CN104388408A - Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3 - Google Patents

Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3 Download PDF

Info

Publication number
CN104388408A
CN104388408A CN201410598371.4A CN201410598371A CN104388408A CN 104388408 A CN104388408 A CN 104388408A CN 201410598371 A CN201410598371 A CN 201410598371A CN 104388408 A CN104388408 A CN 104388408A
Authority
CN
China
Prior art keywords
glu16
dextranase
gene
glucanase
acidic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410598371.4A
Other languages
Chinese (zh)
Other versions
CN104388408B (en
Inventor
姚斌
罗会颖
游帅
石鹏君
黄火清
王亚茹
柏映国
杨培龙
马锐
孟昆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Animal Science of CAAS
Original Assignee
Feed Research Institute of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Feed Research Institute of Chinese Academy of Agricultural Sciences filed Critical Feed Research Institute of Chinese Academy of Agricultural Sciences
Priority to CN201410598371.4A priority Critical patent/CN104388408B/en
Publication of CN104388408A publication Critical patent/CN104388408A/en
Application granted granted Critical
Publication of CN104388408B publication Critical patent/CN104388408B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2448—Licheninase (3.2.1.73)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12C—BEER; PREPARATION OF BEER BY FERMENTATION; PREPARATION OF MALT FOR MAKING BEER; PREPARATION OF HOPS FOR MAKING BEER
    • C12C7/00—Preparation of wort
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/12—Disaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01073—Licheninase (3.2.1.73)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to the field of gene engineering and in particular relates to acid glucanase GLU16-3, a gene for the same and an application of the acid glucanase GLU16-3. The amino acid sequence of the acid glucanase GLU16-3 is shown in SEQ ID NO.1. The glucanase has the following properties: the optimum pH value is 4.0; the optimum temperature is 60 DEG C; the specific activity is 14796.6U/mg; the glucanase has good protease resistance, is used for effectively degrading beta-glucan, laminarin and lichenin and is easily subjected to industrial fermentation production. As a novel enzyme preparation, the acid glucanase GLU16-3 can be widely used in the industries of feed, wine making, food, energy, and the like.

Description

A kind of acid high specific activity dextranase GLU16-3 and gene thereof and application
Technical field
The present invention relates to genetically engineered field, particularly, the present invention relates to a kind of acidic dextranase GLU16-3 and gene, the recombinant vectors comprising this gene and application.
Background technology
Mierocrystalline cellulose, hemicellulose and xylogen etc. are the main moietys of plant cell wall.Mierocrystalline cellulose accounts for greatly 40 ~ 45% of dry cell weight, is the linear structure molecule be formed by connecting by β-Isosorbide-5-Nitrae-glycosidic link by glucose.Xylogen accounts for 15 ~ 25% of dry cell weight, is a kind of complicated phenol polymer.Hemicellulose accounts for 30 ~ 35% of dry cell weight, is renewable biological source the abundantest after Mierocrystalline cellulose.It is made up of poly-polysaccharide of mixing, and forms the sugar occupied the majority and names, be referred to as (Schulze E 1891.Ber Dtsch Chem Ges 24,2277-2287.) such as dextran, mannosans and glucomannan by main chain.Wherein beta-glucan is the structural non-starch polysaccharide in monocotyledonous grasses cell walls, mainly be present in aleurone layer and albuminous cell, as barley and oat Formation of Endosperm Cell Walls containing have an appointment 70 ~ 75% dextran (Philippe S et al.2006.Planta 224 (2), 449-461.)
Beta-glucanase is the general name of the class of enzymes that can decompose the glucose polymer that β-glycosidic link chain becomes.Different by the mode of action, beta-glucanase can be divided into endoglucanase and exoglucanase two class.Wherein inscribe β-1,3-1,4-dextranase (zymetology classification number E.C.3.2.1.73) can be hydrolyzed β-1,3-1,4-dextran, single-minded act on β-1,3 key be connected β-1,4 glycosidic links, make it be degraded to low molecular weight fraction, lose wetting ability and viscosity.Change the characteristic of monogastric animal intestinal contents, improve endogenous digestive enzyme activity, change enteric microorganism environment, be beneficial to the absorption and digestion of animal to nutritive substance, the transformation efficiency (Mathlouthi N et al.2002.Amin Res 51,395-406.) improving growth performance and feed has broad application prospects in food and feed industry etc.
In brewage industry, there is potential application prospect, in Process of Beer Brewing, the dextran in Fructus Hordei Germinatus causes beer filtration difficulty, blocking filtering membrane, adds production cost and the quality of beer, adopt acidic dextranase and dextranase synergy, can overcome the above problems.Therefore, the architecture basics of the generation of acidic dextranase, purifying, character, acidic character and deepening continuously in the application in the fields such as feed manufacturing, wine industry, fruit juice production and the energy.
Because different industry is different to dextranase property requirements, therefore, obtains the novel research with good characteristic dextranase and be still significant.This time cloning is very high with the dextranase Rate activity of the acidity be separated, and effectively can reduce its cost in industrial application, can better be applied to feed, wine brewing, foodstuffs industry.Dextranase in the present invention all has high enzyme vigor under acidity, neutral pH, there is excellent pH stability, keep stable between pH1 ~ 10, and there is fine thermostability and stomach en-and trypsin-resistant, show higher hemicellulase activity, Fructus Hordei Germinatus viscosity degradation experiment shows, it has a significant effect to the reduction of Fructus Hordei Germinatus viscosity, meet multiple industry needs, especially at feed, in the industrial circle such as brewage and food, there is good application potential.
Summary of the invention
The object of this invention is to provide a kind of acidic dextranase of energy efficient application.
Another object of the present invention is to provide the gene of above-mentioned acidic dextranase of encoding.
Another object of the present invention is to provide the recombinant vectors comprising said gene.
Another object of the present invention is to provide the recombinant bacterial strain comprising said gene.
Another object of the present invention is to provide a kind of gene engineering method preparing above-mentioned acidic dextranase.
Another object of the present invention provides the application of above-mentioned acidic dextranase.
The present invention is separated and obtains a kind of new acidic dextranase GLU16-3 from blue shape bacterium (Talaromyces leycettanus), and its aminoacid sequence is as shown in SEQ ID NO.1.
SEQ ID NO.1：
MRSTTTLLPLVALLAKLSTAGYVLQDDYGNSDSFFDKFTFFTGSDPTHGFVQYVDQATAENAGLIHASNGEVYIGVDHTNVASGSGRQSVRITSTNSYTHGLFIVDLAHMPGSICGAWPAFWMVGANWPNNGEIDIIEGVNQQTNNAMTLHTNEGCTIDNSGFTGTLVTSNCWINAPGQSTNAGCSIDSTSSQSYGTGFNNAGGGVYATEWTSNGISIWFFPRGSTPADISSGSPDPSTWGTPAASFGGSGCDIDSHFGAQQIVFDTTFCGDWAGNVWSSGSCASLAGTCQDYVANNPSAFAEAYWYVNSLKVYQDTAESTIIAHGPGNVTSTHSTTAPVPFARTHRIRRHGHGN
Wherein, this enzyme genes encoding 355 amino acid, N holds 20 amino acid to be its signal peptide sequence " mrstttllplvallaklsta " (SEQ ID NO.3).
Therefore, the theoretical molecular of ripe acidic dextranase GLU16-3 is 35.4kDa, and its aminoacid sequence is as shown in SEQ ID NO.2:
GYVLQDDYGNSDSFFDKFTFFTGSDPTHGFVQYVDQATAENAGLIHASNGEVYIGVDHTNVASGSGRQSVRITSTNSYTHGLFIVDLAHMPGSICGAWPAFWMVGANWPNNGEIDIIEGVNQQTNNAMTLHTNEGCTIDNSGFTGTLVTSNCWINAPGQSTNAGCSIDSTSSQSYGTGFNNAGGGVYATEWTSNGISIWFFPRGSTPADISSGSPDPSTWGTPAASFGGSGCDIDSHFGAQQIVFDTTFCGDWAGNVWSSGSCASLAGTCQDYVANNPSAFAEAYWYVNSLKVYQDTAESTIIAHGPGNVTSTHSTTAPVPFARTHRIR RHGHGN
The pH stability that dextranase GLU16-3 of the present invention has had simultaneously, and in acid and neutral scope, all there is the characteristic such as high reactivity, proteolytic degradation under normal temperature.The present invention screens the dextranase that Talaromyces leycettanus produces, and its optimum pH is 4.0, maintains the enzymic activity of more than 60% in the scope of pH1.0 ~ 10.0; Optimum temperuture is 60 DEG C; By stomach en-and trypsin treatment 30 minutes, enzyme is lived free of losses.
The invention provides the above-mentioned acidic dextranase GLU16-3 of coding.Particularly, the genome sequence of this gene is as shown in SEQ ID NO.4:
atgcggtccacaaccacactccttcctctcgtggccctgttggccaagctcagcacagctggttatgtgctgcaggatgattatggaaactcggattccttctttgacaagttcactttcttcacggtatgcgctcgatgatatatagcttaccggttggacctacgtgcactgacacgactttcagggctctgacccaacccacggctttgtccagtatgtcgaccaggccacagcagagaatgcaggtctgattcacgcgtcgaacggcgaggtctatattggcgtcgatcataccaatgtcgccagtggtagcggccgtcagagcgtgcgcatcaccagcaccaacagctatactcatggcctgttcattgtggaccttgcgcatatgcccggtagcatctgcggagcctggcctgccttgtaagtggcagttaatctcttccactctcatctgccagggttttttttgttttacctgacctggcaacagctggatggtcggtgccaactggccgaacaacggcgaaatcgatatcatcgaaggagtcaaccaacagaccaacaacgccatgacccttcacactaacgaaggatgcaccatcgacaactctggcttcacgggcactctcgtcaccagcaactgctggataaacgcccccggccaatccaccaacgcaggatgcagcatcgactcgacctcctcacagtcctacggcacgggcttcaacaacgccggcggcggcgtctacgccaccgaatggaccagcaacggcatcagcatctggttcttcccccgcggaagcacccccgcggacatctcatccggcagccccgacccatcgacctggggtactcccgcggcgagcttcggcggctcaggctgcgacatcgactcgcactttggcgcgcagcagatcgtcttcgacacgaccttctgcggcgactgggccggcaacgtctggagctccggcagctgtgcctccctcgcgggcacatgccaggattacgtcgccaacaacccttccgcgttcgccgaggcgtactggtacgtcaactcgttgaaggtctaccaggacaccgcggaaagtactataatagctcatggccccggtaatgtgacttcgacacattcgacgaccgctccggttcccttcgcgcgcacacaccgtatccgcagacatggccatggcaattag
The present invention passes through the method separating clone of PCR glucanase gene GLU16-3, DNA complete sequence analysis result and shows, dextranase GLU16-3 genome GLU16-3 total length 1199bp, cNDA coding gene sequence total length 1068bp.Wherein, the base sequence of signal peptide is:
ATGCGGTCCACAACCACACTCCTTCCTCTCGTGGCCCTGTTGGCCAAGCTCAGCACAGCT(SEQ ID NO.6)。
CDNA (the removing signal peptide) sequence of ripe dextranase GLU16-3 is as shown in SEQ ID NO.5.
SEQ ID NO.5
Ggttatgtgctgcaggatgattatggaaactcggattccttctttgacaagttcactttcttcacgggctctgacccaacccacggctttgtccagtatgtcgaccaggccacagcagagaatgcaggtctgattcacgcgtcgaacggcgaggtctatattggcgtcgatcataccaatgtcgccagtggtagcggccgtcagagcgtgcgcatcaccagcaccaacagctatactcatggcctgttcattgtg gaccttgcgcatatgcccggtagcatctgcggagcctggcctgccttctggatggtcggtgccaactggccgaacaacggcgaaatcgatatcatcgaaggagtcaaccaacagaccaacaacgccatgacccttcacactaacgaaggatgcaccatcgacaactctggcttcacgggcactctcgtcaccagcaactgctggataaacgcccccggccaatccaccaacgcaggatgcagcatcgactcgacctcctcacagtcctacggcacgggcttcaacaacgccggcggcggcgtctacgccaccgaatggaccagcaacggcatcagcatctggttcttcccccgcggaagcacccccgcggacatctcatccggcagccccgacccatcgacctggggtactcccgcggcgagcttcggcggctcaggctgcgacatcgactcgcactttggcgcgcagcagatcgtcttcgacacgaccttctgcggcgactgggccggcaacgtctggagctccggcagctgtgcctccctcgcgggcacatgccaggattacgtcgccaacaacccttccgcgttcgccgaggcgtactggtacgtcaactcgttgaaggtctaccaggacaccgcggaaagtactataatagctcatggccccggtaatgtgacttcgacacattcgacgaccgctccggttcccttcgcgcgcacacaccgtatccgcagacatggccatggcaattag
Maturation protein theoretical molecular is 35.5kDa, GLU16-3 is a kind of new dextranase.
Present invention also offers the recombinant vectors comprising above-mentioned acidic dextranase gene GLU16-3, be preferably pPIC-GLU16-3.Glucanase gene of the present invention is inserted between the suitable restriction enzyme site of expression vector, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, be preferably and glucanase gene of the present invention be inserted between EcoR I on plasmid pPIC9 and Not I restriction enzyme site, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulate and control by it, obtain expression of recombinant yeast plasmid pPIC9-GLU16-3.
Present invention also offers the recombinant bacterial strain comprising above-mentioned acidic dextranase gene GLU16-3, preferred described bacterial strain is intestinal bacteria, yeast, genus bacillus or lactobacillus, is preferably recombinant bacterial strain GS115/GLU16-3.
Present invention also offers a kind of method preparing acidic dextranase GLU16-3, comprise the following steps:
1) with above-mentioned recombinant vectors transformed host cell, recombinant bacterial strain is obtained;
2) cultivate recombinant bacterial strain, induction restructuring dextranase is expressed; And
3) the dextranase GLU16-3 also expressed by purifying is reclaimed.
Wherein, preferred described host cell is Pichia pastoris, cerevisiae or many types of inferior yeast cell, preferably by expression of recombinant yeast Plastid transformation Pichia pastoris (Pichia pastoris) GS115, obtain recombinant bacterial strain GS115/GLU16-3.
Present invention also offers the application of above-mentioned acidic dextranase GLU16-3.
The present invention's technical problem first to be solved overcomes the deficiencies in the prior art, provide a kind of good properties, be suitable at feed, wine brewing, dextranase that Applications in Food Industry is new.Dextranase optimal pH of the present invention is 4.0, has higher enzymic activity in pH2.0 ~ 6.0; PH good stability; There is the ability of good protease inhibitor; and there is higher fiber element enzymic activity.This dextranase can be applicable to fodder industry, effectively reduces viscosity, eliminates or reduces the anti-oxidant action caused because viscosity increases.In wine industry, dextran of can effectively degrading, the viscosity effectively reducing wort improves filtration efficiency clarifying beer.Therefore, the application of this dextranase in energy industry also demonstrates its huge potentiality.
Accompanying drawing explanation
Fig. 1 recombinates the optimal pH of dextranase.
Fig. 2 recombinates the pH stability of dextranase.
Fig. 3 recombinates the optimum temperuture of dextranase.
Fig. 4 recombinates the thermostability of dextranase.
Embodiment
Test materials and reagent
1, bacterial strain and carrier: the present invention is separated and obtains a kind of new acidic dextranase GLU16-3 from (Talaromyces leycettanus).Yeast expression vector pPIC9 and bacterial strain GS115 is purchased from Invitrogen company.
2, enzyme and other biochemical reagents: restriction endonuclease is purchased from TaKaRa company, and ligase enzyme is purchased from Invitrogen company.Oat beta-glucan available from Sigma, other is all domestic reagent (all can buy from common biochemical Reagent Company and obtain).
3, substratum:
(1) Talaromyces leycettanus JCM12802 substratum is potato juice substratum: 1000mL potato juice, 10g glucose, 25g agar, pH2.5.
(2) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0).
(3) BMGY substratum: 1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerine (V/V).
(4) BMMY substratum: replace glycerine divided by 0.5% methyl alcohol, all the other compositions are all identical with BMGY, pH4.0.
Illustrate: in following examples, do not make the experimental methods of molecular biology illustrated, concrete grammar listed in equal reference " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book carries out, or carries out according to test kit and product description.
The clone of embodiment 1 blue shape bacterium Talaromyces leycettanus JCM12802 glucanase coding gene as well as GLU16-3
Extract blue shape bacterium 12802Talaromyces leycettanus JCM12802 genomic dna:
The liquid culture mycelium aseptic filter paper of 3 days is filtered and puts into mortar, add 2mL extracting solution, grinding 5min, then lapping liquid is placed in 50mL centrifuge tube, 65 DEG C of water-bath cracking 20min, every 10min mixing once, the centrifugal 5min of 10000rpm at 4 DEG C.Get supernatant extrct foreigh protein removing in phenol/chloroform, then get supernatant and add equal-volume Virahol, after room temperature leaves standstill 5min, the centrifugal 10min of 10000rpm at 4 DEG C.Abandon supernatant, precipitate with 70% washing with alcohol twice, vacuum-drying, adds appropriate TE and dissolves, be placed in-20 DEG C for subsequent use.
Conservative (GYCDA (S) QC and GCG (D) FNPY) sequences Design according to the 16th family's glucanase gene has synthesized degenerated primer P1, P2
P1:5'-TGCGGTAYNTGGCCNGC-3'；
P2:5'-CCGGCCCANTBNCCRCARAA-3'。
With Talaromyces leycettanus JCM12802 STb gene for template carries out pcr amplification.PCR reaction parameter is: 94 DEG C of sex change 5min; Then 94 DEG C of sex change 30sec, 45 DEG C of annealing 30sec, 72 DEG C extend 1min, 30 rear 72 DEG C of insulation 10min of circulation.Obtain an about 558bp fragment, be connected with pEASY-T3 carrier after this fragment is reclaimed and send three rich Bioisystech Co., Ltd to check order.
According to the nucleotide sequence obtained that checks order, each three the TAIL-PCR Auele Specific Primers of design upstream and downstream: design direction is the zone of ignorance direction needing amplification, and the Position Design of sp2 is in the inner side of sp1, and sp3 is positioned at the inner side of sp2.Distance between every two primers does not have strict regulation, and the general 22 ~ 30nt of primer length, annealing temperature is at 60 ~ 65 DEG C.Obtained the flanking sequence of known sequence by TAIL-PCR, amplification obtains product and reclaims the order-checking of Hou Songsanbo Bioisystech Co., Ltd.GLU16-3 glucanase gene total length 1199bp after splicing, encode 355 amino acid and a terminator codon, N holds 20 amino acid to be signal peptide.Predict that the theoretical molecular of the maturation protein of this coded by said gene is 35.5kDa.
Embodiment 2 is recombinated the preparation of dextranase
Expression vector pPIC9 is carried out double digestion (EcoR I+Not I), simultaneously by the gene GLU16-3 double digestion (EcoR I+Not I) of encode glucanase, the gene fragment cutting out encoding mature dextranase is connected with expression vector pPIC9, obtain the recombinant plasmid pPIC-GLU16-3 containing Talaromyces leycettanus JCM12802 glucanase gene GLU16-3 and transform Pichia pastoris GS115, obtaining recombinant pichia yeast strain GS115/GLU16-3.
In kind build the recombinant expression plasmid of the glucanase gene GLU16-3 containing signal peptide sequence, and obtain restructuring recombinant pichia yeast strain.
Get the GS115 bacterial strain containing recombinant plasmid, be inoculated in 300mL BMGY nutrient solution, after 30 DEG C of 250rpm shaking culture 48h, collected by centrifugation thalline.Then resuspended in 150mL BMMY substratum, 30 DEG C of 250rpm shaking culture.After induction 72h, collected by centrifugation supernatant.Measure the vigor of dextranase.The expression amount of restructuring dextranase is 706.9U/mL.SDS-PAGE result shows, restructuring dextranase obtains expression in pichia spp.The specific activity of restructuring dextran is 14796.6U/mg.
Embodiment 4 is recombinated the activation analysis of dextranase
DNS method: concrete grammar is as follows: at pH5.0, under 60 DEG C of conditions, the reaction system of 1mL comprises the suitable dilution enzyme liquid of 100 μ L, 900 μ L substrates, and reaction 10min, adds 1.5mL DNS termination reaction, boiling water boiling 5min.After cooling, 540nm measures OD value.1 Ge Meihuo unit (U) is defined as per minute under given conditions and discharges enzyme amount required for 1 μm of ol reducing sugar.
Embodiment 5 is recombinated the property testing of dextranase GLU16-3
The measuring method of the optimal pH of dextranase GLU16-3 and the pH stability of 1, recombinating is as follows:
The restructuring dextranase of embodiment 4 purifying is carried out under different pH enzymatic reaction to measure its optimal pH.Substrate dextran carries out dextranase vitality test with in the 0.1mol/L citrate-phosphate disodium hydrogen damping fluid of different pH 60 DEG C.Result (Fig. 1) shows, the optimal pH of recombinase GLU16-3 is 4.0, has the relative activity of more than 60% in pH3.0 ~ 5.0.Dextranase is 37 DEG C of process 60min in the damping fluid of above-mentioned various different pH, then in pH4.0 buffer solution system, measure enzymic activity at 60 DEG C, with the pH patience of studying enzyme.Result (Fig. 2) shows that dextranase is all very stable between pH 1.0-10.0, and process 60min within the scope of this pH after, residual enzyme is active in about 60%, and this illustrates that this enzyme has good pH stability in acidity and neutral range.
2, the optimum temperuture of dextranase and thermal stability determination method as follows:
Being determined as of optimum temperuture of dextranase carries out enzymatic reaction under citrate-phosphate disodium hydrogen damping fluid (pH4.0) buffer solution system and differing temps.Temperature tolerance is determined as dextranase and processes different time at different temperatures, then carries out enzyme assay at 60 DEG C.Enzyme reaction optimum temperuture measurement result (Fig. 3) shows that its optimum temperuture is 60 DEG C.The thermostability test of enzyme shows (Fig. 4), and GLU16-3 has good thermostability, incubation 1h at 60 DEG C, and the enzyme of more than 90% can be kept to live.
3, the K of dextranase mvalues determination method is as follows:
Be substrate by the dextran of different concns, in citrate-phosphate disodium hydrogen damping fluid (pH4.0) buffer solution system, at 60 DEG C, measure enzymic activity, calculate its K mvalue.After measured, K when taking dextran as substrate mvalue is 4mg/mL, maximum reaction velocity V maxbe 20000 μm of ol/minmg.
4, different metal ion chemistry reagent is determined as follows the impact that GLU16-3 enzyme is lived:
In enzymatic reaction system, add different metal ions and the chemical reagent of different concns, study its impact on enzymic activity, various material final concentration is 5mmol/L.60 DEG C, measure enzymic activity under pH4.0 condition.Result shows, recombinate when concentration the is 5mmol vigor of dextranase of part ion and chemical reagent does not have considerable change.But Ag +, Pb 2+, Cu 2+, Mn 2+, Fe 3+can suppress its half vigor nearly, and SDS can its vigor of strongly inhibited.And Na +can partly activate GLU16-3 enzyme activity.
5, dextranase antipepsin and trypsinase ability are determined as follows:
With pH2.0KCl-HCl buffer 0.1mg/mL stomach en-, pH7.0Tris-HCl buffer 0.1mg/mL trypsinase.The enzyme liquid getting the 0.5mL purifying after the dilution of pH2.0KCl-HCl damping fluid adds 0.5mL stomach en-, the enzyme liquid of the 0.5mL purifying after the dilution of pH7.0Tris-HCl damping fluid adds the mixing of 0.5mL trypsinase, proteolytic enzyme/dextranase (w/w) ≈ 0.1,37 DEG C of insulations 30 and 60min sampling, measure enzymic activity under pH5.0 and 60 DEG C condition.After experimental result shows dextranase GLU16-3 stomach en-and trypsin treatment 60min, the GLU16-3 after protease treatment still has the enzyme work of more than 85%.
6, the substrate specificity of restructuring dextranase
This enzyme, except acting on except barley, also has certain Degradation to lichenstarch, laminarin and Rhizoma amorphophalli powder.This enzyme mainly cuts β-Isosorbide-5-Nitrae glycosidic link, barley and lichenstarch can be decomposed into glucoseor cellobiose.It is 5.2% to the degradation capability of laminarin relative to barley, illustrates that it has faint cutting β-1,3 glycosidic link ability.Be 4.5% to the degradation capability of hemicellulose Rhizoma amorphophalli powder relative to barley.
7, the impact of zytase on barley germ juice viscosity and filtration velocity is added
Barley germ, through pulverizer process, is crossed 0.2mm screen cloth, is dissolved in 100mL citrate-phosphate disodium hydrogen damping fluid.Add the restructuring dextranase GLU16-3 of 100 or 150U.Then respectively at 55,60,65 DEG C of process 30min, 60 DEG C of process 60min, 70 DEG C of process 30min, finally boil 5min deactivation.Experiment contrast is not for add dextranase.Its filtration velocity is measured with filter paper.Get the agent of 5ml filtered liquid viscosity and measure its viscosity numerical value.Result shows, adds the enzyme liquid process of 100U, its with compare, filtration velocity and viscosity reduce by 20.1% and 17.8% respectively.

Claims (10)

1. an acidic dextranase GLU16-3, is characterized in that, its aminoacid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.
2. acidic dextranase GLU16-3 as claimed in claim 1, is characterized in that, sequence SEQ ID NO.1 comprises signal peptide at N end, and the sequence of described signal peptide is as shown in SEQ ID NO.3.
3. an acidic dextranase gene GLU16-3, is characterized in that, encode acidic dextranase GLU16-3 according to claim 1.
4. acidic dextranase gene GLU16-3 as claimed in claim 3, it is characterized in that, its base sequence is as shown in SEQ ID NO.4 or SEQ ID NO.5.
5. acidic dextranase gene GLU16-3 as claimed in claim 3, it is characterized in that, described acidic dextranase gene GLU16-3 comprises signal peptide sequence, and described sequence is as shown in SEQ ID NO.6.
6. comprise the recombinant vectors of acidic dextranase gene GLU16-3 described in claim 3.
7. comprise the recombinant vectors pPIC-GLU16-3 of acidic dextranase gene GLU16-3 described in claim 3.
8. comprise the recombinant bacterial strain of acidic dextranase gene GLU16-3 described in claim 3.
9. prepare a method of acidic dextranase gene GLU16-3, it is characterized in that, comprise the following steps:
1) with the recombinant vectors transformed host cell of claim 6, recombinant bacterial strain is obtained;
2) cultivate recombinant bacterial strain, induction restructuring dextranase is expressed;
3) the dextranase GLU16-3 also expressed by purifying is reclaimed.
10. the application of acidic dextranase GLU16-3 described in claim 1.
CN201410598371.4A 2014-10-30 2014-10-30 Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3 Active CN104388408B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410598371.4A CN104388408B (en) 2014-10-30 2014-10-30 Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410598371.4A CN104388408B (en) 2014-10-30 2014-10-30 Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3

Publications (2)

Publication Number Publication Date
CN104388408A true CN104388408A (en) 2015-03-04
CN104388408B CN104388408B (en) 2017-01-11

Family

ID=52606369

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410598371.4A Active CN104388408B (en) 2014-10-30 2014-10-30 Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3

Country Status (1)

Country Link
CN (1) CN104388408B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113416721A (en) * 2021-06-04 2021-09-21 江苏科技大学 N-glycosylation mutants of GH16 family glucanase and application thereof
CN113699136A (en) * 2021-06-04 2021-11-26 江苏科技大学 Beta-1, 3-1, 4-glucanase mutant with high catalytic activity at animal body temperature and application thereof
CN114317495A (en) * 2022-01-10 2022-04-12 鑫缘茧丝绸集团股份有限公司 Glucanase mutant with improved heat stability and application thereof
CN114836402A (en) * 2022-04-26 2022-08-02 江苏科技大学 GH16 family heat stability enhanced glucanase mutant and construction method and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101748108B (en) * 2008-12-09 2013-04-03 中国农业科学院饲料研究所 Acidophil Beta-glucanase GLU7A and gene and application thereof
DK2668265T3 (en) * 2011-01-26 2017-10-16 Novozymes As Hitherto unknown glycoside hydrolases from thermophilic fungi
CN102154246B (en) * 2011-01-28 2012-11-28 武汉新华扬生物股份有限公司 Acid glucanase CEL7G5 and gene and application thereof

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113416721A (en) * 2021-06-04 2021-09-21 江苏科技大学 N-glycosylation mutants of GH16 family glucanase and application thereof
CN113699136A (en) * 2021-06-04 2021-11-26 江苏科技大学 Beta-1, 3-1, 4-glucanase mutant with high catalytic activity at animal body temperature and application thereof
CN113416721B (en) * 2021-06-04 2022-07-22 江苏科技大学 N-glycosylation mutants of GH16 family glucanase and application thereof
CN113699136B (en) * 2021-06-04 2023-02-03 江苏科技大学 Animal body beta-1, 3-1, 4-glucanase mutant with high catalytic activity at room temperature and application thereof
CN114317495A (en) * 2022-01-10 2022-04-12 鑫缘茧丝绸集团股份有限公司 Glucanase mutant with improved heat stability and application thereof
CN114836402A (en) * 2022-04-26 2022-08-02 江苏科技大学 GH16 family heat stability enhanced glucanase mutant and construction method and application thereof
CN114836402B (en) * 2022-04-26 2023-11-21 江苏科技大学 Glucanase mutant with enhanced GH16 family thermal stability, construction method and application thereof

Also Published As

Publication number Publication date
CN104388408B (en) 2017-01-11

Similar Documents

Publication Publication Date Title
CN101457207B (en) Eosinophil beta-mannanase MAN5A and gene and application thereof
CN104388408B (en) Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3
CN107129976B (en) Xylanase, coding gene thereof and application thereof
CN101748108B (en) Acidophil Beta-glucanase GLU7A and gene and application thereof
CN102363774B (en) Beta-mannaseBA-Man5A with wide pH range, gene thereof and application of gene
CN103275954B (en) High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof
CN103525792B (en) A kind of high temperature high specific activity acidic beta-mannase and gene thereof and application
CN102181416B (en) Alkali-resisting beta-mannase Man5A as well as gene and applications thereof
CN102533698B (en) High temperature acidic mannase Man5C1, and gene and application thereof
CN101724565A (en) Acid xylanase XYNB, genes and application thereof
CN102154246B (en) Acid glucanase CEL7G5 and gene and application thereof
CN103695397B (en) Mesophilic acidic xylanase XYN10L1 and gene and application thereof
CN104498456A (en) Acidic beta-glucosidase Bgl3B and gene and application thereof
CN101851612B (en) Acid glucanase CELA and gene and application thereof
CN102154244B (en) High-temperature acid cellulase EgG5 and gene and application thereof
CN103789283B (en) A kind of neutral arabinofuranosidase Abf43 and gene thereof and application
CN101892208B (en) High-temperature acidic xylanase XYN10J88, gene and application thereof
CN102586206B (en) High temperature acidic xylanase XYN10C1 as well as gene and application thereof
CN104388407A (en) Acid glucanase GLU16-8, gene for same and application of acid glucanase GLU16-8
CN105176950B (en) Acidic thermophilic xylanase TLXyn10A, and gene and application thereof
CN101838637B (en) Wide-temperature applicability acidic dextranase AGL9A, and gene and application thereof
CN104152428B (en) Mannase ManAGN25 with low temperature activity and gene thereof
CN103642779B (en) A kind of high specific activity acidic beta-mannase Man5D and gene thereof and application
CN103074317B (en) High temperature neutral xylanase XYNA used for brewing beer and gene and application thereof
CN104004734B (en) A kind of neutral β-Mannannase Man26DW1 and gene and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20200828

Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2

Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences

Address before: 100081 Beijing, Zhongguancun, South Street, No. 12, No.

Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES

TR01 Transfer of patent right