CN106047840B - A kind of acidity exo polygalacturonase and its gene and application - Google Patents
A kind of acidity exo polygalacturonase and its gene and application Download PDFInfo
- Publication number
- CN106047840B CN106047840B CN201610405968.1A CN201610405968A CN106047840B CN 106047840 B CN106047840 B CN 106047840B CN 201610405968 A CN201610405968 A CN 201610405968A CN 106047840 B CN106047840 B CN 106047840B
- Authority
- CN
- China
- Prior art keywords
- polygalacturonase
- exo
- exo polygalacturonase
- acidity
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01015—Polygalacturonase (3.2.1.15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01067—Galacturan 1,4-alpha-galacturonidase (3.2.1.67)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to genetic engineering fields, and in particular to a kind of acidity exo polygalacturonase and its preparation method and application.The amino acid sequence of the acidity exo polygalacturonase is as shown in SEQ ID NO.1 or SEQ ID NO.2.The enzyme optimal pH is that 3.5, thermal stability is good (70 DEG C of optimum temperature, 80% or more enzyme activity can be kept by handling 1h in 60,70 DEG C), is easy fermenting and producing.All these advantages can mean that neoteric exo polygalacturonase in feed, food service industry, it will the exo polygalacturonase than reporting in the past more has application value.
Description
Technical field
The present invention relates to genetic engineering fields, and in particular to it is a kind of acidity exo polygalacturonase and its gene and
Using.
Background technique
Pectin is a kind of electronegative macromolecule polysaccharide, is widely present in the group of higher plant, especially fruits and vegetables
It is the main component of fruit-vegetable plant cell mesoglea in knitting.Pectin is by the D- galacturonic acid of different esterification degrees with α -1,4 glucosides
Polysaccharide chain made of key connection, the side chain often with the compositions such as rhamnose, arabinose, galactolipin, xylose, molecular weight between
Between 25kD~360kD.Pectic substance is divided into 4 classes: protopectin (protopectin), pectin (pectin), pectic acid
(pectic acid, pectate) and pectinic acid (pectinic acid, pectinate).Pectase is to decompose pectic substance
The general name of a variety of enzymes, high molecular pectin polysaccharide can be degraded to small molecule or monomer reduction sugar form by it, and can effectively degrade fruit
Glue, therefore pectase has important industrial application (Lucie Parenicova et al., FEBS Letters (2000)
467:333-336).Protopectinase, depolymerase and pectinesterase can be divided by mechanism of action pectase.Depolymerase can be divided into again
Pectin hydrolase and pectin lyase.Wherein hydrolase is generated by α -1,4 glycosidic bond that hydrolysis cuts D- galactonic acid
Oligogalacturonans, and lyases then cuts off α-Isosorbide-5-Nitrae glycosidic bond by trans-elimination and generates β -4,5 unsaturated galactolipins
Aldehydic acid, the methyl esters in pectinesterase hydrolysis of pectin generate pectic acid (Nilay Demir et al., Journal of Food
Engineering(2001)47:275-280)。
Polygalacturonase chain can carry out depolymerization by lyases and hydrolase two ways.Polygalacturonase
(Polygalacturonase, Endo-/EC 3.2.1.15, Exo-/EC 3.2.1.67) acts on polygalacturonase chain
α-Isosorbide-5-Nitrae-d- glycosidic bond, hydrolysis occurs, generates single or oligomerization galacturonic acid.Polygalacturonase is ground
Study carefully and be most widely used (Sharma et al., Reviews in Environmental Science and Bio/
Technology 2013,12:45–60。
Polygalacturonase is that most commonly used enzyme is studied in pectin enzyme system, belongs to glycoside hydrolase the 28th
Race, specific catalytic hydrolyze α-Isosorbide-5-Nitrae-glycosidic bond in polygalacturonase chain and generate single or oligomerization galacturonic acid, without
The polygalacturonase of esterification or acetylation can be hydrolyzed.As other glycoside hydrolases, polygalacturonase
It is divided into restriction endonuclease (endo-) and excision enzyme (exo-), the hydrolysate of endo-polygalacturonase (EC 3.2.1.15)
It is oligogalacturonans, and the hydrolysis of the exo polygalacturonase (EC 3.2.1.67) of bacterium and originated from fungus is whole
Product is different: it is galacturonic acid that bacterium exo polygalacturonase, which hydrolyzes final product,；Fungal exo poly gala
The hydrolysis final product of uronic acid enzyme is golacturonic acid.
The polygalacturonase of separate sources, zymologic property significant difference.Most of circumscribed polygalacturonases
The optimum pH of enzyme belongs to alkaline range, and the optimum temperature of exo polygalacturonase is maintained at 50-60 DEG C of range.
Summary of the invention
The object of the present invention is to provide a kind of acid, heat-resisting exo polygalacturonases.
Another object of the present invention is to provide the encoding gene of above-mentioned exo polygalacturonase.
Another object of the present invention is to provide the recombinant vector comprising above-mentioned exo polygalacturonase gene.
Another object of the present invention is to provide the recombinant bacterial strain comprising above-mentioned exo polygalacturonase gene.
Another object of the present invention is to provide a kind of method for preparing exo polygalacturonase.
Another object of the present invention is to provide the application of above-mentioned exo polygalacturonase.
The present invention first the technical problem to be solved is that overcome the deficiencies of the prior art and provide a kind of good properties,
It is suitable for the new exo polygalacturonase applied in the industries such as feed, food, amino acid sequence such as SEQ ID
NO.1:
433 amino acid of the enzyme overall length, 22 amino acid of N-terminal are signal peptide sequence " MKFSNTLTQA ISLLSLGLAV
EG”。
Therefore, the theoretical molecular weight of mature exo polygalacturonase is 45.0kDa, and amino acid sequence is such as
SEQ ID NO.2:
The optimal pH of the exo polygalacturonase is 3.5, is stablized within the scope of pH1.0-pH7.0；Optimum temperature
70 DEG C, still there is 30% enzyme activity at 85 DEG C, is able to maintain 80% or more in 60 processing 1h enzyme activity, handles 1h enzyme in 70 DEG C
Work is able to maintain 60% or more, handles 2min at 80 DEG C, is able to maintain 60% or more enzyme activity, has good thermostabilization
Property.
The present invention also provides the genes for encoding above-mentioned exo polygalacturonase.The complete genome sequence of the enzyme is such as
Shown in SEQ ID NO.3:
Wherein, the base sequence of signal peptide are as follows:
“ATGAAGTTCT CCAATACCCT TACCCAGGCA ATCAGCCTGT TGTCTCTGGG CCTCGCCGTG
GAAGGG”
Therefore, the coded sequence of mature gene is
Shown in SEQ ID NO.4:
The enzyme belongs to the 28th family of glycosyl hydrolase, is a kind of new circumscribed polygalacturonase by comparing the enzyme
Enzyme.
The present invention also provides the recombinant vectors comprising above-mentioned exo polygalacturonase gene, preferably finish red ferment
Female expression vector.Exo polygalacturonase gene of the invention is inserted into the suitably restricted digestion position of expression vector
Between point, make its nucleotide sequence is operable to be linked to the expression control sequence.It is most preferred real as of the invention one
Scheme is applied, preferably limits EcoRI and NotI that exo polygalacturonase gene cDNA is inserted on plasmid pPIC9
Between property restriction enzyme site, so that the nucleotide sequence is located at the downstream of AOXl promoter and is regulated and controled by it, obtain expression of recombinant yeast
Plasmid.
The present invention also provides the recombinant bacterial strain comprising above-mentioned exo polygalacturonase gene, preferably recombination is finished
Red yeast strain.
The present invention also provides a kind of methods for preparing exo polygalacturonase enzyme, comprising the following steps:
1) host cell is converted with above-mentioned recombinant vector, obtains recombinant bacterial strain；
2) recombinant bacterial strain, the expression of induction recombination exo polygalacturonase are cultivated；And
3) it recycles and purifies expressed exo polygalacturonase.
Wherein, the preferably described host cell is Pichia pastoris (Pichia pastoris) cell, brewer's yeast
(Saccharomyces cerevisiae) cell or Hansenula polymorpha (Hansenula polymorpha) cell preferably will
Expression of recombinant yeast plasmid converts Pichia pastoris (Pichic pastoris) GS115, obtains recombinant bacterial strain.
The present invention also provides the applications of above-mentioned exo polygalacturonase.Carry out industrialization with genetic engineering means
Produce exo polygalacturonase.The present invention has obtained a new exo polygalacturonase base from blue shape bacterium
Cause, the exo polygalacturonase of coding have several advantages that acid (optimal pH 3.5), thermal stability are good
(70 DEG C of optimum temperature, 80% or more enzyme activity can be kept by handling 1h in 60,70 DEG C), are easy fermenting and producing.It is all these
Advantage can mean that neoteric exo polygalacturonase in feed, food service industry, it will outer than what is reported in the past
Cutting polygalacturonase more has application value.The present invention provides a new exo polygalacturonase gene,
It can make to be applied to the industry such as feed, food.It can realize and be produced using genetic engineering means according to the technique and scheme of the present invention
Good properties are suitble to the exo polygalacturonase of industrial application.
Detailed description of the invention
The SDS-PAGE analysis that Fig. 1 exo polygalacturonase is expressed in Pichia pastoris, M. molecular weight of albumen mark
Standard, the recombinase of 1 purifying, the recombinase after 2 desugar bases.
The optimum pH of Fig. 2 present invention recombination exo polygalacturonase.
The pH stability of Fig. 3 exo polygalacturonase of the present invention.
Fig. 4 exo polygalacturonase optimal reactive temperature of the present invention.
Fig. 5 exo polygalacturonase thermal stability of the present invention.
Specific embodiment
Test material and reagent
1, bacterial strain and carrier: expressive host Pichia pastoris GS115, expression plasmid carrier pPIC9 are our company
It saves.
2, enzyme and other biochemical reagents: restriction endonuclease is purchased from Fermentas company, and ligase is purchased from Promaga company, more
Polygalacturonic acid is purchased from Sigma company.It is other all (to be bought from common biochemical Reagent Company for domestic analytical reagents
To).
3, culture medium:
(1) LB culture medium: 0.5% yeast extract, 1% peptone, 1%NaCl, pH 7.0
(2) YPD culture medium: 1% yeast extract, 2% peptone, 2% glucose
(3) MD solid medium: 2% glucose, 1.5% agarose, 1.34%YNB, 0.00004%Biotin
(4) MM solid medium: 1.5% agarose, 1.34%YNB, 0.00004%Biotin, 0.5% methanol
(5) BMGY culture medium: 1% yeast extract, 2% peptone, 1% glycerol (V/V), 1.34%YNB,
0.00004%Biotin
(6) BMMY culture medium: 1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 0.5%
Methanol (V/V)
4, the experimental methods of molecular biology illustrated in detail is not done in the present embodiment, referring to " Molecular Cloning: A Laboratory
Guide " specific method listed in book of (third edition) J. Pehanorm Brooker one carries out, or according to kit and product description
It carries out.
The acquisition of 1 exo polygalacturonase encoding gene of embodiment
Design cloning primer F:atgaagttctccaatacccttacccaggc and R:
ctatacgcagtcgatggccaaagtgctc.Blue shape bacterium KWB1 total serum IgE is extracted, is utilized Oligo (dT)20It is obtained with reverse transcriptase
A chain of cDNA, then the primers F and R of design amplification open reading frame, expand the single-stranded cDNA, obtain circumscribed poly half
The cDNA sequence of lactobionic acid enzyme, amplification send sequencing after obtaining product recycling.PCR is carried out by template of blue shape bacterium KWB1 total DNA
Amplification.PCR response parameter are as follows: 95 DEG C of 5min；94 DEG C of 30sec, 62 DEG C of 30sec, 72 DEG C of 60sec, 30 circulations, 72 DEG C of 10min.
An about 1.3k bp segment is obtained, correct rear acquisition overall length encoding gene is sequenced.CDNA long 1302bp, encode 433 amino acid and
One terminator codon, 22 amino acid of N-terminal are its signal peptide sequence.
