CN103789305A - Molecular identification method for gene type of gold-silver feather locus of chicken - Google Patents
Molecular identification method for gene type of gold-silver feather locus of chicken Download PDFInfo
- Publication number
- CN103789305A CN103789305A CN201410032115.9A CN201410032115A CN103789305A CN 103789305 A CN103789305 A CN 103789305A CN 201410032115 A CN201410032115 A CN 201410032115A CN 103789305 A CN103789305 A CN 103789305A
- Authority
- CN
- China
- Prior art keywords
- silver
- plumage
- ultrapure water
- gold
- band
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular identification method for the gene type of a gold-silver feather locus of chicken. The method comprises the following steps: A, designing a primer according to a DNA (deoxyribonucleic acid) sequence of an SLC45A2 gene of the chicken; B, creating a 15 microliter system by taking a primer pair M4-S/A as an amplification primer; C, detecting a PCR (polymerase chain reaction) product through agarose gel electrophoresis; D, performing enzyme digestion through a restriction enzyme; E, detecting an enzyme digestion product through polyacrylamide gel electrophoresis; F, displaying an electrophoresis result through silver staining and judging a result according to the sizes and the number of stripes; G, in a rooster, the stripes being 64bp and 16bp are gold feather homozygotes (ZsZs), the stripes being 64bp, 55bp and 16bp are silver feather heterozygotes (ZSZs), and the stripes being 55bp and 16bp are silver feather homozygotes (ZSZS); and H, in a hen, the stripes being 64bp and 16bp are gold feather hemizygotes (ZsW) and the stripes being 55bp and 16bp are silver feather hemizygotes (ZSW). The method is easy to implement, is easy and convenient to operate, cannot be restricted by genetic background, is wide in application range, and can be used for identifying the gene types of different individuals on the gold-silver feather locus.
Description
Technical field
The present invention relates to molecule marker Application Areas in chicken genetic breeding, be specifically related to a kind of molecular assay method of chicken gold and silver plumage loci gene type.
Background technology
The male and female of nascent chick are differentiated in poultry is produced and are had great significance, when chick goes out shell in broiler production, differentiate that male and female are conducive to male and female and divide foster, be convenient to the growth rate different according to male and female, nutritional needs gives different feeds and feeding and management condition, avoid public young growth soon, rob food and the female young growth of impact; When chick goes out shell in commodity egg is produced, eliminate public young bird and can save space and the cost of raising public young bird, improve surviving rate and the reguarity of hen; Can be by differentiating male and female, only selling other chick of different lines unicity protection breeding achievement for kind of chicken.The sex appraisal method of chick is divided into two classes substantially: a class, according to the difference of the reproductive organ of male and female chick, is identified by the direct observation to reproduction projection or sexual gland, comprises apparatus differential method, turns over anus differential method etc.; The another kind of sex-linkage crisscross inheritance phenomenon of utilizing chicken sex-linked gene, use with the genotypic kind of specific sex linked gene or strain and hybridize production autosexing strain, differentiate chick sex by size or the different rates of feathering of the color of filial generation chick down, light patch.The relative direct observational method of automatic sexing (as turning over anus method, apparatus differential method) has discriminating speed fast, and accuracy rate is high, does not need discriminating personnel to carry out special technical training, little to chick damage, the little advantage of possibility of cross infection disease.In autosexing strain is produced, the sex linked gene of application has speed feather genes, gold and silver feather genes and horizontal spot gene at present.In the automatic sexing method of utilizing these genes, utilize gold and silver feather genes automatic sexing directly to pass through chick down color differentiating male and female, more simple, intuitive, not free restriction, and also accuracy rate is higher, has better utilised and is worth.While utilizing gold and silver feather genes to carry out automatic sexing, use golden plumage cock and the mating of silver-colored plumage hen, the public natal down of the offspring that gives birth to be white, female natal down be redness.Gold and silver plumage autosexing strain has been widely used in deriving from the supporting system of brown shell layer of the white genetic background of Luo Daohong-Luo Dao at present, but rare application in the chicken group of other genetic backgrounds, major reason is that on gold and silver plumage site, allelic expression is subject to the modifying factor impact on other sites (as exit site etc.) to a great extent, thereby under some genetic backgrounds, is difficult to the individual gold and silver plumage phenotype of precise Identification (and then identified gene type).Adopt gold and silver plumage loci gene type molecular assay method of the present invention, can in Different Chicken kind of groups, pick out gold and silver plumage loci gene type different cock and hen and breed, under other genetic background, also can utilize gold and silver feather genes to carry out the object of automatic sexing thereby reach.The method that the present invention sets up can be identified the genotype on Different Individual gold and silver plumage site quick, easy, accurately, contributes to the promotion and application widely of gold and silver plumage automatic sexing technology.
Summary of the invention
The object of the present invention is to provide a kind of molecular assay method of chicken gold and silver plumage loci gene type, easy to implement the method, easy and simple to handle, in gold and silver plumage autosexing strain, the down color of chick is only determined with visual inspection, and silver-colored plumage heterozygote is identical with silver-colored plumage homozygote phenotype, naked eyes cannot be distinguished, and this molecular assay method can be distinguished heterozygote and homozygote.Gold and silver plumage autosexing strain has been widely used in deriving from the supporting system of brown shell layer of the white genetic background of Luo Daohong-Luo Dao at present, but rare application in the chicken group of other genetic backgrounds, a major reason is that on gold and silver plumage site, allelic expression is affected by the modifying factor on other sites to a great extent, thereby is difficult to the individual gold and silver plumage phenotype of precise Identification (and then identified gene type) under some genetic backgrounds.And this molecular assay method is not subject to the restriction of genetic background, have wide range of applications.Can identify the genotype of Different Individual on gold and silver plumage site.
In order to realize above-mentioned object, the present invention adopts following technical measures:
A molecular assay method for chicken gold and silver plumage loci gene type, the steps include:
A, utilize software primer premier 5.0, according to chicken
sLC45A2the DNA sequence dna design primer pair M4-S/A of gene, primer length is 22bp:M4-S:5'ATCCCATTATCGCTGTCTGCAT 3', M4-A:5'AATCCGTGAAGAAGAGCATAGT 3'; A DNA sequence dna for separation, its sequence is the nucleotide sequence shown in SEQ ID NO.1.
B, set up 15 μ L systems take primer pair M4-S/A as amplimer as follows: 1.5 μ L 10 × EasyTaq Buffer (+Mg
2+), the positive anti-primer of 0.3 μ L (10 μ M), the dNTP (2.5mM) of 0.15 μ L, the Taq polysaccharase of 0.5U, the genomic dna of 1 μ L, adds ultrapure water polishing to 15 μ L; Response procedures is 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, and 53 ℃ of annealing 30s, 72 ℃ are extended 30s, 35 circulations, 72 ℃ are extended 5min again, and 15 ℃, 1min, saves backup at 4 ℃;
C, electrophoresis detection PCR product: get 6 μ L PCR products, add 3 μ L 6 × Loading Buffer, preparation concentration is the sepharose of 1.2 %, after point sample, electrophoresis 40min under 120V voltage, ethidium bromide staining, gel imaging instrument detects, and determines whether and increases successfully according to the size that has that it's too late of band.
D, digestion with restriction enzyme: the reaction system that enzyme is cut is: ultrapure water 3.6 μ L, 10 × bufferG, 0.5 μ L, restriction endonuclease 4U, PCR product 1 μ L.Cut 16h in 37 ℃ of enzymes.
E, polyacrylamide gel electrophoresis detect enzyme and cut product: the polyacrylamide that adopt 40%, degree of crosslinking is 19:1, be formulated as the gel of 16% polyacrylamide, and system is: polyacrylamide 18 mL, 5 × TBE, 9 mL, ultrapure water 18 mL, 10%AP 350 μ L, TEMED 35 μ L.First 300V electrophoresis 10min, then 120V electrophoresis 5.5h.
F, silver staining display electrophoresis result, according to the size of band and number result of determination: it is as follows that silver dyes step: the dehydrated alcohol rinsing 10min of ultrapure water rinsing twice, 10%; The nitric acid rinsing 10min of ultrapure water rinsing twice, 1%; Ultrapure water rinsing twice is that 0.2% Silver Nitrate adds 750 μ L formaldehyde lucifuge rinsing 20min; The sodium hydroxide of ultrapure water rinsing twice, 3% adds the rinsing of 1mL formaldehyde until there is clear band; Ultrapure water rinsing twice, 3% acetic acid color development stopping; Change ultrapure water, Taking Pictures recording analytical results.
G, in cock, be golden plumage homozygote (Z if band is 64bp and 16bp
sz
s); If band is 64bp, 55bp and 16bp is silver-colored plumage heterozygote (Z
sz
s); If band is 55bp and 16bp is silver-colored plumage homozygote (Z
sz
s);
H, in hen, be golden plumage hemizygote (Z if band is 64bp and 16bp
sw); If band is 55bp and 16bp is silver-colored plumage hemizygote (Z
sw).
atcccattat cgctgtctgt gtgtgagcca cctctttgga tggatggctt tcctgtccaa 60
catgctcttc ttcacggatt 80
What underscore marked is SNP site.
In cock, if genotype is golden plumage homozygote, this site is C/C; If silver-colored plumage homozygote, this site is A/A; If silver-colored plumage heterozygote, this site is C/A.
In hen, if genotype is golden plumage hemizygote, this site is C/-; If silver-colored plumage hemizygote, this site is A/-.
Adopt phenol-chloroform method to extract the DNA of chicken to be identified, also can adopt the additive methods such as salting-out process to extract DNA.The DNA extracting is for the partial sequence of amplification gene SLC45A2.
The coded albumen of SLC45A2 is the relevant translocator of film, contains 12 cross-film districts, synthetic relevant with pigment.May be relevant with this process of melanosome that TYR, TYRP1 are transported to the II phase from golgi body.The sudden change of SLC45A2 may affect above-mentioned transport process, and then impact is pseudo-melanic synthetic but synthetic not impact on eumelanin finally causes the reddish yellow feather of chicken to become white.
The present invention compared with prior art, has the following advantages and effect:
Can in Different Chicken kind of groups, pick out gold and silver plumage loci gene type different cock and hen and breed, under other genetic background, also can utilize gold and silver feather genes to carry out the object of automatic sexing thereby reach.The method that the present invention sets up can be identified the base on Different Individual gold and silver plumage site quick, easy, accurately, contributes to the promotion and application widely of gold and silver plumage automatic sexing technology.
In gold and silver plumage autosexing strain, use golden plumage cock and the mating of silver-colored plumage hen, the public natal down of the offspring that gives birth to be white, female natal down be redness.The color of chick down only determines by visual inspection, and silver-colored plumage homozygote is consistent with the phenotype of silver-colored plumage heterozygote, cannot distinguish by naked eyes.And this molecular assay method can be distinguished heterozygote and homozygote.Gold and silver plumage autosexing strain has been widely used in deriving from the supporting system of brown shell layer of the white genetic background of Luo Daohong-Luo Dao at present, but rare application in the chicken group of other genetic backgrounds, a major reason is that on gold and silver plumage site, allelic expression is affected by the modifying factor on other sites to a great extent, thereby is difficult to the individual gold and silver plumage phenotype of precise Identification (and then identified gene type) under some genetic backgrounds.And molecular assay method is not subject to the restriction of genetic background.Chu Luo island is red-genetic background beyond Luo Dao is white under, can first utilize this molecular assay method to determine individual genotype, then between the individuality of homologous genes type, find out the common ground in phenotype, and find out the modifying factor that affects its phenotype, under other genetic background condition, also can adopt gold and silver plumage automatic sexing thereby reach.
Accompanying drawing explanation
Fig. 1 is a kind of molecular assay method schema of chicken gold and silver plumage loci gene type.
Fig. 2 be a kind of gold and silver plumage supporting be the pcr amplification result electrophorogram of the red chicken DNA in capital.
Numbering is described as follows:
1-4: female, Jin Yu, Z
sw; 5-8: female, silver-colored plumage, Z
sw
9-12: male, Jin Yu, Z
sz
s; 13-16: male, silver-colored plumage, Z
sz
s
NC: negative control
Except negative control, all amplify the band of 80bp.DNA Marker is marker I.
Fig. 3 is that a kind of enzyme is cut the result schematic diagram that silver dyes after the polyacrylamide gel electrophoresis of product.
Numbering is described as follows:
1-4: female, Jin Yu, Z
sw; 5-8: female, silver-colored plumage, Z
sw
9-12: male, Jin Yu, Z
sz
s; 13-16: male, silver-colored plumage, Z
sz
s
NC: negative control
DNA Marker is low ladder.
The band of 1-4 is 64bp and 16bp, and the band of 5-8 is 55bp and 16bp
The band of 9-12 is 64bp and 16bp, and the band of 13-16 is 64bp, 55bp and 16bp.
Embodiment
Embodiment 1:
A molecular assay method for chicken gold and silver plumage loci gene type, the steps include:
1. the preparation of sample and preservation:
Gather the brown father and mother of Luo Man of Hubei China province Tian Mu plant of Wuhan City for male and female chicken and commercial generation chick (male and female chicken) blood sample thereof, the anti-freezing of citric acid antithrombotics, puts ice chest and takes back laboratory and be stored in-20 ℃ of refrigerators for subsequent use.Get 60 μ L anti-freezing blood samples, adopt conventional phenol-chloroform extraction method to extract the DNA in blood sample, DNA sample retention is for subsequent use in 4 ℃ of refrigerators.
2, design of primers: utilize software primer premier 5.0, according to 8821 of the DNA sequence dna of the SLC45A2 gene of chicken to 9781 design primer pair M4-S/A, primer length is 22bp:M4-S:5'ATCCCATTATCGCTGTCTGCAT 3', M4-A:5'AATCCGTGAAGAAGAGCATAGT 3';
A DNA sequence dna for separation, its sequence is the nucleotide sequence shown in SEQ ID NO.1.
3, pcr amplification:
Set up 15 μ L systems take primer pair M4-S/A as amplimer as follows: 1.5 μ L 10 × EasyTaq Buffer (+Mg
2+), the positive anti-primer of 0.3 μ L (10 μ M), the dNTP (2.5mM) of 0.15 μ L, the Taq polysaccharase of 0.5U, the genomic dna of 1 μ L, adds ultrapure water polishing to 15 μ L; Response procedures is 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, and 53 ℃ of annealing 30s, 72 ℃ are extended 30s, 35 circulations, 72 ℃ are extended 5min again, and 15 ℃, 1min, saves backup at 4 ℃;
4, electrophoresis detection PCR product:
Get 6 μ L PCR products, add 3 μ L 6 × Loading Buffer, preparation concentration is the sepharose of 1.2 %, after point sample, electrophoresis 40min under 120V voltage, ethidium bromide staining, gel imaging system detects, and determines whether and increases successfully according to the size that has that it's too late of band.
5, digestion with restriction enzyme:
The reaction system that enzyme is cut is: ultrapure water 3.6 μ L, 10 × bufferG, 0.5 μ L, restriction endonuclease 4U, PCR product 1 μ L.Cut 16h in 37 ℃ of enzymes.
6, polyacrylamide gel electrophoresis detects enzyme and cuts product:
Adopt the polyacrylamide that concentration is 40%, degree of crosslinking is 19:1, compound concentration is the gel of 16% polyacrylamide, and system is: polyacrylamide 18 mL, 5 × TBE, 9 mL, ultrapure water 18 mL, 10%AP 350 μ L, TEMED 35 μ L.First 300V electrophoresis 10min, then 120V electrophoresis 5.5h.
7, silver staining display electrophoresis result, according to the size of band and number result of determination:
It is as follows that silver dyes step: ultrapure water rinsing twice, the dehydrated alcohol rinsing 10min that concentration is 10%; The nitric acid rinsing 10min of ultrapure water rinsing twice, 1%; The Silver Nitrate of ultrapure water rinsing twice, 0.2% adds 750 μ L formaldehyde lucifuge rinsing 20min; The sodium hydroxide of ultrapure water rinsing twice, 3% adds the rinsing of 1mL formaldehyde until there is clear band; Ultrapure water rinsing twice, 3% acetic acid color development stopping; Change ultrapure water, Taking Pictures recording analytical results.
8, genotype identification:
Identify the genotype of Different Individual according to method of the present invention, result shows: 91 the golden plumage hens (commercial generation) that detect are golden plumage hemizygote (Z entirely
sw), accuracy rate is 100%; 71 silver-colored plumage cocks (commercial generation) are silver-colored plumage heterozygote (Z entirely
sz
s), accuracy rate is 100%; In 65 silver-colored plumage hens (father and mother's generation), 64 is silver-colored plumage hemizygote (Z
sw), 1 is golden plumage hemizygote (Z
sw), accuracy rate is 98.5%; 71 golden plumage cocks (father and mother's generation) are golden plumage homozygote (Z entirely
sz
s), accuracy rate is 100%.
Embodiment 2:
A molecular assay method for chicken gold and silver plumage loci gene type, the steps include:
1. the preparation of sample and preservation:
Gather the red father and mother in capital of the exit of valley, Jingzhou City of Hubei China province Qin Ye company limited for male and female chicken and commercial generation chick (male and female chicken) blood sample thereof, the anti-freezing of citric acid antithrombotics, puts ice chest and takes back laboratory and be stored in-20 ℃ of refrigerators for subsequent use.Get 60 μ L anti-freezing blood samples, adopt conventional phenol-chloroform extraction method to extract the DNA in blood sample, DNA sample retention is for subsequent use in 4 ℃ of refrigerators.
2, design of primers: utilize software primer premier 5.0, according to the DNA sequence dna design primer pair M4-S/A of chicken SLC45A2 gene, primer length is 22bp:M4-S:5'ATCCCATTATCGCTGTCTGCAT 3', M4-A:5'AATCCGTGAAGAAGAGCATAGT 3';
A DNA sequence dna for separation, its sequence is the nucleotide sequence shown in SEQ ID NO.1.
3, pcr amplification:
Set up 15 μ L systems take primer pair M4-S/A as amplimer as follows: 1.5 μ L 10 × EasyTaq Buffer (+Mg
2+), the positive anti-primer of 0.3 μ L (10 μ M), the dNTP (2.5mM) of 0.15 μ L, the Taq polysaccharase of 0.5U, the genomic dna of 1 μ L, adds 11.65 μ L ultrapure water polishing to 15 μ L; Response procedures is 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, and 53 ℃ of annealing 30s, 72 ℃ are extended 30s, 35 circulations, 72 ℃ are extended 5min again, and 15 ℃, 1min, saves backup at 4 ℃.
4, electrophoresis detection PCR product
Get 6 μ L PCR products, add 3 μ l 6 × Loading Buffer, preparation concentration is the sepharose of 1.2 %, electrophoresis 40min under the voltage of 120V, ethidium bromide staining, gel imaging system detects, and determines whether and increases successfully according to the size that has that it's too late of band.
5, digestion with restriction enzyme
The reaction system that enzyme is cut is: ultrapure water 3.6 μ L, 10 × bufferG, 0.5 μ L, restriction endonuclease 4U, PCR product 1 μ L.Cut 16h in 37 ℃ of enzymes.
6, polyacrylamide gel electrophoresis detects enzyme and cuts product
The polyacrylamide that employing 40%, degree of crosslinking are 19:1, the gel of preparation 16%, system is: polyacrylamide 18 mL, 5 × TBE, 9 mL, ultrapure water 18 mL, 10%AP 350 μ L, TEMED 35 μ L.First 300V electrophoresis 10min, then 120V electrophoresis 5.5h.
7, silver staining display electrophoresis result, according to the size of band and number result of determination
It is as follows that silver dyes step: ultrapure water rinsing twice, 10% dehydrated alcohol rinsing 10min; Ultrapure water rinsing twice, 1% nitric acid rinsing 10min; Ultrapure water rinsing twice, 0.2% Silver Nitrate adds 750 μ L formaldehyde lucifuge rinsing 20min; Ultrapure water rinsing twice, 3% sodium hydroxide adds the rinsing of 1mL formaldehyde until there is clear band; Ultrapure water rinsing twice, 3% acetic acid color development stopping, changes ultrapure water.Taking Pictures recording analytical results.
8, genotype identification.
Identify the genotype of Different Individual according to method of the present invention, result shows: 42 the golden plumage hens (commercial generation) that detect are golden plumage hemizygote (Z entirely
sw), accuracy rate is 100%; 37 silver-colored plumage cocks (commercial generation) are silver-colored plumage heterozygote (Z entirely
sz
s), accuracy rate is 100%; 40 silver-colored plumage hens (father and mother's generation) are silver-colored plumage hemizygote (Z entirely
sw), accuracy rate is 100%; 40 golden plumage cocks (father and mother's generation) are golden plumage homozygote (Z entirely
sz
s), accuracy rate is 100%.
Embodiment 3:
A molecular assay method for chicken gold and silver plumage loci gene type, the steps include:
1. the preparation of sample and preservation:
Gather Hubei China and economize the scape sun chicken of Enshi City (scape sun chicken plumage look: no matter chick or Adult Chicken all have two types, one is grain fiber crops, and one is jute.Grain fiber crops male and female chicken Xiang Yu, primaries, main tail feather end feather are black, and other are grain fiber crops looks, back of the body plumage, abdomen plumage, and saddle feather is shallow grain fiber crops look.The glow of jute plumage cock plumage look, Xiang Yu, primaries, main tail feather end are black, and other positions such as back of the body plumage, abdomen plumage, saddle feather are jute look, and hen whole body feather is pale yellow numb look.) blood sample, the anti-freezing of citric acid antithrombotics, puts ice chest and takes back laboratory and be stored in-20 ℃ of refrigerators for subsequent use.Get 60 μ L anti-freezing blood samples, adopt conventional phenol-chloroform extraction method to extract the DNA in blood sample, DNA sample retention is for subsequent use in 4 ℃ of refrigerators.
2, design of primers: utilize software primer premier 5.0, according to the DNA sequence dna design primer pair M4-S/A of chicken SLC45A2 gene, primer length is 22bp:M4-S:5'ATCCCATTATCGCTGTCTGCAT 3', M4-A:5'AATCCGTGAAGAAGAGCATAGT 3'.A DNA sequence dna for separation, its sequence is the nucleotide sequence shown in SEQ ID NO.1.
3,3, pcr amplification:
Set up 15 μ L systems take primer pair M4-S/A as amplimer as follows: 1.5 μ L 10 × EasyTaq Buffer (+Mg
2+), the positive anti-primer of 0.3 μ L (10 μ M), the dNTP (2.5mM) of 0.15 μ L, the Taq polysaccharase of 0.5U, the genomic dna of 1 μ L, adds 11.65 μ L ultrapure water polishing to 15 μ L; Response procedures is 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, and 53 ℃ of annealing 30s, 72 ℃ are extended 30s, 35 circulations, 72 ℃ are extended 5min again, and 15 ℃, 1min, saves backup at 4 ℃;
4, electrophoresis detection PCR product:
Get 6 μ L PCR products, add 3 μ l 6 × Loading Buffer, the agarose gel electrophoresis of 1.2 %, 120V, 40min, ethidium bromide staining, gel imaging system (Bio Rad Laboratories) detects, and determines whether and increases successfully according to the size that has that it's too late of band.
5, digestion with restriction enzyme:
The reaction system that enzyme is cut is: ultrapure water 3.6 μ L, 10 × bufferG, 0.5 μ L, restriction endonuclease 4U, PCR product 1 μ L.Cut 16h in 37 ℃ of enzymes.
6, polyacrylamide gel electrophoresis detects enzyme and cuts product:
The polyacrylamide of employing 40%, 19:1, the gel of preparation 16%, system is: polyacrylamide 18 mL, 5 × TBE, 9 mL, ultrapure water 18 mL, 10%AP 350 μ L, TEMED 35 μ L.First 300V electrophoresis 10min, then 120V electrophoresis 5.5h.
7, silver staining display electrophoresis result, according to the size of band and number result of determination:
It is as follows that silver dyes step: ultrapure water rinsing twice, 10% dehydrated alcohol rinsing 10min; Ultrapure water rinsing twice, 1% nitric acid rinsing 10min; Ultrapure water rinsing twice, 0.2% Silver Nitrate adds 750 μ L formaldehyde lucifuge rinsing 20min; Ultrapure water rinsing twice, 3% sodium hydroxide adds the rinsing of 1mL formaldehyde until there is clear band; Ultrapure water rinsing twice, 3% acetic acid color development stopping; Change ultrapure water, Taking Pictures recording analytical results.
8, genotype identification.
Identify the genotype of Different Individual according to method of the present invention, result shows: 17 jute cocks that detect are golden plumage homozygote (Z entirely
sz
s); 24 jute hens are golden plumage hemizygote (Z entirely
sw); In 27 grain fiber crops cocks, 13 is silver-colored plumage heterozygote (Z
sz
s), 13 is silver-colored plumage homozygote (Z
sz
s), 1 is golden plumage homozygote (Z
sz
s); In 30 grain fiber crops hens, 23 is silver-colored plumage hemizygote (Z
sw), 7 is golden plumage hemizygote (Z
sw).
Embodiment 4:
A molecular assay method for chicken gold and silver plumage loci gene type, the steps include:
1. the preparation of sample and preservation:
Gather Hubei China province Anlu City glad magnificent chicken blood sample, the anti-freezing of citric acid antithrombotics, puts ice chest and takes back laboratory and be stored in-20 ℃ of refrigerators for subsequent use.Get 60 μ L anti-freezing blood samples, adopt conventional phenol-chloroform extraction method to extract the DNA in blood sample, DNA sample retention is for subsequent use in 4 ℃ of refrigerators.
2, design of primers: utilize software primer premier 5.0, according to chicken
sLC45A2the DNA sequence dna design primer pair M4-S/A of gene, primer length is 22bp:M4-S:5'ATCCCATTATCGCTGTCTGCAT 3', M4-A:5'AATCCGTGAAGAAGAGCATAGT 3'; A DNA sequence dna for separation, its sequence is the nucleotide sequence shown in SEQ ID NO.1.
3, pcr amplification:
Set up 15 μ L systems take primer pair M4-S/A as amplimer as follows: 1.5 μ L 10 × EasyTaq Buffer (+Mg
2+), the positive anti-primer of 0.3 μ L (10 μ M), the dNTP (2.5mM) of 0.15 μ L, the Taq polysaccharase of 0.5U, the genomic dna of 1 μ L, adds 11.65 μ L ultrapure water polishing to 15 μ L; Response procedures is 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, and 53 ℃ of annealing 30s, 72 ℃ are extended 30s, 35 circulations, 72 ℃ are extended 5min again, and 15 ℃, 1min, saves backup at 4 ℃;
4, electrophoresis detection PCR product:
Get 6 μ L PCR products, add 3 μ l 6 × Loading Buffer, the agarose gel electrophoresis of 1.2 %, 120V, 40min, ethidium bromide staining, gel imaging system detects, and determines whether and increases successfully according to the size that has that it's too late of band.
5, digestion with restriction enzyme:
The reaction system that enzyme is cut is: ultrapure water 3.6 μ L, 10 × bufferG, 0.5 μ L
, restriction endonuclease 4U, PCR product 1 μ L.Cut 16h in 37 ℃ of enzymes.
6, polyacrylamide gel electrophoresis detects enzyme and cuts product
The polyacrylamide of employing 40%, 19:1, the gel of preparation 16%, system is: polyacrylamide 18 mL, 5 × TBE, 9 mL, ultrapure water 18 mL, 10%AP 350 μ L, TEMED 35 μ L.First 300V electrophoresis 10min, then 120V electrophoresis 5.5h.
7, silver staining display electrophoresis result, according to the size of band and number result of determination:
It is as follows that silver dyes step: ultrapure water rinsing twice, 10% dehydrated alcohol rinsing 10min; Ultrapure water rinsing twice, 1% nitric acid rinsing 10min; Ultrapure water rinsing twice, 0.2% Silver Nitrate adds 750 μ L formaldehyde lucifuge rinsing 20min; Ultrapure water rinsing twice, 3% sodium hydroxide adds the rinsing of 1mL formaldehyde until there is clear band; Ultrapure water rinsing twice, 3% acetic acid color development stopping; Change ultrapure water, Taking Pictures recording analytical results.
8, genotype identification:
Identify the genotype of Different Individual according to method of the present invention, result shows: 40 glad magnificent chickens that detect are all golden plumage homozygote (Z
sz
s) or golden plumage hemizygote (Z
sw).
Embodiment 5:
A molecular assay method for chicken gold and silver plumage loci gene type, the steps include:
1. the preparation of sample and preservation:
Gather Yun county yang white plumage black-bone chicken cock (originate in Yun County, Hubei Province, plumage look be complete white, is recessive white feather homozygote) seminal fluid of Hubei China province Shiyan City, preserve liquid preservation with seminal fluid, put ice chest and take back laboratory and be stored in-20 ℃ of refrigerators for subsequent use.Get 60 μ L anti-freezing blood samples, adopt conventional phenol-chloroform extraction method to extract the DNA in blood sample, DNA sample retention is for subsequent use in 4 ℃ of refrigerators.
2, design of primers: utilize software primer premier 5.0, according to chicken
sLC45A2the DNA sequence dna design primer pair M4-S/A of gene, primer length is 22bp:M4-S:5'ATCCCATTATCGCTGTCTGCAT 3', M4-A:5'AATCCGTGAAGAAGAGCATAGT 3'; A DNA sequence dna for separation, its sequence is the nucleotide sequence shown in SEQ ID NO.1.
3, pcr amplification:
Set up 15 μ L systems take primer pair M4-S/A as amplimer as follows: 1.5 μ L 10 × EasyTaq Buffer (+Mg
2+), the positive anti-primer of 0.3 μ L (10 μ M), the dNTP (2.5mM) of 0.15 μ L, the Taq polysaccharase of 0.5U, the genomic dna of 1 μ L, adds 11.65 μ L ultrapure water polishing to 15 μ L; Response procedures is 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, and 53 ℃ of annealing 30s, 72 ℃ are extended 30s, 35 circulations, 72 ℃ are extended 5min again, and 15 ℃, 1min, saves backup at 4 ℃.
4, electrophoresis detection PCR product:
Get 6 μ L PCR products, add 3 μ l 6 × Loading Buffer, the agarose gel electrophoresis of 1.2 %, 120V, 40min, ethidium bromide staining, gel imaging system detects, and determines whether and increases successfully according to the size that has that it's too late of band.
5, digestion with restriction enzyme:
The reaction system that enzyme is cut is: ultrapure water 3.6 μ L, 10 × bufferG, 0.5 μ L, restriction endonuclease 4U, PCR product 1 μ L.Cut 16h in 37 ℃ of enzymes.
6, polyacrylamide gel electrophoresis detects enzyme and cuts product:
The polyacrylamide of employing 40%, 19:1, the gel of preparation 16%, system is: polyacrylamide 18 mL, 5 × TBE, 9 mL, ultrapure water 18 mL, 10%AP 350 μ L, TEMED 35 μ L.First 300V electrophoresis 10min, then 120V electrophoresis 5.5h.
7, silver staining display electrophoresis result, according to the size of band and number result of determination:
It is as follows that silver dyes step: ultrapure water rinsing twice, 10% dehydrated alcohol rinsing 10min; Ultrapure water rinsing twice, 1% nitric acid rinsing 10min; Ultrapure water rinsing twice, 0.2% Silver Nitrate adds 750 μ L formaldehyde lucifuge rinsing 20min; Ultrapure water rinsing twice, 3% sodium hydroxide adds the rinsing of 1mL formaldehyde until there is clear band; Ultrapure water rinsing twice, 3% acetic acid color development stopping; Change ultrapure water, Taking Pictures recording analytical results.
8, genotype identification:
Identify the genotype of Different Individual according to method of the present invention, result shows: in 36 male Yun county yang white plumage black-bone chickens that detect, 33 is golden plumage homozygote (Z
sz
s), 3 is silver-colored plumage heterozygote (Z
sz
s).
SEQ ID NO.1
<110> Hua Zhong Agriculture University
The molecular assay method of a <120> chicken gold and silver plumage loci gene type
The molecular assay method of a <130> chicken gold and silver plumage loci gene type
<160> 1
<170> PatentIn version 3.1
<210> 1
<211> 80
<212> DNA
<213> chicken
<400> 1
atcccattat cgctgtctgt gtgtgagcca cctctttgga tggatggctt tcctgtccaa 60
catgctcttc ttcacggatt 80
Claims (2)
1. a DNA sequence dna for separation, its sequence is the nucleotide sequence shown in SEQ ID NO.1.
2. the molecular assay method of a kind of chicken gold and silver plumage loci gene type claimed in claim 1, the steps include:
Utilize software primer premier 5.0, according to chicken
sLC45A2the DNA sequence dna design primer pair M4-S/A of gene, primer length is 22bp, primer sequence is: M4-S:5'ATCCCATTATCGCTGTCTGCAT 3', M4-A:5'AATCCGTGAAGAAGAGCATAGT 3';
Set up 15 μ L systems take primer pair M4-S/A as amplimer as follows: 1.5 μ L 10 × EasyTaq Buffer (+Mg
2+), the positive anti-primer of 0.3 μ L (10 μ M), the dNTP(2.5mM of 0.15 μ L), the Taq polysaccharase of 0.5U, the genomic dna of 1 μ L, adds ultrapure water polishing to 15 μ L; Response procedures is 94 ℃ of denaturation 5min, 94 ℃ of sex change 30s, and 53 ℃ of annealing 30s, 72 ℃ are extended 30s, 35 circulations, 72 ℃ are extended 5min again, and 15 ℃, 1min, saves backup at 4 ℃;
Electrophoresis detection PCR product: get 6 μ L PCR products, add 3 μ L 6 × Loading Buffer, preparation concentration is the sepharose of 1.2 %, after point sample, electrophoresis 40min under 120V voltage, ethidium bromide staining, gel imaging system detects, and determines whether and increases successfully according to the size that has that it's too late of band;
Digestion with restriction enzyme: the reaction system that enzyme is cut is: ultrapure water 3.6 μ L, 10 × bufferG, 0.5 μ L, restriction endonuclease 4U, PCR product 1 μ L, cuts 16h in 37 ℃ of enzymes;
Polyacrylamide gel electrophoresis detects enzyme and cuts product: adopt the polyacrylamide that concentration is 40%, degree of crosslinking is 19:1, compound concentration is 16% polyacrylamide gel, system is: polyacrylamide 18 mL, 5 × TBE, 9 mL, ultrapure water 18 mL, 10%AP 350 μ L, TEMED 35 μ L, first 300V electrophoresis 10min, then 120V electrophoresis 5.5h;
Silver staining display electrophoresis result, according to the size of band and number result of determination: it is as follows that silver dyes step: the dehydrated alcohol rinsing 10min of ultrapure water rinsing twice, 10%; The nitric acid rinsing 10min of ultrapure water rinsing twice, 1%; The Silver Nitrate of ultrapure water rinsing twice, 0.2% adds 750 μ L formaldehyde lucifuge rinsing 20min; The sodium hydroxide of ultrapure water rinsing twice, 3% adds the rinsing of 1mL formaldehyde until there is clear band; Ultrapure water rinsing twice, 3% acetic acid color development stopping; Change ultrapure water, Taking Pictures recording analytical results;
In cock, band is that 64bp and 16bp are golden plumage homozygote: Z
sz
s; Band is that 64bp, 55bp and 16bp are silver-colored plumage heterozygote: Z
sz
s; Band is that 55bp and 16bp are silver-colored plumage homozygote: Z
sz
s;
In hen, band is that 64bp and 16bp are golden plumage hemizygote: Z
sw; Band is that 55bp and 16bp are silver-colored plumage hemizygote: Z
sw.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410032115.9A CN103789305A (en) | 2014-01-23 | 2014-01-23 | Molecular identification method for gene type of gold-silver feather locus of chicken |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410032115.9A CN103789305A (en) | 2014-01-23 | 2014-01-23 | Molecular identification method for gene type of gold-silver feather locus of chicken |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103789305A true CN103789305A (en) | 2014-05-14 |
Family
ID=50665362
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410032115.9A Pending CN103789305A (en) | 2014-01-23 | 2014-01-23 | Molecular identification method for gene type of gold-silver feather locus of chicken |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103789305A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104962636A (en) * | 2015-07-07 | 2015-10-07 | 华南农业大学 | Wenchang chicken white spot phenotype related molecular marker and application of molecular marker |
CN110419506A (en) * | 2019-07-31 | 2019-11-08 | 北京市华都峪口禽业有限责任公司 | Red plumage chicken produces the corss combination method of rouge and powder shell egg |
CN114395632A (en) * | 2021-12-28 | 2022-04-26 | 河北农业大学 | Primer pair, kit and detection method for detecting genotype of honeysuckle locus of chicken |
CN115141891A (en) * | 2022-06-30 | 2022-10-04 | 河北农业大学 | KASP primer group for identifying chicken honeysuckle feather character molecular marker and application |
-
2014
- 2014-01-23 CN CN201410032115.9A patent/CN103789305A/en active Pending
Non-Patent Citations (7)
Title |
---|
F.M.AUSUBE著: "《精编分子生物学实验指南 第5版》", 31 December 2008, 化学工业出版社 * |
GUNNARSSON ET AL.: "GenBank:DQ900699.1", 《NCBI》 * |
ULRIKA GUNNARSSON ET AL.: "Mutations in SLC45A2 Cause Plumage Color Variation in Chicken and Japanese Quail", 《GENETICS》 * |
童大跃等主编: "《新编法医物证》", 31 December 2013, 中国医药科技出版社 * |
郭军 等: "鸡羽色性状基因定位的研究进展", 《中国畜牧兽医》 * |
陈丽静编: "《生物技术实验流程》", 31 December 2012, 中国农业大学出版社 * |
黄留玉主编: "《遗传标记在实验动物遗传质量控制中的应用》", 31 December 2011, 军事医学出版社 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104962636A (en) * | 2015-07-07 | 2015-10-07 | 华南农业大学 | Wenchang chicken white spot phenotype related molecular marker and application of molecular marker |
CN104962636B (en) * | 2015-07-07 | 2017-12-26 | 华南农业大学 | A kind of Wenchang Chicken hemp phenotype related molecular marker and its application |
CN110419506A (en) * | 2019-07-31 | 2019-11-08 | 北京市华都峪口禽业有限责任公司 | Red plumage chicken produces the corss combination method of rouge and powder shell egg |
CN110419506B (en) * | 2019-07-31 | 2022-01-14 | 北京市华都峪口禽业有限责任公司 | Hybridization matching method for laying red pink shell eggs by red feather chickens |
CN114395632A (en) * | 2021-12-28 | 2022-04-26 | 河北农业大学 | Primer pair, kit and detection method for detecting genotype of honeysuckle locus of chicken |
CN115141891A (en) * | 2022-06-30 | 2022-10-04 | 河北农业大学 | KASP primer group for identifying chicken honeysuckle feather character molecular marker and application |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101619354B (en) | Method for identifying fast and slow feather molecules of chickens | |
CN101696452B (en) | Method for identifying molecules of recessive white feather genes of chicken | |
Kulibaba et al. | Prolactin and growth hormone gene polymorphisms in chicken lines of Ukrainian selection | |
CN102134593B (en) | Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis | |
CN103583470B (en) | A kind of breeding method of the blue or green shank and recessive white feather chicken strain based on molecule assisted Selection | |
CN104293905B (en) | A kind of primer for detecting the blue or green chain SNP site genotype of shin proterties of chicken, test kit and detection method | |
CN103387980A (en) | Microsatellite loci of portunus trituberculatus and primer | |
CN103789305A (en) | Molecular identification method for gene type of gold-silver feather locus of chicken | |
CN102352410B (en) | Method for rapidly improving number of eggs produced by Bian chicken through DNA (deoxyribonucleic acid) labeling | |
CN106811540A (en) | It is a kind of to identify female ussuriensis, male individual microsatellite marker and specific primer and application | |
CN103320517A (en) | Primer and method for quickly detecting gender difference of juvenile fishes of fugu rubripes | |
CN111206082B (en) | Sex-specific molecular marker primer and kit for Trachinotus ovatus and application of sex-specific molecular marker primer and kit | |
CN102912017B (en) | Method for quickly and accurately identifying northern snakehead, Taiwan snakehead and hybrid snakehead | |
CN102321750A (en) | Method for rapidly screening bian chicken weight gain degree by molecular marking | |
CN105331724A (en) | Cynoglossus semilaevis sex chromosome-linked DNA segments and application thereof | |
CN112080570A (en) | KASP labeled primer combination for identifying hybrid stichopus japonicus in Zhongrussia and application thereof | |
CN103602744B (en) | Primers, kit and detection method for detecting gene type of dominant white feather site of chicken | |
CN105671170A (en) | Primer combination for identifying creeping character of chicken and application thereof | |
CN108570508A (en) | A kind of and the relevant molecular labeling of beak deformity character and its application | |
CN108893547A (en) | It is a kind of for the primer pair of the quick Sex judging of squab, kit and quick Sex judging method | |
CN103181361B (en) | Method for breeding Ili horses, and kit employed in method | |
CN110564872B (en) | Molecular marking method for predicting and identifying breeder cocks' ability | |
CN102719567A (en) | PCR (Polymerase Chain Reaction) detection primer and method for H120 strain of avian infectious bronchitis virus | |
CN103789445B (en) | Molecular genetic marker for weight of jinghai yellow chicken at 12 weeks and application thereof | |
CN104593358A (en) | Primer for identifying Shaobai chicken as well as application and method for quickly identifying Shaobai chicken |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140514 |
|
RJ01 | Rejection of invention patent application after publication |