol, makes methanol concentration be maintained at about 0.5%；(3) 12,000 × g are centrifuged 10min, collect supernatant and send out
Ferment liquid, detection enzymatic activity also carries out SDS-PAGE protein electrophoresis analysis.
(2) purification of restructuring 'beta '-mannase
Collect the restructuring 'beta '-mannase supernatant that shaking flask is expressed, concentrated by 10kDa film bag, use less salt simultaneously
Buffer exchange culture medium therein, then further concentrates with 10kDa super filter tube.Concentration can be diluted to the weight of certain multiple
Group Man5DB, is purified by ion-exchange chromatography.Specifically, take Man5DB concentrated solution 2.0mL and use 20mM through in advance
HiTrap Q Sepharose XL anion column equilibrated for Tris-HCl (pH8.0), is then carried out with the NaCl of 0-1mol/L
Linear gradient elution, detects enzymatic activity to the eluent of Fraction collection and carries out the mensuration of protein concentration, utilizing SDS-PAGE electricity
The purity (Fig. 1) of swimming analyzing proteins.
Embodiment 5 is recombinated 'beta '-mannase some properties analysis
Use DNS method that the mannase of the present invention is carried out activity analysis.Concrete grammar is as follows: at pH5.0,65 DEG C of bars
Under part, the reaction system of 1mL includes dilution enzyme liquid suitable for l00 μ L, 900 μ L substrates, reacts l0rnin, adds 1.5mL DNS
Terminate reaction, boiling water boiling 5mn.After cooling, 540nm measures OD value.Mannanase Activity unit definition: under certain condition, often
Minute decomposing the enzyme amount that mannan generates needed for l μm ol reducing sugar is 1 active unit (U).
(1) optimum pH of mannase Man5DB and pH stability
The mannase Man5DB that purified embodiment 3 is expressed carries out enzymatic reaction to measure it under different pH
Optimum pH.Buffer used is citric acid one disodium hydrogen phosphate series of buffer and pH8.0～l0.0Tris-of pH3.0～8.0
HCl series of buffer.The pH adaptive result that the mannase Man5DB of purification measures at buffer system .60 DEG C of different pH
(Fig. 2) showing: the optimum pH of Man5DB is 5.0, in the range of pH3.5-pH6.0, this enzyme is able to maintain that its enzyme of more than 60% is lived
Power.
Enzyme liquid is processed in the buffer of different pH value at 37 DEG C 60min, then measures the enzymatic activity pH with studying enzyme
Stability.Result shows (Fig. 3), and analysis result shows to be able to maintain that between pH3.0-pH9.0 the enzyme activity of more than 80%, explanation
This enzyme has excellent pH stability.
(2) mannase Man5DB reaction optimum temperature and heat stability
The mannase of purification, under the conditions of pH5.0, measures the enzymatic activity under different temperatures (30-80 DEG C), analyzes real
Testing result and show display, the optimal reactive temperature of this enzyme is 65 DEG C (Fig. 4).Temperature tolerance is determined as mannase in different temperatures
Lower process different time, then at 65 DEG C, carry out enzyme assay.Heat stability experiment shows: this enzyme processes at 60 DEG C
60min, residual enzyme work, more than 95%, even if this enzyme processes 60min at 60 DEG C, still can keep the enzyme activity of 50%, this
Show that this enzyme has good stability (Fig. 5).
(3) mensuration of the kinetic parameter of restructuring 'beta '-mannase
With carob (the 0.25 5mg mL of variable concentrations-1) it is substrate, at citrate-phosphate disodium hydrogen buffer
(pH5.0), in buffer solution system, measure enzymatic activity at 65 DEG C, calculate its KmValue.After measured, with carob for K during substratem
Value and Vmax are respectively 1.75mg ml-1With 746.3 μm ol min–1mg–1.The protein content measured in enzyme liquid after purification is
0.67mg mL-1, then by enzyme activity determination method, recording its enzyme and living is 532.9U/mL, finally obtains 'beta '-mannase
Ratio live as 795.3U mg-1。
Claims (9)
1. an acidic beta-mannase Man5DB, it is characterised in that its aminoacid sequence such as SEQ ID NO.1 or SEQ ID
Shown in NO.2.
2. an acidic beta-mannase gene, it is characterised in that the coding a kind of acidic beta-manna described in claim 1 gathers
Carbohydrase Man5DB.
Acidic beta-mannase gene the most according to claim 2, it is characterised in that its nucleotide sequence such as SEQ ID
Shown in NO.3, SEQ ID NO.4 or SEQ ID NO.5.