The building of 2 exo polygalacturonase engineered strain of embodiment
(1) building of expression vector and the expression in yeast
The cDNA of correct exo polygalacturonase is sequenced as template, design synthesized with EcoR I and
The primer cdna-sF:act of Not I restriction enzyme sitegaattcTcagggatcaatattcagagagatgatgcg and
cdnaR:atagcggccgcCtatacgcagtcgatggccaaagtgctc, to exo polygalacturonase at soft-boiled eggs
White code area is expanded.And EcoR I and Not I digestion PCR product are utilized, connection enters expression vector PPIC9, circumscribed
The sequence of polygalacturonase maturation protein is inserted into the downstream of the signal peptide sequence of above-mentioned expression vector, with signal peptide shape
At correct reading frame, it is built into Yeast expression carrier, converts competent escherichia coli cell JM109.Positive transformant into
Row DNA sequencing, sequencing show the correct transformant of sequence for a large amount of preparation and reorganization plasmids.With restriction enzyme Bgl II into
Row linearisation expression plasmid carrier DNA, electroporated yeast GS115 competent cell, 30 DEG C are cultivated 2-3 days, and picking is flat in MD
The transformant grown on plate carries out further expression experiment, and concrete operations please refer to Pichia anomala expression operation manual.
The expression vector of the cDNA of the signal peptide sequence containing exo polygalacturonase is constructed in the same way, and is turned
Change.
(2) screening of the active Transforming son of high exo polygalacturonase
With sterilized toothpick from picking single colonie on the MD plate with transformant, first put on MD plate according to number,
MD plate is placed in 30 DEG C of incubators and is cultivated 1~2 day, until bacterium colony is grown.It is inoculated with by number from picking transformant on MD plate
In the centrifuge tube equipped with 3mL BMGY culture medium, 30 DEG C, 220rpm shaking table culture 48h；By the bacterium solution 3 of shaking table culture 48h,
000 × g be centrifuged 15min, remove supernatant, the BMMY culture medium that 1mL contains 0.5% methanol added in centrifuge tube, 30 DEG C,
220rpm Fiber differentiation；After Fiber differentiation 48h, 3,000 × g is centrifuged 5min, takes supernatant for Enzyme assay, is screened out from it
The high active transformant of exo polygalacturonase, concrete operations please refer to Pichia anomala expression operation manual.
The preparation of the recombination exo polygalacturonase of embodiment 3
(1) great expression of exo polygalacturonase gene shaking flask level in Pichia pastoris
The higher transformant of enzyme activity is filtered out, is inoculated in the 1L triangular flask of 300mL BMGY fluid nutrient medium, 30 DEG C,
220rpm shaking table shaken cultivation 48h；5,000rpm centrifugation 5min softly abandon supernatant, then 100mL are added to thallus and contains 0.5%
The BMMY fluid nutrient medium of methanol, 30 DEG C, 220rpm Fiber differentiation 72h.During Fiber differentiation, a methanol is added at interval for 24 hours
Solution makes methanol concentration be maintained at 0.5% or so to compensate the loss of methanol；(3) 12,000 × g are centrifuged 10min, collect supernatant
Fermentation liquid detects enzymatic activity and carries out SDS-PAGE protein electrophoresis analysis (Fig. 1).
(2) purifying of exo polygalacturonase is recombinated
The recombination exo polygalacturonase supernatant for collecting shaking flask expression, is concentrated by film packet, is used simultaneously
Low salt buffer replaces culture medium therein, is then further concentrated with super filter tube.Concentration can be diluted to the weight of certain multiple
Group exo polygalacturonase, is purified by ion-exchange chromatography.Specifically, the circumscribed poly galacturonic of recombination is taken
Sour enzyme concentrate 2.0mL through in advance with 20mM Tris-HCl (pH 7.5) equilibrated HiTrap Q Sepharose XL yin from
Then sub- column carries out linear gradient elution with the NaCl of 0-1mol/L, detect enzymatic activity and progress to the eluent of Fraction collection
The measurement of protein concentration.
Embodiment 4 recombinates the analysis of exo polygalacturonase some properties
Activity analysis is carried out to exo polygalacturonase of the invention using DNS method.The specific method is as follows: in pH
Under the conditions of 3.5,70 DEG C, the reaction system of 1mL includes l00 μ L dilution enzyme solution appropriate, and 900 μ L substrates react l0rnin, is added
1.5mL DNS terminates reaction, boiling water boiling 5min.540nm measures OD value after cooling.Exo polygalacturonase active unit
Definition: under certain condition, decomposing enzyme amount needed for polygalacturonase generates l μm of ol reduced sugar per minute is 1 activity
Unit (U).
(1) optimal pH of exo polygalacturonase and pH stability
The exo polygalacturonase that purified embodiment 3 is expressed carries out enzymatic reaction at different pH to survey
Its fixed optimal pH.Buffer used is 1.0~3.0 glycine-HCI buffer of pH, one phosphoric acid of citric acid of pH2.2~8.0
Disodium hydrogen series of buffer, pH 8.0~9.0Tris-HC buffer, the glycine-NaOH series of buffer of pH9.0~12.Purifying
Exo polygalacturonase different pH buffer system.The pH adaptive result (Fig. 2) measured at 80 DEG C shows:.It should
The optimal pH of exo polygalacturonase is 3.5.
Enzyme solution is handled into 60min in the buffer of different pH value at 37 DEG C, then measures enzymatic activity with the pH of studying enzyme
Stability.The result shows that (Fig. 3), analysis the result shows that the enzyme is stablized between pH2.0-pH8.0 there is excellent pH to stablize
Property.
(2) exo polygalacturonase reaction optimum temperature and thermal stability
Enzyme of the exo polygalacturonase of purifying under the conditions of 3.5 pH, under measurement different temperatures (40-90 DEG C)
Activity, analysis 70 DEG C of optimum temperature, still have 60% enzyme activity (Fig. 4) at 80 DEG C, 60 the experimental results showed that display
60min is handled at DEG C, enzyme activity is not lost substantially, handles 60min at 70 DEG C, 60% or more enzyme activity is able to maintain, 80
2min is handled at DEG C, is able to maintain 60% or more enzyme activity, is had good thermal stability (Fig. 5).
With polygalacturonase (0.1mol/L citrate-phosphate disodium hydrogen buffer) be substrate, the mutant and
Rate activity of the wild type under optimum condition is respectively 388U/mg, Vmax=1001U/min/mg, Km=3.8mg/mL.
Claims (7)
1. a kind of acidity exo polygalacturonase, which is characterized in that the acidity exo polygalacturonase
Amino acid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.
2. a kind of acidity exo polygalacturonase gene, which is characterized in that coding acidity described in claim 1 is circumscribed
Polygalacturonase.
3. acidity exo polygalacturonase gene according to claim 2, which is characterized in that its nucleotide sequence
As shown in SEQ ID NO.3 or SEQ ID NO.4.
4. the recombinant expression carrier comprising acid exo polygalacturonase gene as claimed in claim 2.
5. the recombinant cell comprising acid exo polygalacturonase gene as claimed in claim 2.
6. a kind of preparation method of acidity exo polygalacturonase, which is characterized in that this method comprises the following steps:
1) host cell is converted with recombinant expression carrier as claimed in claim 4；
2) incubation step 1) obtain host cell；
3) acid exo polygalacturonase described in claim 1 is isolated and purified.
7. exo polygalacturonase described in claim 1 is for α -1,4- sugar in catalyzing hydrolysis polygalacturonase chain
The application of glycosidic bond.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610405968.1A CN106047840B (en) | 2016-06-10 | 2016-06-10 | A kind of acidity exo polygalacturonase and its gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610405968.1A CN106047840B (en) | 2016-06-10 | 2016-06-10 | A kind of acidity exo polygalacturonase and its gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106047840A CN106047840A (en) | 2016-10-26 |
| CN106047840B true CN106047840B (en) | 2019-05-28 |
Family
ID=57170724
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610405968.1A Active CN106047840B (en) | 2016-06-10 | 2016-06-10 | A kind of acidity exo polygalacturonase and its gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106047840B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111254153A (en) * | 2018-11-30 | 2020-06-09 | 中国科学院大连化学物理研究所 | Polygalacturonase encoding gene and enzyme, preparation and application |
| CN114958810A (en) * | 2021-02-22 | 2022-08-30 | 大连海洋大学 | Ultrahigh-temperature-resistant polygalacturonase McPG28A and preparation method thereof |
| CN114292832A (en) * | 2022-01-27 | 2022-04-08 | 大连海洋大学 | Thermophilic high-temperature-resistant polygalacturonaseMlPG28BEncoding gene and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5624834A (en) * | 1992-12-24 | 1997-04-29 | Gist-Brocades, B.V. | Cloning and expression of the exo-polygalacturonase gene from aspergillus |
-
2016
- 2016-06-10 CN CN201610405968.1A patent/CN106047840B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5624834A (en) * | 1992-12-24 | 1997-04-29 | Gist-Brocades, B.V. | Cloning and expression of the exo-polygalacturonase gene from aspergillus |
Non-Patent Citations (2)
| Title |
|---|
| exo polygalacturonase [Aspergillus fumigatus var.RP-2014];GenBank: KEY76445.1;《GenBank》;20140718;序列 |
| probable exopolygalacturonase X [Aspergillus udagawae];GenBank: GAO84197.1;《GenBank》;20151006;序列 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106047840A (en) | 2016-10-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018448B (en) | The heat-resisting acidic cellulase and its gene of a kind of originated from fungus and application | |
| CN109988714B (en) | Trichoderma reesei and application thereof | |
| CN101457207A (en) | Eosinophil beta-mannanase MAN5A and gene and application thereof | |
| WO2020073866A1 (en) | Glucoamylase tlga15 and gene and application thereof | |
| CN106047840B (en) | A kind of acidity exo polygalacturonase and its gene and application | |
| CN105886484A (en) | Thermophilic cellulase, encoding gene thereof and application of thermophilic cellulase | |
| CN110129303B (en) | High-temperature-acid-resistant pectinase Tspec, gene and application | |
| CN102363774B (en) | Beta-mannaseBA-Man5A with wide pH range, gene thereof and application of gene | |
| CN101469325B (en) | Secretory expression method for exoinulinase from Kluyveromyces marxianus | |
| CN103525792B (en) | A kind of high temperature high specific activity acidic beta-mannase and gene thereof and application | |
| CN105154417B (en) | The acidic cellulase and its gene of a kind of originated from fungus and application | |
| CN106967701A (en) | Acid high temperature-resisting cellulase Cel5 and its gene and application | |
| CN104232604B (en) | Polygalacturonase PG7fn and gene and application thereof | |
| CN106566818B (en) | Acid thermophilic polygalacturonase TePG28A and its encoding gene and application | |
| CN110564748B (en) | Poria cocos cellulose endonuclease gene and expression vector and protein thereof | |
| CN105274076B (en) | The polygalacturonase PG63H95Y and its encoding gene of a kind of mutation and application | |
| CN110577959B (en) | Cellulose exonuclease gene, protein thereof and recombinant vector | |
| CN110592121B (en) | High-expression cellulose endonuclease gene and recombinant vector and protein thereof | |
| CN105838693B (en) | A kind of high temperature resistant acidic pectase PAGL8 and its gene and application | |
| CN109486689B (en) | Method for enhancing acid resistance of L-asparaginase | |
| KR101350955B1 (en) | Novel exoglucanase and the Use thereof | |
| CN103642779B (en) | A kind of high specific activity acidic beta-mannase Man5D and gene thereof and application | |
| US20210284983A1 (en) | Beta glucosidase with high glucose tolerance, high thermal stability and broad ph activity spectrum | |
| CN105219751B (en) | The polygalacturonase PG63T341Y and its encoding gene of a kind of mutation and application | |
| CN108588056A (en) | A kind of low temperature alpha-amylase Tcamy and its gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |