CN103275954B - High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof - Google Patents
High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof Download PDFInfo
- Publication number
- CN103275954B CN103275954B CN201310062872.6A CN201310062872A CN103275954B CN 103275954 B CN103275954 B CN 103275954B CN 201310062872 A CN201310062872 A CN 201310062872A CN 103275954 B CN103275954 B CN 103275954B
- Authority
- CN
- China
- Prior art keywords
- man5xz7
- mannase
- high temperature
- gene
- alkali resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to the field of gene engineering, concretely relates to high temperature and alkali resisting mannanase Man5XZ7, gene and application thereof. The amino acid sequence is shown in the SEQ ID No.1 or SEQ ID No.2. The invention provides a new excellent high temperature and alkali resisting mannanase which is suitable for foodstuff and weaving industry, and solves the technology problem and overcomes the prior art. The optimized pH of mannanase of the present invention is pH 5.0, and the mannanase has a higher enzyme activity at pH 8.0-9.0; the product has a good pH stability; the product has a good antitrypsin capability.
Description
Technical field
The present invention relates to genetically engineered field, particularly, the present invention relates to a kind of high temperature alkali resistant mannase Man5XZ7 and gene and application.
Background technology
Plant cell wall polysaccharides three major polymers: cellulose, this three major types composition of Salvia polysaccharide of hemicellulose and xylogen.Wherein, the content of hemicellulose is only second to Mierocrystalline cellulose, accounts for 35% of plant dry weight, is the abundantest reproducible biomass resource of occurring in nature.Hemicellulose mainly comprises the multiple composition of Salvia polysaccharides such as xylan, mannosans, xylan, arabogalactan, dextran.The linear polysaccharide that mannosans is formed by connecting with Isosorbide-5-Nitrae-β-D-mannopyranose glycosidic bond.The structural analysis of mannosans finds, on its main chain residue can be replaced by glucose or semi-lactosi by α-1,6-glycosidic link and mannose residue are connected to form branch and are called different mannosans.Mainly contain polygalactomannan (galactomannan), glucomannan (glucomannan), gala glucomannan (galactoglucomannan).Therefore digesting mannosans is mainly to rely on the synergy of beta-mannase excision enzyme and mannoside restriction endonuclease to be decomposed into seminose.Comprising: β-D-mannase (β-mannanase), beta-Mannosidase (β-mannosidase), beta-glucosidase (glucosidase), the side chain enzymes such as alpha-galactosidase (α-galactosidase) and de-acetylation enzyme (deacytle esterase).
'beta '-mannase (β-mannanase, EC3.2.1.78) is the hemicellulase that a class can be hydrolyzed mannosans, is extensively present in microorganism, animal and plant.Protein structure analysis shows, 'beta '-mannase mainly belongs to glycosyl hydrolase family 5 and 26.The glycosyl hydrolase that comprises multiple different sources in glycosyl hydrolase family 5.Be mainly derived from microorganism, comprise fungi, bacterium and actinomycetes, as reported, wood in fungi is mould, mould, aspergillus, yeast and shuttle spore bacterium, the pseudomonas in bacterium, bud pole bacterium, vibrios, and the streptomycete in actinomycetes etc. is all the main monoid of 'beta '-mannase.Because microbe-derived 'beta '-mannase has lot of advantages, as high in enzymic activity, Heat stability is good and extraction are convenient, cost is low, compares with the 'beta '-mannase of plant and animal material, has broader temperature action scope, action pH, the outstanding features such as Substratspezifitaet, therefore, microbe-derived 'beta '-mannase is widely used in actual production and fundamental research
Along with the further investigation to 'beta '-mannase, this enzyme is all widely used at aspects such as feed, papermaking, protective foods and biotechnology research.Wherein the mannase of originated from fungus is beneficial to the high efficient expression of downstream pichia spp external source, is more suitable for industrial production.At present, the mannase of most of originated from fungus mostly is middle temperature acidicenzym, is beneficial at feedstuff industry and applies.But food, textile industry needs high-temperature alkaline enzyme to be applicable to its processing condition.In the present invention, derive from the mannase Man5XZ7 optimal pH 5.0 of Thielavia terrestris Thielavia terrestris XZ7CGMCC6544, under pH9.0, still there is 25.6% activity, and there is satisfactory stability at pH3-10; 75 ℃ of optimum temperutures; And at pichia yeast expression system efficient secretory expression.Due to above advantageous property, Man5XZ7 can be used under needs alkalescence processing condition, has broad application prospects.
Summary of the invention
The high temperature alkali resistant mannase that the object of this invention is to provide a kind of energy efficient application.
A further object of the present invention is to provide the gene of the above-mentioned high temperature alkali resistant mannase of coding.
Another object of the present invention is to provide the recombinant vectors that comprises said gene.
Another object of the present invention is to provide the recombinant bacterial strain that comprises said gene.
Another object of the present invention is to provide a kind of gene engineering method of preparing above-mentioned high temperature alkali resistant mannase.
Another object of the present invention is to provide the application of above-mentioned high temperature alkali resistant mannase.
Another object of the present invention is to provide Thielavia terrestris XZ7.
The present invention (is stored in (No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 10th, 2012 from Thielavia terrestris XZ7 (Thielavia terrestris XZ7CGMCC6544), Institute of Microorganism, Academia Sinica, 100101), its preserving number is: CGMCC6544), separation obtains a kind of new high temperature alkali resistant mannase Man5XZ7.
The invention provides a kind of high temperature alkali resistant mannase Man5XZ7, its aminoacid sequence is as shown in SEQ ID NO.1.
SEQ?ID?NO.1：
MVRNIVATGLSLLSTAGVFLGGAAAQMPTANGTRFTIDGKTGYFAGTNSYWISFLTNNRDVDLVLDHISSSGLRILRVWGFNDVNRRPSSGTVWFQLLSSSGSQINTGADGLQRLDYVVQSAEKRGVKLIINFVNNWNDYGGMQAYVSAFGGSKESWYTNTRAQDQYKKYIAAVVSRYVNLPAVFAWELANEPRCKGCNTDVIFKWATDISAYIRSLDPKHMITLGDEGFGLPGQTTYPYQYGEGTDFVKNLRIKNLDFGTFHMYPSSWGVPNSFGPGWIRDHAAACKAAGKPCLLEEYGVTSDQCNVERTWQAASREQAANGMAGDLFWQWGDQLSTGQTHNDGHTIYYGSSTATCLVTDHVRAINAM*
Wherein, 369 amino acid of this enzyme genes encoding, 25 amino acid of N end are signal peptide sequence " MVRNIVATGLSLLSTAGVFLGGAAA " (SEQ ID NO.3).
Therefore, the theoretical molecular of ripe high temperature alkali resistant mannase Man5XZ7 is 38.3kDa, and its aminoacid sequence is as shown in SEQ ID NO.2:
QMPTANGTRFTIDGKTGYFAGTNSYWISFLTNNRDVDLVLDHISSSGLRILRVWGFNDVNRRPSSGTVWFQLLSSSGSQINTGADGLQRLDYVVQSAEKRGVKLIINFVNNWNDYGGMQAYVSAFGGSKESWYTNTRAQDQYKKYIAAVVSRYVNLPAVFAWELANEPRCKGCNTDVIFKWATDISAYIRSLDPKHMITLGDEGFGLPGQTTYPYQYGEGTDFVKNLRIKNLDFGTFHMYPSSWGVPNSFGPGWIRDHAAACKAAGKPCLLEEYGVTSDQCNVERTWQAASREQAANGMAGDLFWQWGDQLSTGQTHNDGHTIYYGSSTATCLVTDHVRAINAM*
In the thermostability that mannase Man5XZ7 of the present invention has had simultaneously at high temperature neutrality and alkaline range, all there is high reactivity.The present invention screens the mannase that Thielavia terrestris XZ7CGMCC6544 produces, and its optimum pH is 5.0, at pH9.0, also maintains more than 25% enzymic activity; Optimum temperuture is 75 ℃, at 85 ℃ of enzyme activities still with 50% left and right.
The invention provides the above-mentioned high temperature alkali resistant mannase man5XZ7 of coding.Particularly, the genome sequence of this gene is as shown in SEQ ID NO.4:
Atggtcagaaacatcgtggccactgggctcagcctgctctcgacggctggagtttttcttggaggagcagcagcacaaatgcccactgccaacgggacacgcttcaccattgacggcaagacgggctactttgcgggcacaaactcgtactggatcagcttcctcaccaacaacagggacgttgatctcgtcttggaccacatctcgtcctccggcctcaggatcctccgagtgtggggattcaacgacgtcaaccgccgcccctcttcgggcaccgtgtggtttcaactgctctcgtcgtccggttcgcagatcaacaccggcgctgacggtctgcagagactcgactatgtcgtccagtcggccgagaagcgcggggtcaagctgattatcaactttgtcaacaactggaacgactacggcggcatgcaagcctacgtttcggcgtttggcggctccaaggaaagctggtacaccaacacgcgggcccaggaccaatacaagaagtacattgcagccgttgtcagccgctatgtcaacttgcccgccgtctttgcctgggaactggccaacgagccccgctgcaaagggtgcaataccgatgtcattttcaagtgggcaaccgatatctcggcttacatccgcagtctggatcccaaacatatgatcacgctgggtgacgagggattcggcctgccaggacaaaccacttacccttaccaatacggcgagggtaccgacttcgtcaagaacctgcgtatcaaaaatctggatttcggcactttccacatgtatcctagtagctggggcgtgccgaacagctttggtcctggttggatccgcgatcacgccgcagcctgcaaagccgctggcaagccttgtcttctggaggagtatggcgtcacatcggaccagtgcaatgtggagcggacgtggcaggcggcttcacgagagcaagctgccaacgggatggcaggcgacctcttctggcagtggggagaccagctgagcaccgggcagacacacaacgacggccacaccatctactatggatctagcaccgccacgtgtttggtgactgatcacgtcagggctattaacgccatgtaa
The method separating clone of the present invention by RT-PCR mannase gene man5XZ7, cDNA complete sequence analysis result shows, mannase Man5XZ7 gene man5XZ7 total length 1110bp.Wherein, the base sequence of signal peptide is:
ATGGTCAGAAACATCGTGGCCACTGGGCTCAGCCTGCTCTCGACGGCTGGAGTTTTTCTTGGAGGAGCAGCAGCA(SEQ?ID?NO.6)。
The gene order of ripe mannase Man5XZ7 is as shown in SEQ ID NO.5.
SEQ?ID?NO.5
caaatgcccactgccaacgggacacgcttcaccattgacggcaagacgggctactttgcgggcacaaactcgtactggatcagcttcctcaccaacaacagggacgttgatctcgtcttggaccacatctcgtcctccggcctcaggatcctccgagtgtggggattcaacgacgtcaaccgccgcccctcttcgggcaccgtgtggtttcaactgctctcgtcgtccggttcgcagatcaacaccggcgctgacggtctgcagagactcgactatgtcgtccagtcggccgagaagcgcggggtcaagctgattatcaactttgtcaacaactggaacgactacggcggcatgcaagcctacgtttcggcgtttggcggctccaaggaaagctggtacaccaacacgcgggcccaggaccaatacaagaagtacattgcagccgttgtcagccgctatgtcaacttgcccgccgtctttgcctgggaactggccaacgagccccgctgcaaagggtgcaataccgatgtcattttcaagtgggcaaccgatatctcggcttacatccgcagtctggatcccaaacatatgatcacgctgggtgacgagggattcggcctgccaggacaaaccacttacccttaccaatacggcgagggtaccgacttcgtcaagaacctgcgtatcaaaaatctggatttcggcactttccacatgtatcctagtagctggggcgtgccgaacagctttggtcctggttggatccgcgatcacgccgcagcctgcaaagccgctggcaagccttgtcttctggaggagtatggcgtcacatcggaccagtgcaatgtggagcggacgtggcaggcggcttcacgagagcaagctgccaacgggatggcaggcgacctcttctggcagtggggagaccagctgagcaccgggcagacacacaacgacggccacaccatctactatggatctagcaccgccacgtgtttggtgactgatcacgtcagggctattaacgccatgtaa
Maturation protein theoretical molecular is 38.3kDa, and mannase gene man5XZ7 sequence and the aminoacid sequence derived are carried out to BLAST comparison in GenBank, and this gene is a kind of new mannase gene.
The present invention also provides the recombinant vectors that comprises above-mentioned high temperature alkali resistant mannase gene man5XZ7, is preferably pPIC-man5XZ7.Mannase gene of the present invention is inserted between the restriction enzyme site that expression vector is suitable, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, be preferably mannase gene of the present invention is inserted between the EcoR I and Not I restriction enzyme site on plasmid pPIC9, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulated and controled by it, obtain expression of recombinant yeast plasmid pPIC9-man5XZ7.
The present invention also provides the recombinant bacterial strain that comprises above-mentioned high temperature alkali resistant mannase gene man5XZ7, and preferred described bacterial strain is intestinal bacteria, yeast, genus bacillus or lactobacillus, is preferably recombinant bacterial strain GS115/man5XZ7.
The present invention also provides a kind of method of preparing high temperature alkali resistant mannase Man5XZ7, comprises the following steps:
1) with above-mentioned recombinant vectors transformed host cell, obtain recombinant bacterial strain;
2) cultivate recombinant bacterial strain, induction restructuring mannosans expression of enzymes;
3) reclaim the also expressed mannase Man5XZ7 of purifying.
Wherein, preferred described host cell is Pichia pastoris, cerevisiae or many types of inferior yeast cell, preferably expression of recombinant yeast plasmid is transformed to Pichia pastoris (Pichia pastoris) GS115, obtains recombinant bacterial strain GS115/Man5XZ7.
The present invention also provides the application of above-mentioned high temperature alkali resistant mannase Man5XZ7, and for example, alkali mannase Man5XZ7 is for the application of degrade polygalactomannan and glucomannan.
The present invention's technical problem first to be solved is to overcome the deficiencies in the prior art, provide a kind of character good, be suitable for applying new high temperature alkali resistant mannase in food, textile industry.Mannase optimal pH of the present invention is 5.0, has higher enzymic activity in pH8.0～9.0; PH good stability; There is good antitryptic ability.In addition Man5XZ7 can effectively degrade various types of polygalactomannan and glucomannan etc., and not degradation of xylan and Microcrystalline Cellulose sodium, the mannosans part in bleached pulp of can effectively degrading and do not affect Mierocrystalline cellulose.Therefore, the application of this mannase in industry also demonstrates its huge potentiality.
Accompanying drawing explanation
The recombinate optimal pH of mannase of Fig. 1.
The recombinate pH stability of mannase of Fig. 2.
The recombinate optimum temperuture of mannase of Fig. 3.
The recombinate thermostability of mannase of Fig. 4.
Thielavia terrestris XZ7 (Thielavia terrestris XZ7CGMCC6544) (is stored in (Datun Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 10th, 2012, Institute of Microorganism, Academia Sinica, 100101), its preserving number is: CGMCC6544).
Embodiment
Test materials and reagent
1, bacterial strain and carrier: separation of the present invention Thielavia terrestris XZ7 (Thielavia terrestris XZ7CGMCC6544).Yeast expression vector pPIC9 and bacterial strain GS115 are purchased from Invitrogen company.
2, enzyme and other biochemical reagents: restriction endonuclease is purchased from TaKaRa company, and ligase enzyme is purchased from Invitrogen company.Carob bean gum is purchased from Sigma company, and other is all domestic reagent (all can buy and obtain from common biochemical reagents company).
3, substratum:
(1) Thielavia terrestris XZ7CGMCC6544 substratum is potato juice substratum: 1000mL potato juice, 10g glucose, 25g agar, pH6.0.
(2) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0).
(3) BMGY substratum: 1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerine (V/V).
(4) BMMY substratum: replace glycerine divided by 0.5% methyl alcohol, all the other compositions are all identical with BMGY, pH4.0.
Illustrate: the experimental methods of molecular biology that in following examples, work illustrates, all with reference to listed concrete grammar in < < molecular cloning experiment guide > > (third edition) J. Pehanorm Brooker one book, carry out, or carry out according to test kit and product description.
Embodiment 1 Thielavia terrestris XZ7CGMCC6544 produces enzyme characteristic
To derive from sand top layer, Guangxi sample (enrichment medium: (NH after enrichment culture
4)
2sO
45g/L, KH
2pO
41g/L, MgSO
47H
2o0.5g/L, FeSO
47H
2o0.01g/L, CaCl
20.2g/L, corn cob meal 0.5%, wheat bran 0.5%, pH2.5), coats culture medium ((NH after dilution routinely
4)
2sO
45g/L, KH
2pO
41g/L, MgSO
47H
2o0.5g/L, FeSO
47H
2o0.01g/L, CaCl
20.2g/L, carob bean gum 0.5%, 1.5% agarose, pH6.0) dull and stereotyped upper, cultivate 3～5d for 45 ℃, it is separated at culture medium plate streaking that picking produces transparent circle bacterium colony, and the sepn process 3 that repeats to rule is taken turns, and makes bacterial strain purifying.By this method, screen the bacterial strain of this secretion mannase.Produce the bacterial strain of transparent circle maximum names as XZ7 after line separation and purification.
Thalline is cultivated respectively after 5d on the PDA of differing temps substratum, and rapidly, poor growth at 30 ℃, does not grow at 19 ℃ in growth at 45 ℃.Bacterium colony is circular, white, and fine hair shape, back side color milk yellow, there are a large amount of pores in the later stage, is ascoma.Ascoma Vandyke brown, spherical without aperture, frangible, appendage mycelioid.Thecaspore Vandyke brown, smooth, unicellular, ellipse, conidiophore is closely vertical, and adnation, on mycelium, has separation, rare branch, conidiogenous cell taper.Conidium is smooth, and water white transparency falls bar-shaped or melon seeds shape more.Through 18S rDNA, identify that this bacterial strain is Thielavia terrestris, name Thielavia terrestris XZ7.Take on the liquid nutrient medium that carob bean gum is sole carbon source 45 ℃ cultivate 3d, mannase is lived as 4.6U/mL.
The clone of embodiment 2 Thielavia terrestris XZ7CGMCC6544 beta-mannase coding gene man5XZ7
Extract Thielavia terrestris XZ7CGMCC6544 genomic dna:
The liquid culture mycelium of 3 days is filtered and puts into mortar with aseptic filter paper, add 2mL extracting solution, grind 5min, lapping liquid is placed in to 50mL centrifuge tube, 65 ℃ of water-bath cracking 20min, mix once every 10min, the centrifugal 5min of 12000rpm at 4 ℃.Get supernatant extrct foreigh protein removing in phenol/chloroform, then get supernatant and add equal-volume Virahol, after the standing 5min of room temperature, the centrifugal 10min of 12000rpm at 4 ℃.Abandon supernatant, 70% washing with alcohol twice for precipitation, vacuum-drying, adds appropriate TE dissolving, be placed in-20 ℃ standby.
According to conservative (NNWSDYGG and AWELGNEP) sequences Design of Wu family mannase gene, degenerated primer P1, P2 have been synthesized
P1:5'-AAYAAYTGGGAYGAYTWYGGNGG-3'；
P2:5'-GGYTCRYYNSCNARYTCCCANGC-3'。
The total DNA of Thielavia terrestris XZ7CGMCC6544 of take carries out pcr amplification as template.PCR reaction parameter is: 94 ℃ of sex change 5min; Then 94 ℃ of sex change 30sec, 45 ℃ of (0.5 ℃ of each circulation landing) annealing 30sec of 50 ℃ of landing, 72 ℃ are extended 30s, and 10 circulations are then 94 ℃ of sex change 30s afterwards, 45 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations altogether, 72 ℃ of insulation 10min.Obtain an about 176bp fragment, the order-checking of Song Sanbo Bioisystech Co., Ltd is connected with pEASY-T3 carrier after this fragment is reclaimed.
The nucleotide sequence obtaining according to order-checking, each three TAIL-PCR Auele Specific Primers of design upstream and downstream: design direction is for needing the zone of ignorance direction of amplification, and the Position Design of sp2 is in the inner side of sp1, and sp3 is positioned at the inner side of sp2.Distance between every two primers does not have strict regulation, the general 22～30nt of primer length, and annealing temperature is at 60～65 ℃.And by they difference called after usp1, usp2, usp3 (upstream Auele Specific Primer), dsp1, dsp2, dsp3 (downstream Auele Specific Primer) is in Table 1.
Table 1. mannase Man5XZ7TAIL-PCR Auele Specific Primer
By reverse TAIL-PCR, obtain the flanking sequence of known sequence, amplification obtains product and reclaims the order-checking of Hou Songsanbo Bioisystech Co., Ltd.Man5XZ7 mannase gene total length 1247bp after splicing.Utilize RNA to extract total RNA of the thalline of test kit (SV Total RNA Isolation System, Promega) extracting liq inducing culture.By the cDNA of RT-PCR method amplification gene, it is 1110bp that the order-checking of Jing Sanbo Bioisystech Co., Ltd obtains its full-length cDNA, 369 amino acid of encoding.With SignalP (http://www.cbs.dtu.dk/services/SignalP), analyze the signal peptide that shows that 25 amino acid of N end are prediction.The theoretical molecular of predicting the maturation protein of this coded by said gene is 38.3kDa.