4. comprise the recombinant expression carrier of acidic beta-mannase gene described in claim 2.
5. comprise the recombinant expression carrier pPIC9-man5DB of acidic beta-mannase gene described in claim 2, wherein, incite somebody to action
EcoR I that sequence beta-mannase gene as shown in SEQ ID NO.5 is inserted on pPIC9 and the restricted enzyme action of Not I
Between site, make this nucleotide sequence be positioned at the downstream of AOXl promoter and be regulated and controled by it, obtain recombinant expression carrier pPIC9-
man5DB。
6. comprise the recombinant bacterial strain of acidic beta-mannase gene described in claim 2.
7. comprise the recombinant bacterial strain GS115/man5DB of acidic beta-mannase gene described in claim 2, by claim 5
Described recombinant expression carrier pPIC9-man5DB converts Pichia pastoris GS115 and obtains recombinant bacterial strain GS115/man5DB.
8. the method preparing acidic beta-mannase Man5DB, it is characterised in that comprise the following steps:
(1) with the recombinant expression carrier transformed host cell described in claim 4；
(2) host cell is cultivated；
(3) isolated and purified acquisition 'beta '-mannase Man5DB.
9. acidic beta-mannase Man5DB described in claim 1 is for the application of hydrolyzing mannan.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088929.4A CN103834628B (en) | 2014-03-12 | 2014-03-12 | A kind of acidic beta-mannase and gene thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088929.4A CN103834628B (en) | 2014-03-12 | 2014-03-12 | A kind of acidic beta-mannase and gene thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834628A CN103834628A (en) | 2014-06-04 |
| CN103834628B true CN103834628B (en) | 2017-01-04 |
Family
ID=50798525
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410088929.4A Active CN103834628B (en) | 2014-03-12 | 2014-03-12 | A kind of acidic beta-mannase and gene thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834628B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994479B (en) * | 2012-11-29 | 2014-02-19 | 青岛蔚蓝生物集团有限公司 | Mannose |
-
2014
- 2014-03-12 CN CN201410088929.4A patent/CN103834628B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834628A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101457207B (en) | Eosinophil beta-mannanase MAN5A and gene and application thereof | |
| CN105018448B (en) | The heat-resisting acidic cellulase and its gene of a kind of originated from fungus and application | |
| CN110054702B (en) | Zearalenone degrading enzyme fusion protein and encoding gene and application thereof | |
| CN108559739A (en) | The mannase PMan5A mutant and its gene and application that heat resistance improves | |
| CN109385413A (en) | Glucoamylase TlGA1931 and its gene and application | |
| CN105886484A (en) | Thermophilic cellulase, encoding gene thereof and application of thermophilic cellulase | |
| CN107129976B (en) | Xylanase, coding gene thereof and application thereof | |
| CN103525792B (en) | A kind of high temperature high specific activity acidic beta-mannase and gene thereof and application | |
| CN102363774B (en) | Beta-mannaseBA-Man5A with wide pH range, gene thereof and application of gene | |
| CN105154417B (en) | The acidic cellulase and its gene of a kind of originated from fungus and application | |
| CN100348720C (en) | Mannase and its coding gene and uses | |
| CN107002055B (en) | Fungus-derived high-temperature acidic beta-glucosidase, and coding gene and application thereof | |
| CN106047840B (en) | A kind of acidity exo polygalacturonase and its gene and application | |
| CN102978187B (en) | High-activity beta-mannanase MAN5A with pH value within range of 2.5-6.5, and gene and application thereof | |
| CN103275954B (en) | High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof | |
| CN104388408A (en) | Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3 | |
| CN101948854B (en) | Lactase mutator, secretory expression method and application thereof | |
| CN104560833B (en) | A kind of basophilic micrococcus luteus and its alkalescent xylanase and the application of generation | |
| CN103255118B (en) | Beta-mannase, coding gene as well as producing strain and application thereof | |
| CN103255119A (en) | High temperature beta-mannase, coding gene as well as engineering bacteria and application thereof | |
| CN107488221B (en) | Swollenin protein from fungi and gene and application thereof | |
| CN103834628B (en) | A kind of acidic beta-mannase and gene thereof and application | |
| CN103642779B (en) | A kind of high specific activity acidic beta-mannase Man5D and gene thereof and application | |
| CN103820420B (en) | A kind of high-temperature thermal stability acid alpha-galactosidase Gal27A and gene thereof and application | |
| CN104004733B (en) | A kind of high-temperature acidic 'beta '-mannase Man5DW1 and gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200903 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100081 Beijing, Zhongguancun, South Street, No. 12, No. Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |