CN103834628A - Acid beta-mannase as well as gene and application of acid beta-mannase - Google Patents
Acid beta-mannase as well as gene and application of acid beta-mannase Download PDFInfo
- Publication number
- CN103834628A CN103834628A CN201410088929.4A CN201410088929A CN103834628A CN 103834628 A CN103834628 A CN 103834628A CN 201410088929 A CN201410088929 A CN 201410088929A CN 103834628 A CN103834628 A CN 103834628A
- Authority
- CN
- China
- Prior art keywords
- mannase
- beta
- enzyme
- man5db
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/2488—Mannanases
- C12N9/2494—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01078—Mannan endo-1,4-beta-mannosidase (3.2.1.78), i.e. endo-beta-mannanase
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to the field of genetic engineering, and in particular relates to acid beta-mannase Man5DB as well as a gene and an application of the acid beta-mannase, wherein an amino acid sequence of the acid beta-mannase is represented as either SEQ ID NO. 1 or SEQ ID NO. 2. The enzyme has the following natures: optimum pH is 5.0, and the enzyme can keep enzyme activity at above 60% within a pH range of 3.5-6.0; optimum reaction temperature is 65 DEG C, and the enzyme can keep enzyme activity at above 50% at 45-70 DEG C; after being processed for 60min at 37 DEG C, the enzyme can keep enzyme activity at above 80% within a pH range of 4.0-9.0, thus showing that the enzyme is excellent in pH stability; and after being processed for 60min at 50 DEG C, the enzyme activity is free from loss and can be still kept at above 20% after being processed for 5min at 65 DEG C. In addition, specific activity is 795Umg<-1>. The acid beta-mannase is excellent in heat resistance, and is applicable to such industries as feed, food and medicine. According to the technical scheme disclosed by the invention, mannase that is excellent in nature and applicable to industrial application can be produced through genetic engineering means.
Description
Technical field
The present invention relates to genetically engineered field, particularly, the present invention relates to a kind of produce acid 'beta '-mannase and gene and application.
Background technology
The materials such as plant cell wall three major polymers: cellulose, hemicellulose and xylogen form.Mannosans is the important component of plant hemicellulose, is the wire polymer being formed by connecting by β-Isosorbide-5-Nitrae-D-MANNOSE, mainly contains the substituted radicals such as glucosyl group, ethanoyl and galactosyl on the side chain of polysaccharide.'beta '-mannase (β-mannanase EC3.2.1.78) is a kind of inscribe lytic enzyme that is hydrolyzed mannosans, and with internal-cutting way degraded mannose backbone β-l, 4 glycosidic links, discharge short β-l, 4 mannooligo saccharides.
In recent years, along with the discovery of mannooligo saccharide physiological function, the enhancing of the rise of green feed and people's environmental consciousness, the regeneration research of the energy, research and the utilization of people to β-Gan entered a dew glycanase new stage.'beta '-mannase has been widely used in the numerous areas such as food, medicine, feed, papermaking, textile printing and dyeing, oil production, fine chemistry industry and biotechnology, is a kind of novel industrial enzyme, has very large potential using value.
'beta '-mannase is extensively present in the biologies such as bacterium, actinomycetes, fungi, plant, animal.The mannase of bacterial origin is mainly the mannase of sour partial neutral.Its molecular weight is many between 35kDa～55kDa, and optimal reaction operative temperature is 50 ℃～70 ℃.At present most study is genus bacillus, and except more than the suitableeest action pH of Bacillus alcalophilus reaches pH9.0, optimal reaction pH is between 5.5～8.0 mostly.It is acid that the 'beta '-mannase of fungi is generally, and molecular weight is greatly about 45kDa～55kDa, and the suitableeest action pH is 4.0～6.0, and optimum temperature is 55 ℃～75 ℃.Relatively bacterium, the 'beta '-mannase optimal reaction pH value of originated from fungus, pH stability is all on the low side, and thermotolerance is poorer than bacterium.At present both at home and abroad, separating and property testing although many 'beta '-mannases are cloned,, all there are some defects in the nature and characteristic of these enzymes, and for example, pH sphere of action is improper, poor heat stability, and expression amount is low etc., all can not meet the needs of practical application.Therefore people wish to find a kind of new 'beta '-mannase that can meet practical application request, apply in the industries such as feed, food, medicine thereby can further promote this 'beta '-mannase.
The present invention has obtained a new beta-mannase gene from Staphylotrichum coccosporum NBRC31817 bacterial strain, and the mannase of its coding has following advantage: acid, good thermostability, easy fermentative production.These advantages all mean that neoteric 'beta '-mannase, in the industries such as feed, food, medicine, will more have using value than former reported 'beta '-mannase.
Summary of the invention
The object of this invention is to provide the 'beta '-mannase of a kind of acidity, good thermostability.
A further object of the present invention is to provide the gene of above-mentioned 'beta '-mannase.
A further object of the present invention is to provide the recombinant vectors that comprises above-mentioned 'beta '-mannase.
A further object of the present invention is to provide the recombinant bacterial strain that comprises above-mentioned beta-mannase gene.
A further object of the present invention is to provide a kind of method of preparing 'beta '-mannase.
A further object of the present invention is to provide the application of above-mentioned 'beta '-mannase.
The present invention's technical problem first to be solved is to overcome the deficiencies in the prior art, provide a kind of character good, be suitable for the new 'beta '-mannase applied in the industries such as feed, food, medicine.This 'beta '-mannase Man5DB, its aminoacid sequence is as SEQ ID NO.1:
1MKSVTSLLLL?AGAAAGQQAA?YGQCGGIGYS?GPSSCVSGYA?CTSYNPYYYQ
51CVPGTATSAP?ATTSKTSSSV?KTTSTSSSVK?TTSTSTVKTS?TSSTKTTSST
101TAGPTATGFA?KTNGLMFEID?GVTKYFAGTN?CYWCGFLTAN?ADVDHVFADM
151AAAGFKVVRV?WGFNDVNSIP?GSGTVWYQYL?SASGSQINTG?ANGLQRMDYV
201VSSAAAHGLK?LIINFVNNWN?DYGGINAYVN?AFGGSASTWY?TNTAAQAQYQ
251KYIEAVVSRY?KTSTAVFAWE?LANEPRCSGC?DASVIYNWAA?KTSQYIKSLD
301SNHMVTIGDE?GFGPLTGGDG?SYPYQAGAGG?YTWVDNLNIS?TLDFGTLHLY
351PDSWGQPYSW?GDLWVSTHAS?ACVKANKPCI?LEEYGGTNNC?TIENPWQKTA
401LSSKGIAGDM?FWQYGDTLPS?CNCQTSQDGN?TVFYNQGNWD?CMVTQHVAAI
451NSS*
Wherein, 454 amino acid of this enzyme total length, 16 amino acid of N end are signal peptide sequence " MKSVTSLLLLAGAAAG ".
Therefore, the theoretical molecular of ripe 'beta '-mannase Man5D is 47kDa, and its aminoacid sequence is as SEQID NO.2:
1QQAAYGQCGG?IGYSGPSSCV?SGYACTSYNP?YYYQCVPGTA?TSAPATTSKT
51SSSVKTTSTS?SSVKTTSTST?VKTSTSSTKT?TSSTTAGPTA?TGFAKTNGLM
101FEIDGVTKYF?AGTNCYWCGF?LTANADVDHV?FADMAAAGFK?VVRVWGFNDV
151NSIPGSGTVW?YQYLSASGSQ?INTGANGLQR?MDYVVSSAAA?HGLKLIINFV
201NNWNDYGGIN?AYVNAFGGSA?STWYTNTAAQ?AQYQKYIEAV?VSRYKTSTAV
251FAWELANEPR?CSGCDASVIY?NWAAKTSQYI?KSLDSNHMVT?IGDEGFGPLT
301GGDGSYPYQA?GAGGYTWVDN?LNISTLDFGT?LHLYPDSWGQ?PYSWGDLWVS
351THASACVKAN?KPCILEEYGG?TNNCTIENPW?QKTALSSKGI?AGDMFWQYGD
401TLPSCNCQTS?QDGNTVFYNQ?GNWDCMVTQH?VAAINSS*
This 'beta '-mannase Man5DB has acid feature.Optimal pH is 5.0, and within the scope of pH3.5-pH6.0, this enzyme can maintain its more than 60% enzyme activity; 65 ℃ of optimum temperutures.At 50 ℃, process 60min, residual enzyme is lived and is not lost, even if this enzyme is processed 60min at 60 ℃, still can keep 50% enzyme activity, has good stability; High density fermentation enzymic activity is high simultaneously, is easy to suitability for industrialized production.
The present invention also provides the gene of the above-mentioned 'beta '-mannase of encoding.The complete genome sequence of this enzyme is as shown in SEQ IDNO.3:
1ATGAAGTCTGTCACCTCCCTCCTCCTCCTGGCTGGCGCCGCCGCCGGCCAGCAAGCGGCC
61TACGGACAGTGCGGCGGCATCGGCTACTCCGGCCCTTCCAGCTGCGTGTCGGGGTACGCG
121TGTACCTCGTACAACCCGTACTACTACCAGTGCGTTCCGGGGACGGCCACTTCTGCCCCG
181GCCACGACGTCAAAGACTTCGTCGAGCGTGAAGACCACCTCGACGTCTTCCTCCGTGAAG
241ACCACCTCGACGTCGACTGTCAAGACGAGCACTTCGTCGACGAAGACCACCTCGTCCACC
301ACTGCCGGGCCGACGGCCACAGGCTTTGCGAAGACGAATGGTCTGATGTTTGAGATTGAC
361GGCGTCACCAAGTACTTTGCGGGCACCAACTGCTACTGTTTGTCACCTCTTTCACCTCCG
421GATGGCCCCGACACCATGACTGACCGTTGACCAGGGTGCGGCTTCCTGACCGCCAACGCC
481GATGTCGACCACGTCTTCGCCGACATGGCCGCCGCCGGCTTCAAGGTTGTCCGCGTGTGG
541GGCTTCAACGACGTCAACAGCATCCCCGGGTCCGGAACCGTCTGGTACCAGTACCTGTCC
601GCCAGCGGCTCGCAGATCAACACGGGCGCGAACGGCCTGCAGAGGATGGACTACGTCGTC
661TCGTCGGCGGCGGCCCACGGGCTGAAGCTGATCATCAACTTCGTCAACAACTGGAATGAT
721TATGGTGGAATCAACGCCTATGTGAACGCCTTTGGCGGATCAGCGTCGACGTGGTACACC
781AACACGGCCGCGCAGGCGCAGTACCAGAAATACATTGAGGCTGTCGTGAGCAGGTACAAG
841ACTTCGACGGCTGTGTTTGCCTGGGAGCTGGCGAACGAGCCGAGATGCAGCGGTTGCGAT
901GCGTAAGTCTGACGATCTACCCAAGTCGAACCCTTTAACGTTTCCAACACACTCCAGCTC
961CGTCATCTACAACTGGGCGGCCAAGACCTCCCAGTACATCAAGTCCCTCGACTCCAATCA
1021CATGGTCACCATCGGCGACGAAGGCTTCGGCCCCCTGACCGGCGGCGACGGCAGCTACCC
1081CTACCAGGCGGGCGCCGGTGGCTACACCTGGGTGGACAACCTGAATATCTCGACGCTGGA
1141CTTTGGCACGCTGCACCTGTATCCCGACAGCTGTGAGTATCAAGTACGCTCTATCAGGCA
1201GAGAGCGTCTCACTAACAGACTGTCAGGGGGCCAACCCTACAGCTGGGGCGACCTCTGGG
1261TCTCGACTCACGCCTCCGCGTGCGTCAAGGCCAACAAGCCGTGCATCCTGGAGGAGTGTA
1321AGTCCCGCCCCATCCCCTCCCCAGTCCCTAGACGTCCGGACAGTATCACTAACACCGAGA
1381ACAGACGGCGGTACAAACAACTGCACCATCGAGAACCCCTGGCAAAAGACGGCCCTCTCT
1441TCCAAGGGCATCGCCGGCGACATGTTCTGGCAGTACGGCGACACCCTCCCCAGCTGCAAC
1501TGCCAGACCTCGCAGGACGGGAACACCGTGTTTTACAACCAAGGCAACTGGGACTGCATG
1561GTCACGCAGCATGTGGCGGCTATCAACTCTTCGTGA
The method separating clone of the present invention by PCR this beta-mannase gene man5DB, DNA complete sequence analysis result shows, 'beta '-mannase Man5DB structure gene total length 1596bp, contains 4 introns ,+399～455bp, + 903～957bp, + 1174～1228bp ,+1318～1384bp, is its intron sequences, the long 1362bp of cDNA, its cDNA sequence is as shown in SEQ ID NO.4:
1ATGAAGTCTGTCACCTCCCTCCTCCTCCTGGCTGGCGCCGCCGCCGGCCAGCAAGCGGCC
61TACGGACAGTGCGGCGGCATCGGCTACTCCGGCCCTTCCAGCTGCGTGTCGGGGTACGCG
121TGTACCTCGTACAACCCGTACTACTACCAGTGCGTTCCGGGGACGGCCACTTCTGCCCCG
181GCCACGACGTCAAAGACTTCGTCGAGCGTGAAGACCACCTCGACGTCTTCCTCCGTGAAG
241ACCACCTCGACGTCGACTGTCAAGACGAGCACTTCGTCGACGAAGACCACCTCGTCCACC
301ACTGCCGGGCCGACGGCCACAGGCTTTGCGAAGACGAATGGTCTGATGTTTGAGATTGAC
361GGCGTCACCAAGTACTTTGCGGGCACCAACTGCTACTGGTGCGGCTTCCTGACCGCCAAC
421GCCGATGTCGACCACGTCTTCGCCGACATGGCCGCCGCCGGCTTCAAGGTTGTCCGCGTG
481TGGGGCTTCAACGACGTCAACAGCATCCCCGGGTCCGGAACCGTCTGGTACCAGTACCTG
541TCCGCCAGCGGCTCGCAGATCAACACGGGCGCGAACGGCCTGCAGAGGATGGACTACGTC
601GTCTCGTCGGCGGCGGCCCACGGGCTGAAGCTGATCATCAACTTCGTCAACAACTGGAAT
661GATTATGGTGGAATCAACGCCTATGTGAACGCCTTTGGCGGATCAGCGTCGACGTGGTAC
721ACCAACACGGCCGCGCAGGCGCAGTACCAGAAATACATTGAGGCTGTCGTGAGCAGGTAC
781AAGACTTCGACGGCTGTGTTTGCCTGGGAGCTGGCGAACGAGCCGAGATGCAGCGGTTGC
841GATGCCTCCGTCATCTACAACTGGGCGGCCAAGACCTCCCAGTACATCAAGTCCCTCGAC
901TCCAATCACATGGTCACCATCGGCGACGAAGGCTTCGGCCCCCTGACCGGCGGCGACGGC
961AGCTACCCCTACCAGGCGGGCGCCGGTGGCTACACCTGGGTGGACAACCTGAATATCTCG
1021ACGCTGGACTTTGGCACGCTGCACCTGTATCCCGACAGCTGGGGCCAACCCTACAGCTGG
1081GGCGACCTCTGGGTCTCGACTCACGCCTCCGCGTGCGTCAAGGCCAACAAGCCGTGCATC
1141CTGGAGGAGTACGGCGGTACAAACAACTGCACCATCGAGAACCCCTGGCAAAAGACGGCC
1201CTCTCTTCCAAGGGCATCGCCGGCGACATGTTCTGGCAGTACGGCGACACCCTCCCCAGC
1261TGCAACTGCCAGACCTCGCAGGACGGGAACACCGTGTTTTACAACCAAGGCAACTGGGAC
1321TGCATGGTCACGCAGCATGTGGCGGCTATCAACTCTTCGTGA
Wherein, the base sequence of signal peptide is:
“ATGAAGTCTGTCACCTCCCTCCTCCTCCTGGCTGGCGCCGCCGCCGGC”
Therefore, the encoding sequence of ripe gene is
Shown in SEQ ID NO.5:
1CAGCAAGCGGCCTACGGACAGTGCGGCGGCATCGGCTACTCCGGCCCTTCCAGCTGCGTG
61TCGGGGTACGCGTGTACCTCGTACAACCCGTACTACTACCAGTGCGTTCCGGGGACGGCC
121ACTTCTGCCCCGGCCACGACGTCAAAGACTTCGTCGAGCGTGAAGACCACCTCGACGTCT
181TCCTCCGTGAAGACCACCTCGACGTCGACTGTCAAGACGAGCACTTCGTCGACGAAGACC
241ACCTCGTCCACCACTGCCGGGCCGACGGCCACAGGCTTTGCGAAGACGAATGGTCTGATG
301TTTGAGATTGACGGCGTCACCAAGTACTTTGCGGGCACCAACTGCTACTGGTGCGGCTTC
361CTGACCGCCAACGCCGATGTCGACCACGTCTTCGCCGACATGGCCGCCGCCGGCTTCAAG
421GTTGTCCGCGTGTGGGGCTTCAACGACGTCAACAGCATCCCCGGGTCCGGAACCGTCTGG
481TACCAGTACCTGTCCGCCAGCGGCTCGCAGATCAACACGGGCGCGAACGGCCTGCAGAGG
541ATGGACTACGTCGTCTCGTCGGCGGCGGCCCACGGGCTGAAGCTGATCATCAACTTCGTC
601AACAACTGGAATGATTATGGTGGAATCAACGCCTATGTGAACGCCTTTGGCGGATCAGCG
661TCGACGTGGTACACCAACACGGCCGCGCAGGCGCAGTACCAGAAATACATTGAGGCTGTC
721GTGAGCAGGTACAAGACTTCGACGGCTGTGTTTGCCTGGGAGCTGGCGAACGAGCCGAGA
781TGCAGCGGTTGCGATGCCTCCGTCATCTACAACTGGGCGGCCAAGACCTCCCAGTACATC
841AAGTCCCTCGACTCCAATCACATGGTCACCATCGGCGACGAAGGCTTCGGCCCCCTGACC
901GGCGGCGACGGCAGCTACCCCTACCAGGCGGGCGCCGGTGGCTACACCTGGGTGGACAAC
961CTGAATATCTCGACGCTGGACTTTGGCACGCTGCACCTGTATCCCGACAGCTGGGGCCAA
1021CCCTACAGCTGGGGCGACCTCTGGGTCTCGACTCACGCCTCCGCGTGCGTCAAGGCCAAC
1081AAGCCGTGCATCCTGGAGGAGTACGGCGGTACAAACAACTGCACCATCGAGAACCCCTGG
1141CAAAAGACGGCCCTCTCTTCCAAGGGCATCGCCGGCGACATGTTCTGGCAGTACGGCGAC
1201ACCCTCCCCAGCTGCAACTGCCAGACCTCGCAGGACGGGAACACCGTGTTTTACAACCAA
1261GGCAACTGGGACTGCATGGTCACGCAGCATGTGGCGGCTATCAACTCTTCGTGA
Maturation protein theoretical molecular is 47kDa, and this enzyme belongs to glycoside hydrolase the 5th family.The c DNA sequence dna of beta-mannase gene man5DB and the aminoacid sequence derived are carried out to BLAST comparison in Gen Bank and find, determine that Man5DB is a kind of new mannase.
The present invention also provides the recombinant vectors that comprises above-mentioned beta-mannase gene, is preferably pPIC9-man5DB.Beta-mannase gene of the present invention is inserted between the restriction enzyme site that expression vector is suitable, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, be preferably beta-mannase gene plasmid is inserted between the EcoR I and Not I restriction enzyme site on pPIC9, make this nucleotide sequence be positioned at the downstream of AOXl promotor and regulated and controled by it, obtain expression of recombinant yeast plasmid pPIC9-man5DB.
The present invention also provides the recombinant bacterial strain that comprises above-mentioned beta-mannase gene, is preferably recombinant bacterial strain GS115/man5DB.
The present invention also provides a kind of method of having a liking for sour 'beta '-mannase of preparing, and comprises the following steps:
1) with above-mentioned recombinant vectors transformed host cell, obtain recombinant bacterial strain;
2) cultivate recombinant bacterial strain, the expression of induction restructuring 'beta '-mannase;
3) reclaim the also expressed 'beta '-mannase of purifying.
Wherein, preferred described host cell is pichia yeast (Pichia pastoris) cell, cereuisiae fermentum (Saccharomyces cerevisiae) cell or Hansenula polymorpha (Hansenula polymorpha) cell, preferably expression of recombinant yeast plasmid is transformed to Pichia pastoris (Pichic pastoris) GS115, obtain recombinant bacterial strain GS115/man5DB.
The invention provides a new mannase gene, the mannase of its coding has acidity, good thermotolerance and protease inhibitor ability, can be applied to the industry such as feed, food, medicine.Just can realize according to technical scheme of the present invention the mannase that utilizes the good applicable industrial application of genetic engineering means nature of production.
Accompanying drawing explanation
The SDS-PAGE of the 'beta '-mannase that Fig. 1 man5DB expresses in pichia spp analyzes, l, the mannase supernatant of expression; 2, the restructuring 'beta '-mannase of purifying; 3, desugar base purification of Recombinant 'beta '-mannase after treatment.
The recombinate optimum pH of 'beta '-mannase of Fig. 2 the present invention.
The pH stability of Fig. 3 'beta '-mannase of the present invention.
Fig. 4 'beta '-mannase optimal reactive temperature of the present invention.
Fig. 5 beta-mannase enzyme heat stability of the present invention.
Embodiment
Test materials and reagent
1, bacterial strain and carrier: pichia spp (Pichia pastoris GS115) is for preserving in this laboratory; Yeast expression vector pPIC9 and bacterial strain GS115 are purchased from Invitrogen company.
2, enzyme and other biochemical reagents: restriction endonuclease is purchased from TaKaRa company, and ligase enzyme is purchased from Invitrogen company.Oat xylan is purchased from Sigma company, and other is all domestic reagent (all can buy and obtain from common biochemical reagents company).
3, substratum:
(I) culture medium: 30g/L wheat bran, 30g/L corn cob meal, 30g/L dregs of beans, 5g/L Rhizoma amorphophalli powder, 5g/L (NH
4) SO
4, 1g/L KH
2pO
4, 0.5g/L MgSO
47H
2o, 0.01g/L FeSO
47H
2o, 0.2g/LCaCl
2in 1L deionized water, 121 ℃, sterilising treatment 20min under 15 pounds of conditions
(2) Escherichia coli culture medium LB (126 peptones, 0.5% yeast extract, 126NaCI, pH7.O).
(3) BMGY substratum; 1% yeast extract, 2% peptone, 1.34%YNB, 0.000049<Biotin, 1% glycerine (v/v).
(4) BMMY substratum: replace glycerine divided by 0.5% methyl alcohol, all the other compositions are all identical with BMGY, pH4.0.
Illustrate: the experimental methods of molecular biology that in following examples, work illustrates, all carries out with reference to listed concrete grammar in " molecular cloning experiment guide " (third edition) J. Pehanorm Brooker one book, or carries out according to test kit and product description.
The clone of embodiment 1 beta-mannase coding gene man5D
Extract Staphylotrichum coccosporum genomic dna
The mould Staphylotrichum coccosporum of large spore circle spore NBRC31817 is purchased from authoritative culture presevation administrative center of Japan NBRC(NITE biological resource center).
Culture medium is cultivated to the bacterium of 3 days, the centrifugal 10min of 12,000rpm, the mycelium of collection adds in the mortar of high-temperature sterilization, be ground to rapidly powder with liquid nitrogen, then ground thalline is transferred to one new, be equipped with in 15ml CTAB lysate 50mL centrifuge tube, soft turned upside down mixes, be placed in 70 ℃ of water-bath insulation 3h, every 20min, turned upside down softly mixes once, so that abundant cracking thalline.4 ℃, 12, the centrifugal 10min of 000rpm, draws supernatant to new centrifuge tube, adds isopyknic chloroform extracting, and room temperature is placed 5min.4 ℃, 12, the centrifugal 10min of 000rpm.Get supernatant and add the extracting of isopyknic phenol/chloroform again, room temperature is placed 5min.4 ℃, 12, the centrifugal 10min of 000rpm.So that as far as possible except foreigh protein removing, then get supernatant and add equal-volume Virahol, leave standstill after 5min in room temperature, the centrifugal l0min of l0000rpm at 4 ℃.Abandon supernatant, 70% washing with alcohol twice for precipitation, vacuum-drying, adds appropriate TE dissolving, be placed in-20 ℃ for subsequent use.
Synthesized degenerate primer P1 according to the beta-mannase gene conserved sequence design of having delivered, P2(is in table 1).Carry out pcr amplification take Staphylotrichum coccosporum genomic dna as template.PCR reaction parameter is: 95 ℃ of 5min; 94 ℃ of 30sec, 50～45 ℃ of 30sec, 72 ℃ of 30sec, 12 circulations (wherein after each circulation, renaturation temperature declines 1 ℃); 94 ℃ of 30min, 45 ℃ of 30sec, 72 ℃ of 30sec, 30 circulations; 72 ℃ of 10min.Obtain an about 180bp fragment, this fragment is reclaimed to the order-checking of Hou Songsanbo Bioisystech Co., Ltd.
The nucleotide sequence design TAIL-PCR primer uspl obtaining according to order-checking, usp2, usp3; Dspl, dsp2, dsp3(is in table 1).Obtain the flanking sequence of known sequence by TAIL-PCR, amplification obtains product and reclaims the order-checking of Hou Songsanbo Bioisystech Co., Ltd.After the sheet cracked ends splicing of checking order correct, obtain full-length gene.
The primer that this experiment of table 1 is required
The acquisition of embodiment 2 'beta '-mannase cDNA
Extract the total RNA of Staphylotrichum coccosporum, utilize Oligo (dT)
20obtain a chain of cDNA with ThermoScript II, then design amplification open reading frame primers F and R(in table 1), this strand cDNA that increases, obtains the cDNA sequence of mannase, amplification obtains product and reclaims the order-checking of Hou Songsanbo Bioisystech Co., Ltd.
Contain 4 introns by finding after the genome sequence to mannase and cDNA sequence alignment that this gene has, the long 1362bp of cDNA, encode 453 amino acid and a terminator codon, it is its signal peptide sequence that N holds 16 amino acid, proves that the gene of the coding mannase that separating clone obtains from Staphylotrichum coccosporum is new gene through comparison.
The structure of embodiment 3 'beta '-mannase engineering strains
(1) structure of expression vector and the expression at yeast
Take the cDNA that checks order mannase Man5DB correct as template, design has been synthesized with the expression primers F of EcoR I and Not I restriction enzyme site and R(in table 1), increase in the coding region of the maturation protein to Man5DB.And utilize EcoR I and Not I enzyme to cut PCR product, connect and enter expression vector pPIC9 (Invitrogen, San Diego), the sequence of 'beta '-mannase Man5DB maturation protein is inserted into the downstream of the signal peptide sequence of above-mentioned expression vector, form correct reading frame with signal peptide, be built into Yeast expression carrier pPIC9-man5DB, transform competent escherichia coli cell JM109.Positive transformant carries out DNA sequencing, and order-checking shows that transformant that sequence is correct is for preparing in a large number recombinant plasmid.Carry out linearizing expression plasmid carrier DNA with restriction enzyme Bgl II, electric shock transformed yeast GS115 competent cell, coat the RDB flat board of histidine defect, cultivate 2-3 days for 30 ℃, the transformant that picking is grown on RDB flat board carries out further expressing experiment, and concrete operations please refer to Pichia anomala expression operational manual.
Build in the same way the expression vector containing the cDNA of Man5DB signal peptide sequence, and transform.
(2) screening of high mannosans enzymic activity transformant
With sterilized toothpick picking list bacterium colony from the long RDB plate that has transformant, first put MM according to numbering upper, then put on the MD flat board of corresponding numbering, on each flat board, put 100 single bacterium colonies, amount to 200 transformants; There are MM, the MD flat board of transformant to be placed in 30 ℃ of incubators point and cultivate 1～2 day, grow to bacterium colony.From MD flat board, picking transformant is inoculated in the centrifuge tube that 3mL BMGY substratum is housed by number, 30 ℃, 220rpm shaking table cultivation 48h; The centrifugal 15min of bacterium liquid 3,000 × g that shaking table is cultivated to 48h, removes supernatant, and the BMMY substratum that adds again 1mL to contain 0.5% methyl alcohol in centrifuge tube, at 30 ℃, 220rpm inducing culture; After inducing culture 48h, the centrifugal 5min of 3,000 × g, gets supernatant and detects for enzymic activity, therefrom filters out the transformant of high mannosans enzymic activity, and concrete operations please refer to Pichia anomala expression operational manual.
The recombinate preparation of 'beta '-mannase of embodiment 4
(1) great expression of beta-mannase gene Man5DB shaking flask level in pichia spp
Filter out enzyme higher transformant alive, be inoculated in the 1L triangular flask of 400mL BMGY liquid nutrient medium, 30 ℃, 220rpm shaking table shaking culture 48h; The centrifugal 5min of 5,000rpm, softly abandons supernatant, then the BMMY liquid nutrient medium that adds 200mL to contain 0.5% methyl alcohol to thalline, and 30 ℃, 220rpm inducing culture 72h.During inducing culture, interval 24h adds a methanol solution to compensate the loss of methyl alcohol, makes methanol concentration remain on 0.5% left and right; (3) 12, the centrifugal 10min of 000 × g, collects supernatant fermented liquid, detects enzymic activity and carries out the analysis of SDS-PAGE protein electrophoresis.
(2) purifying of restructuring 'beta '-mannase
Collect the restructuring 'beta '-mannase supernatant liquor that shaking flask is expressed, concentrate by 10kDa film bag, replace substratum wherein with low salt buffer simultaneously, then further concentrated with 10kDa super filter tube.The concentrated restructuring Man5DB that can be diluted to certain multiple, carries out purifying by ion exchange chromatography.Particularly, get the HiTrap Q Sepharose XL anion column of Man5DB concentrated solution 2.0mL through using 20mM Tris-HCl (pH8.0) balance to cross in advance, then carry out linear gradient elution with the NaCl of 0-1mol/L, the elutriant that substep is collected detects enzymic activity and carries out the mensuration of protein concentration, utilizes the purity (Fig. 1) of SDS-PAGE electrophoretic analysis albumen.
The embodiment 5 'beta '-mannase some properties analysis of recombinating
Adopt DNS method to carry out activation analysis to mannase of the present invention.Concrete grammar is as follows: at pH5.0, under 65 ℃ of conditions, the reaction system of 1mL comprises the dilution enzyme liquid that l00 μ L is suitable, 900 μ L substrates, and reaction l0rnin, adds 1.5mL DNS termination reaction, boiling water boiling 5mn.Cooling rear 540nm measures OD value.Mannosans unit of enzyme activity definition: under certain condition, it is 1 activity unit (U) that per minute decomposes the required enzyme amount of mannosans generation l μ mol reducing sugar.
(1) optimal pH of mannase Man5DB and pH stability
The mannase Man5DB that purified embodiment 3 expresses carries out enzymatic reaction to measure its optimal pH under different pH.Damping fluid used is citric acid one Sodium phosphate dibasic series damping fluid and pH8.0～l0.0Tris-HCl series damping fluid of pH3.0～8.0.The pH adaptive result (Fig. 2) that the mannase Man5DB of purifying measures at buffer system .60 ℃ of different pH shows: the optimal pH of Man5DB is 5.0, and within the scope of pH3.5-pH6.0, this enzyme can maintain its more than 60% enzyme activity.
Enzyme liquid is processed to 60min in the damping fluid of different pH values at 37 ℃, then measure the pH stability of enzymic activity with studying enzyme.Result shows (Fig. 3), and analytical results shows can maintain more than 80% enzyme activity between pH3.0-pH9.0, illustrates that this enzyme has good pH stability.
(2) mannase Man5DB reaction optimum temperuture and thermostability
The mannase of purifying, under pH5.0 condition, is measured the enzymic activity under differing temps (30-80 ℃), analyzes experimental result and shows to show, the optimal reactive temperature of this enzyme is 65 ℃ (Fig. 4).Temperature tolerance is determined as mannase and processes different time under differing temps, then carries out enzyme assay at 65 ℃.Thermostability experiment shows: this enzyme is processed 60min at 60 ℃, and residual enzyme work is more than 95%, even if this enzyme is processed 60min at 60 ℃, still can keep 50% enzyme activity, and this shows that this enzyme has satisfactory stability (Fig. 5).
(3) mensuration of the kinetic parameter of restructuring 'beta '-mannase
With carob bean gum (the 0.25 – 5mg mL of different concns
-1) be substrate, in citric acid-Sodium phosphate dibasic damping fluid (pH5.0) buffer solution system, measure enzymic activity at 65 ℃, calculate its K
mvalue.After measured, the K during take carob bean gum as substrate
mvalue and Vmax are respectively 1.75mg ml
-1with 746.3 μ mol min
– 1mg
– 1.Protein content after mensuration purifying in enzyme liquid is 0.67mg mL
-1, then by enzyme activity determination method, record its enzyme and live as 532.9U/mL, the specific activity that finally obtains 'beta '-mannase is 795.3U mg
-1.
Claims (9)
1. an acidic beta-mannase Man5DB, is characterized in that, its aminoacid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.
2. an acidic beta-mannase gene, is characterized in that, a kind of acidic beta-mannase Man5DB claimed in claim 1 encodes.
3. acidic beta-mannase gene according to claim 2, is characterized in that, its nucleotide sequence is as shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.
4. comprise the recombinant expression vector of acidic beta-mannase gene described in claim 2.
5. comprise the recombinant expression vector pPIC9-man5DB of acidic beta-mannase gene described in claim 2.
6. comprise the recombinant bacterial strain of acidic beta-mannase gene described in claim 2.
7. comprise the recombinant bacterial strain GS115/man5DB of acidic beta-mannase gene described in claim 2.
8. a method of preparing acidic beta-mannase Man5DB, is characterized in that, comprises the following steps:
(1) with recombinant expression vector transformed host cell claimed in claim 4;
(2) cultivate host cell;
(3) separation and purification obtains 'beta '-mannase Man5DB.
9. the application of acidic beta-mannase Man5DB described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088929.4A CN103834628B (en) | 2014-03-12 | 2014-03-12 | A kind of acidic beta-mannase and gene thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410088929.4A CN103834628B (en) | 2014-03-12 | 2014-03-12 | A kind of acidic beta-mannase and gene thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834628A true CN103834628A (en) | 2014-06-04 |
| CN103834628B CN103834628B (en) | 2017-01-04 |
Family
ID=50798525
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410088929.4A Active CN103834628B (en) | 2014-03-12 | 2014-03-12 | A kind of acidic beta-mannase and gene thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834628B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994479A (en) * | 2012-11-29 | 2013-03-27 | 青岛蔚蓝生物集团有限公司 | Mannose |
-
2014
- 2014-03-12 CN CN201410088929.4A patent/CN103834628B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994479A (en) * | 2012-11-29 | 2013-03-27 | 青岛蔚蓝生物集团有限公司 | Mannose |
Non-Patent Citations (1)
| Title |
|---|
| BERKA，R.M. ET AL.: "XP_003654243.1", 《GENE BANK》, 4 January 2012 (2012-01-04) * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834628B (en) | 2017-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101457207B (en) | Eosinophil beta-mannanase MAN5A and gene and application thereof | |
| CN105018448B (en) | The heat-resisting acidic cellulase and its gene of a kind of originated from fungus and application | |
| CN103525792B (en) | A kind of high temperature high specific activity acidic beta-mannase and gene thereof and application | |
| CN102363774B (en) | Beta-mannaseBA-Man5A with wide pH range, gene thereof and application of gene | |
| CN105154417B (en) | The acidic cellulase and its gene of a kind of originated from fungus and application | |
| CN102978187B (en) | High-activity beta-mannanase MAN5A with pH value within range of 2.5-6.5, and gene and application thereof | |
| CN106047840B (en) | A kind of acidity exo polygalacturonase and its gene and application | |
| CN105039288A (en) | Neutral cellulase mutant and application thereof | |
| CN103275954B (en) | High temperature and alkali resisting mannanase Man5XZ7, gene and application thereof | |
| CN106967701A (en) | Acid high temperature-resisting cellulase Cel5 and its gene and application | |
| CN104388408A (en) | Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3 | |
| CN104560833B (en) | A kind of basophilic micrococcus luteus and its alkalescent xylanase and the application of generation | |
| CN103642779B (en) | A kind of high specific activity acidic beta-mannase Man5D and gene thereof and application | |
| CN103255118B (en) | Beta-mannase, coding gene as well as producing strain and application thereof | |
| CN103320415B (en) | Heatproof neutral cellulase Cel 61 and its gene and application | |
| CN103820420B (en) | A kind of high-temperature thermal stability acid alpha-galactosidase Gal27A and gene thereof and application | |
| CN107488221B (en) | Swollenin protein from fungi and gene and application thereof | |
| CN103834628A (en) | Acid beta-mannase as well as gene and application of acid beta-mannase | |
| CN104004733B (en) | A kind of high-temperature acidic 'beta '-mannase Man5DW1 and gene and application | |
| CN102154244B (en) | High-temperature acid cellulase EgG5 and gene and application thereof | |
| CN112574976A (en) | High-temperature-resistant acidic xylanase XYN10L2, and gene and application thereof | |
| CN105176950B (en) | Acidic thermophilic xylanase TLXyn10A, and gene and application thereof | |
| CN101892208B (en) | High-temperature acidic xylanase XYN10J88, gene and application thereof | |
| CN103695397A (en) | Mesophilic acidic xylanase XYN10L1 and gene and application thereof | |
| CN102154246A (en) | Acid glucanase CEL7G5 and gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200903 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100081 Beijing, Zhongguancun, South Street, No. 12, No. Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |
|
| TR01 | Transfer of patent right |