The preparation of embodiment 3 recombined xylanases
Expression vector pPIC9 is carried out to double digestion (EcoR I+Not I), simultaneously by the gene M an5XZ7 double digestion (EcoR I+Not I) of coding mannase, gene sheet (not containing the signal peptide sequence) section that cuts out encoding mature mannase is connected with expression vector pPIC9, the recombinant plasmid pPIC-man5XZ7 that acquisition contains mannase gene man5XZ7 is after Bgl II enzyme linearity and transform Pichia pastoris GS115, obtains recombinant pichia yeast strain GS115/man5XZ7.
Get the GS115 bacterial strain that contains recombinant plasmid, be inoculated in 300mL BMGY nutrient solution, after 30 ℃ of 250rpm shaking culture 48h, centrifugal collection thalline.Then resuspended in 100mL BMMY substratum, 30 ℃ of 250rpm shaking culture.After induction 72h, centrifugal collection supernatant.Measure the vigor of mannase.The expression amount of restructuring mannase is 15.8U/mL.SDS-PAGE result shows, restructuring mannase has obtained expression in pichia spp, and apparent molecular weight is 42.0kDa, and after EndoH processes, molecular weight becomes 38.0 left and right.The specific activity of restructuring mannosans is 705U/mg.
The gene M an5XZ7 sequence of the mannase that comprises signal peptide is connected with expression vector pPIC9, and other testing sequence is the same, and SDS-PAGE result shows, restructuring mannase has obtained expression in pichia spp.
The activation analysis of embodiment 4 restructuring mannases
DNS method: concrete grammar is as follows: at Ph5.0, under 50 ℃ of conditions, the reaction system of 1mL comprises the dilution enzyme liquid that 100 μ L are suitable, 900 μ L substrates, reaction 10min, adds 1.5mL DNS termination reaction, boiling water boiling 5min.Cooling rear 540nm measures OD value.1 Ge Meihuo unit (U) is defined as the enzyme amount that under given condition per minute discharges 1 μ mol reducing sugar.
The property testing of embodiment 5 restructuring mannase Man5XZ7
The restructuring mannase Man5XZ7 that embodiment 3 is obtained carries out following property testing
1, the optimal pH of restructuring mannase Man5XZ7 and the measuring method of pH stability are as follows:
The restructuring mannase of embodiment 3 purifying is carried out to enzymatic reaction to measure its optimal pH under different pH.Substrate carob bean gum is with carrying out Xylanase activity mensuration in 0.1mol/L citric acid-Sodium phosphate dibasic damping fluid of different pH 50 ℃.Result (Fig. 1) shows, the optimal pH of recombinase Man5XZ7 is 5.0, at pH9.0, has more than 25% relative activity.Mannase is 37 ℃ of processing 60min in the damping fluid of above-mentioned various different pH, then at 75 ℃, measure enzymic activity in pH5.0 buffer solution system, with the pH patience of studying enzyme.Result (Fig. 2) shows that mannase is all very stable between pH3.0-10.0, within the scope of this pH, process 60min after residual enzyme activity more than 80%, this illustrates that this enzyme has satisfactory stability within the scope of very wide in range pH.
2, the optimum temperuture of mannase and thermal stability determination method are as follows:
Enzymatic reaction is carried out in being determined as under citric acid-Sodium phosphate dibasic damping fluid (pH5.0) buffer solution system and differing temps of the optimum temperuture of mannase.Temperature tolerance is determined as mannase and processes different time under differing temps, then carries out enzyme assay at 75 ℃.Enzyme reaction optimum temperuture measurement result (Fig. 3) shows that its optimum temperuture is 75 ℃, and lives at 85 ℃ of enzymes still with 60% left and right.The thermostability test of enzyme shows (Fig. 4), and Man5XZ7 has good thermostability, and incubation 1h at 50 ℃ can keep original enzymic activity.
3, the K of mannase
mvalues determination method is as follows:
The carob bean gum of different concns of take is respectively substrate, in citric acid-Sodium phosphate dibasic damping fluid (pH5.0) buffer solution system, measures enzymic activity at 75 ℃, calculates its K at 75 ℃
mvalue.After measured, take the K of carob bean gum during as substrate
mvalue is respectively 6.6mg/mL, maximum reaction velocity V
maxbe 886 μ mol/minmg.
4, the impact that different metal ion chemistry reagent is lived on Man5XZ7 enzyme is determined as follows:
The different metal ions and the chemical reagent that in enzymatic reaction system, add different concns, study its impact on enzymic activity, and various material final concentrations are 1 and 5mmol/L.Under 75 ℃, pH5.0 condition, measure enzymic activity.Result shows, the active not impact of most ions enzymes, and beta-mercaptoethanol can improve its enzyme activity of 1.35 times.Ag
+, its activity of SDS (6.3%) strongly inhibited.Work as Cu
2+can partly suppress Man5XZ7 enzyme activity, and contrary beta-mercaptoethanol can improve its enzyme activity of 1.4 times.
5, mannase antitrypsin ability is determined as follows:
With pH7.0Tris-HCl damping fluid preparation 0.1mg/mL trypsinase.The enzyme liquid of getting the 0.5mL purifying after the dilution of pH7.0Tris-HCl damping fluid adds 0.5mL trypsinase to mix, and 0.1,37 ℃ of insulation 60min of proteolytic enzyme/mannase (w/w) ≈ sampling is measured enzymic activity under pH5.0 and 75 ℃ of conditions.Experimental result shows that mannase Man5XZ7 is with after trypsin treatment 60min, and the enzyme of the Man5XZ7 after trypsin treatment is lived and do not changed.
6, the substrate specificity of restructuring mannase
This enzyme is except acting on carob bean gum, and for guar gum, Rhizoma amorphophalli powder also has certain Degradation (table 2).
Table 2. mannase Man5XZ7 substrate specificity is analyzed
Claims (9)
1. a high temperature alkali resistant mannase Man5XZ7, is characterized in that, its aminoacid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.
2. a high temperature alkali resistant mannase gene man5XZ7, is characterized in that, high temperature alkali resistant mannase Man5XZ7 claimed in claim 1 encodes.
3. high temperature alkali resistant mannase gene man5XZ7 as claimed in claim 2, is characterized in that, its base sequence is as shown in SEQ ID NO.4 or SEQ ID NO.5.
4. the recombinant vectors that comprises high temperature alkali resistant mannase gene man5XZ7 described in claim 2.
5. the recombinant vectors pPIC-Man5XZ7 that comprises high temperature alkali resistant mannase gene man5XZ7 described in claim 2, it is characterized in that, mannase gene by base sequence as shown in SEQ ID NO.5 is inserted between the EcoR I and Not I restriction enzyme site on plasmid pPIC9, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulated and controled by it, obtain recombinant yeast expression vector pPIC-Man5XZ7.
6. the recombinant bacterial strain that comprises high temperature alkali resistant mannase gene man5XZ7 described in claim 2.
7. a method of preparing high temperature alkali resistant mannase Man5XZ7, is characterized in that, comprises the following steps:
1) with the recombinant vectors transformed host cell of claim 4, obtain recombinant bacterial strain;
2) cultivate recombinant bacterial strain, induction restructuring mannosans expression of enzymes;
3) reclaim the also expressed mannase Man5XZ7 of purifying.
Described in claim 1 high temperature alkali resistant mannase Man5XZ7 for being hydrolyzed the application of mannosans.
9. Thielavia terrestris XZ7 (Thielavia terrestris), is characterized in that, deposit number is CGMCC6544.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310062872.6A CN103275954B (en) | 2012-11-08 | 2013-02-28 | High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210442431 | 2012-11-08 | ||
| CN201210442431.4 | 2012-11-08 | ||
| CN201310062872.6A CN103275954B (en) | 2012-11-08 | 2013-02-28 | High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103275954A CN103275954A (en) | 2013-09-04 |
| CN103275954B true CN103275954B (en) | 2014-07-30 |
Family
ID=49058575
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310062872.6A Active CN103275954B (en) | 2012-11-08 | 2013-02-28 | High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103275954B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525792B (en) * | 2013-10-29 | 2016-01-20 | 中国农业科学院饲料研究所 | A kind of high temperature high specific activity acidic beta-mannase and gene thereof and application |
| CN103642774B (en) * | 2013-11-13 | 2016-08-17 | 宁夏夏盛实业集团有限公司 | Mixing neutral cellulase and preparation method thereof and the application in papermaking is pulled an oar |
| CN104004725B (en) * | 2014-06-11 | 2016-05-11 | 中国农业科学院饲料研究所 | The neutral tannase TanXZ7 of low temperature and gene and application in one |
| CN105567541B (en) * | 2016-01-26 | 2018-04-17 | 湖北工业大学 | A kind of Oligomeric manna sugar yam vinegar and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1904052A (en) * | 2005-07-26 | 2007-01-31 | 中国农业科学院饲料研究所 | Beta mannosidase, its coding gene and application |
| CN102181416A (en) * | 2011-03-11 | 2011-09-14 | 中国农业科学院饲料研究所 | Alkali-resisting beta-mannase Man5A as well as gene and applications thereof |
-
2013
- 2013-02-28 CN CN201310062872.6A patent/CN103275954B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1904052A (en) * | 2005-07-26 | 2007-01-31 | 中国农业科学院饲料研究所 | Beta mannosidase, its coding gene and application |
| CN102181416A (en) * | 2011-03-11 | 2011-09-14 | 中国农业科学院饲料研究所 | Alkali-resisting beta-mannase Man5A as well as gene and applications thereof |
Non-Patent Citations (4)
| Title |
|---|
| A family 5 β-mannanase from the thermophilic fungus Thielavia arenaria XZ7 with typical thermophilic enzyme features;Haiqiang Lu 等;《Appl Microbiol Biotechnol》;20130109;第97卷;8121–8128 * |
| Haiqiang Lu 等.A family 5 β-mannanase from the thermophilic fungus Thielavia arenaria XZ7 with typical thermophilic enzyme features.《Appl Microbiol Biotechnol》.2013,第97卷8121–8128. |
| 张敏 等.重组海栖热袍菌极耐热甘露聚糖酶的纯化和性质研究.《微生物学通报》.2008,第35卷(第10期),1565-1571. |
| 重组海栖热袍菌极耐热甘露聚糖酶的纯化和性质研究;张敏 等;《微生物学通报》;20081231;第35卷(第10期);1565-1571 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103275954A (en) | 2013-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101457207B (en) | Eosinophil beta-mannanase MAN5A and gene and application thereof | |
| CN103275954B (en) | High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof | |
| CN105018448A (en) | Heat-resisting acidic cellulase of fungus source and gene and application thereof | |
| CN102533698B (en) | High temperature acidic mannase Man5C1, and gene and application thereof | |
| CN101748108B (en) | Acidophil Beta-glucanase GLU7A and gene and application thereof | |
| CN102392007B (en) | High temperature alkaline xylanase XYN10A, gene thereof and application thereof | |
| CN103343112B (en) | High-temperature alkaline xylanase XYN11A as well as gene and application thereof | |
| CN104673713A (en) | Basophilic streptomyce, neutral endoglucanase produced by basophilic streptomyce and application of basophilic streptomyce | |
| CN102978187B (en) | High-activity beta-mannanase MAN5A with pH value within range of 2.5-6.5, and gene and application thereof | |
| CN102329785B (en) | Medium-temperature alkali-resistant mannase Man5XH9 and gene and application thereof | |
| CN104388408B (en) | Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3 | |
| CN103320415B (en) | Heatproof neutral cellulase Cel 61 and its gene and application | |
| CN104560833B (en) | A kind of basophilic micrococcus luteus and its alkalescent xylanase and the application of generation | |
| CN103695397B (en) | Mesophilic acidic xylanase XYN10L1 and gene and application thereof | |
| CN102358898B (en) | Medium-temperature beta-glucosidase BglA1, gene of same and application of same | |
| CN101838636A (en) | High-specific-activity xylanase XYN11F63 and genes and application thereof | |
| CN101892208B (en) | High-temperature acidic xylanase XYN10J88, gene and application thereof | |
| CN102399768B (en) | Low temperature xylanase BA-XYL11a as well as gene and application | |
| CN102154244B (en) | High-temperature acid cellulase EgG5 and gene and application thereof | |
| Moubasher et al. | Production and purification of extreme xylanase from Aspergillus flavus AUMC 10331 in sub-merged fermentation | |
| CN103074317B (en) | High temperature neutral xylanase XYNA used for brewing beer and gene and application thereof | |
| Parambath et al. | Purification and characterization of carboxymethyl cellulase (CMCase) from P enicillium ochrochloron isolated from forest soil of Neyyar Wild Life Sanctuary, India | |
| CN102586206B (en) | High temperature acidic xylanase XYN10C1 as well as gene and application thereof | |
| CN102154246A (en) | Acid glucanase CEL7G5 and gene and application thereof | |
| CN103232985B (en) | Xylanase XYN10B with high catalytic efficiency, as well as gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200831 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100086 No. 12 South Main Street, Haidian District, Beijing, Zhongguancun Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |