CN103740721A

CN103740721A - Plant coleoptile specific expression promoter and application thereof

Info

Publication number: CN103740721A
Application number: CN201310752156.0A
Authority: CN
Inventors: 魏鹏程; 杨剑波; 李莉; 许蓉芳; 李�浩; 秦瑞英; 杨亚春; 宋丰顺; 张银萍; 倪大虎
Original assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Current assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences; Anhui Academy of Agricultural Sciences
Priority date: 2013-12-30
Filing date: 2013-12-30
Publication date: 2014-04-23
Anticipated expiration: 2033-12-30
Also published as: CN103740721B

Abstract

The invention provides a plant coleoptile specific expression promoter and an application thereof. The invention also provides an expression box containing the promoter, a plant expression vector, a host bacterium and a transformant. Specifically, the promoter is applied to plant transgenic engineering. The promoter provided by the invention can start the specific expression of an exogenous gene in plant coleoptiles, is suitable for any plants with seeds having coleoptiles, and particularly can drive the specific expression of the exogenous gene in rice coleoptiles, so that the plant coleoptile specific expression promoter can be used for improving the growth characteristics of rice, and then a perfect rice species with better quality can be cultured.

Description

A kind of plant embryos bud scale specific expressing promoter and application thereof

Technical field

The present invention relates to biotechnology and plant gene engineering technology field.Particularly, the present invention relates to a kind of plant embryo sheath genetic expression promotor and application thereof, this promotor can drive target gene to express in coleoptile in Transgenic Rice adjustment and control system.

Background technology

Paddy rice is one of topmost food crop, and more than 1/3rd population is all take rice as staple food in the world.Along with expanding economy, in global range, yield of brown rice and quality have been proposed to more and more higher requirement.Thereby utilize the whole bag of tricks to improve rice yield, improvement rice quality, there is the meaning of positive important.By molecular biology and engineered means, go research and Crop Improvement in agriculture production, to there is good application prospect.Since nineteen eighty-three obtains the first strain transgene tobacco, in the time of nearly 30 years, the research of plant genetic engineering has obtained the progress of advancing by leaps and bounds, and has become in modern biology and thremmatology an important method and technology.

Growing of higher organism is that different genes is expressed in order and synergistic process on time and space.The unlatching of genetic expression in this process, close, the height of expressive site and expression amount all will be subject to meticulous regulation and control, the expression regulation of gene is a multi-level complex process, be subject to different adjusting controlling factors, also in multistage level, realize, before transcribing, transcribe, transcribe after, translate, translate rear five levels.Although genetic expression is Multi-regulation system in higher organism, the regulation and control on transcriptional level are links of most critical.Because the initial and occurrence frequency of transcribing is a step the most basic in genetic expression link.Promotor is as an important controlling element on transcriptional level, be the final action target of numerous transcription factors and RNA polymerase, the structure, function, binding mode etc. of therefore furtheing investigate promotor are significant for the basic theories problem of answering in molecular biology.Therefore, people are when some new transformation technologies of exploitation are as organoid conversion, directed conversion etc., and the spatial and temporal expression of more and more focusing on by controlling goal gene reaches corresponding conversion object.Investigators replace constitutive promoter by finding more efficiently tissue, organ specificity expression promotor or abduction delivering promotor, to regulating plant genetic expression better.Just because of this, the research status of tissue-specific promoter in plant genetic engineering is also more and more outstanding.

Coleoptile is the protective tissue of crop cotyledon reply early growth period adverse circumstance, completes differentiation in mature seed.In the seed germination later stage, along with elongation and the expansion of cell, coleoptile extends and makes the seed growth of breaking ground, and protects plumule basset and resist environment stress.Because coleoptile is significant at the plant growth initial stage, existing a large amount of mechanism research reports about coleoptile elongation and physiological response.The discoveries such as Wang Wei wheat bud scale length and drought resistance coefficient under drought stress are utmost point marked positive correlation, can be used as weighing the index of drought resistance of wheat; And in the Drought-resistant Breeding of wheat by from generation to generation drought resisting genotype being screened in early days, obtained good result.The researchs such as Zhou little Mei show, in Rice Seedlings Under Osmotic Stress body, the rising of putrescine (Put), spermidine (Spd) and spermine (Spm) content is conducive to improve the Osmotic Stress Tolerance ability of rice seedling, and the drought resistance of Bud Bursting Period in Rice can be reacted the drought resistance of this kind to a certain extent.On paddy rice, there are some researches show that carrying out selecting when Direct-seeding Rice is produced the kind of long coleoptile type be effective profit, but reported there are no more deep research.

Paddy rice is one of most important food crop in the world, is also the model plant of gramineous crop functional genomics research.Because the coleoptile of rice seedling can not only be grown in wet air, also can in water layer, grow, and growth is faster.This specific character that EMBRYO IN RICE bud scale has is used in rice cropping, and as the area late rice seedling of China double cropping of rice, often directly in retaining Tanaka sowing, California, USA still keeps with aircraft the custom in retaining Tanaka sowing so far.Because coleoptile has broken up in embryo, after sprouting, no longer carry out cell fission propagation, be the good material of research growth mechanism, therefore, to the further investigation of EMBRYO IN RICE bud scale different expression gene, tool is of great significance.

Summary of the invention

The object of this invention is to provide a kind of drive foreign gene in EMBRYO IN RICE bud scale specific expressed promotor, obtain the transformant that contains this promoter sequence and the application of this promotor.Wherein, related " plant " refers to monocotyledons herein, and for example paddy rice, wheat, corn, barley, Chinese sorghum or oat, be preferably paddy rice.

To achieve these goals, on the one hand, the invention provides a kind of plant embryos bud scale specific expressing promoter, described plant embryos bud scale specific expressing promoter comprises the DNA sequence dna shown in SEQ ID No:1 in sequence table.In sequence table, the DNA sequence dna shown in SEQ ID No:1, for deriving from the EMBRYO IN RICE bud scale specific expression promoter of Japanese fine paddy rice (Oryza sativa L cv.Nipponbare), is called PCole1 or promotor PCole1 herein.

Preferably, the DNA sequence dna of plant embryos bud scale specific expressing promoter provided by the invention is the sequence shown in SEQ ID No:1, i.e. PCole1 or promotor PCole1.

On the other hand, the invention provides a kind of plant embryos bud scale specific expressing promoter, the DNA sequence dna shown in its DNA sequence dna and SEQ ID No:1 has at least 80% homology; Or described plant embryos bud scale specific expressing promoter is to add, replace, insert or delete mutant or allelotrope or the derivative that one or more Nucleotide generate in the DNA sequence dna shown in SEQ ID No:1; Or described plant embryos bud scale specific expressing promoter has the product with the DNA sequence dna hybridization shown in SEQ ID No:1.DNA sequence dna shown in these plant embryos bud scale specific expressing promoter sequences and SEQ ID No:1 has identical function, drives target gene specific expressed in plant embryos bud scale.

On the other hand, the present invention also provides a kind of expression cassette that comprises above-mentioned plant embryos bud scale specific expressing promoter.

Another aspect, the present invention also provides a kind of recombinant expression vector, described recombinant expression vector comprises above-mentioned plant embryos bud scale specific expressing promoter, and in described recombinant expression vector, described plant embryos bud scale specific expressing promoter is connected in the upstream of gene order to be expressed; Preferably, described gene to be expressed is Gus gene, described recombinant expression vector is pCAMBIA1391-PCole1, this recombinant expression vector is to be that PCole1 or promotor PCole1 are implemented in the recombinant expression vector obtaining in pCAMBIA1391 by the sequence shown in SEQ ID No:1, is called pCAMBIA1391-PCole1 herein.

On the other hand, the present invention also provides a kind of Host Strains, and described Host Strains comprises above-mentioned plant embryos bud scale specific expressing promoter provided by the invention, above-mentioned expression cassette or above-mentioned recombinant expression vector; Preferably, described Host Strains is agrobacterium tumefaciens.

On the other hand, the invention provides a kind of transformant, described transformant comprises above-mentioned plant embryos bud scale specific expressing promoter provided by the invention, above-mentioned expression cassette, above-mentioned recombinant expression vector or above-mentioned Host Strains.Wherein, described transformant is preferably transgenic cell line, callus or plant.

Again on the one hand, the invention provides above-mentioned plant embryos bud scale specific expressing promoter in the application of cultivating in transgenic plant.Described application comprise above-mentioned plant embryos bud scale specific expressing promoter provided by the invention is connected in to carrier gene order upstream to be expressed (for example, before described promoter sequence is placed in to target gene), thereby structure recombinant expression vector, is transformed into described recombinant expression vector in vegetable cell, tissue or organ and cultivates.Gene to be expressed is that target gene comprises that gene and plant nutrition for improveing plant quality and accumulation absorb relevant gene.

And preferably, described application can be for improvement plant embryos bud scale proterties, and described plant is monocotyledons, and for example paddy rice, wheat, corn, barley, Chinese sorghum or oat, be preferably paddy rice; More preferably, described gene to be expressed is Gus gene, and described recombinant expression vector is pCAMBIA1391-PCole1, for improvement EMBRYO IN RICE bud scale shape.

The DNA sequence dna of the promotor providing in the present invention is (with identical in SEQ ID No:1 in sequence table):

GCGTGTTGCGGAGTATGAGGTCCCTTTTTGGGCTTAAAACTTAAAAGTCCTTTGAGCCGTCGAA

TCCTTTTTGTGGAGAAGCAATGGCTAGTAAGTTGTAACCTCTATCCAGTTCATATACTGGTAGTTT

ACAAGCGGGATTGATTGTTCCACTTAGATATTTTTTTCAGCTAATATTCTAAAAACTTTCCACACT

TTACTGGGTTAATCATCATCATGTAATCCTGAGTTTAAATGGAACAATTATCTGCATTGAAATTAG

TTAGAGCAGGTACAATAGCAGGCTATAAGCCAGCTGTAAACATATTTTAAGGAGATAAATAAGG

AGAGAAGAGCAGCGGGCTACATATTTGTAGTCAGCTGTAGTACGGACTCTAAGACGCAGTGTGT

ATATGACAGGTGGGACCATGTATTAATAGTATAGTATGTAACTATTGTATAAATGAGTTATTAGATT

GACTATAGATGAATTGGAGCTAGTAGTTGGCTATACTATTAATCTTGCTCTTATCGATGCACAGGT

AATAGTTGAACTAACTGCACCTATAATACCTTGTTCTTCTAGACTTGCTCGAAATTTAGGACTATC

TTCAATTAAAAGTATGGTGTAACACCTTTTATGCAATAGTACTCCGTCGACCGAAAAAATATGGA

AGAATACAATTTTTAGCTAAAATTTATCATAGTTTAATACGCCGAATTGACGGCCTAGTAAATCTA

TATCCCTTTAAAAGAAAAGAAATTAGAAATAAAGTAGTGATGGTAATAGTGAATTTGCTACTTCA

CCTACTGCATTGAGATTTTTGCAAGTTAACTCCTGAACTTTTTAATATTAAAAAGATCGAATCTA

AATGGGTAGCTCCTAAAAAAAATAAAAGTAGGATGAATATTCTCTATAGCAAAAAGTGAAAGTA

CATTAATACATTATTTTATCTGTAGCGAGCATGGACATTTAGATGGTTTCTAAAAATTATATAGTAT

TTTGTGTTTATCATGATTTTTTCTTAGGAAAACAACGCTTACTACACGTACTATTTTCAGAATGGG

CTTTCTTTATAGAAGAAAAATAATCCATCCTTTCGGAGGATCGGTTGTGGTCGTTAGCAGGCATT

GCTTCCTTTAGGGATTTGTTGAAAGTGTAGCGTGGCTTTGCCCTCTCCCGCTGATTGGAGTAGC

GTTACCTGTCGTACGAGTTATATTTTTCTTCCTTGGTTGTTTTTTTTCTCTCCTTGGTATAAGTTGG

TCTAGCTAATTACATTGAGTAATATATTGACGTATAATCTTTTTCGCGTTCATGAAAAAATTATAGA

AAAATAATTTTGGAGCGGAAACTAGTCTCCGCAGGAACTCTTTGATTTCTGACGGACTCAACGC

CTGCGGGCTGCAGCTTCTCCCTGCTATCCTCCTTCCCTTTTGATATCGGGTCGAACTTTCCAGGA

CCGGTGCTGCGCATGCAAGTGATCTTCTGGTTTACTAGATGTTCACATTTTCTCCTTTCCAGCCA

CGGCGAAATGTCAGTCCATCTTCGCCGGTTGACTAGCACCGGTCGCCAAACTTCAAGGAAACC

GACGTGCAGGATTCTTTCGTTGCCATGTTGTCACTCACCCGTGCCACCATCGCGCAGCAGAATC

CTTCAGCGGCAAACCAAGAAACGACATCCCGTTGAAAGGTCAGGTCAACCGTAATCCTCATCA

CGGCATCAGTGCATCACCTGAGGCCGACCTGCTCTCCCGATCCCTCGCGAACTCCCCGGGAAG

ACGACGAAGACCAGTTACTTCTACAACGCAAATCGAACTATAGCCGCCCTGCTCTGTCCAGGA

AGCAACGCGCCGGCGCGGGATGCTCCACTATAAAACGCACCCGCTAATCACATCGACCCGCCA

CACCACCTATCACAGCAACACAAGCCAACCACAAAGAATT

It should be noted that: in the DNA sequence dna of above-mentioned promotor, the retention sequence of the forward primer that the sequence " GCGTGTTGCG GAGTATGAGG TC " that sequence beginning represents take italic overstriking is used in obtaining promotor process, 22bp altogether; The retention sequence (the corresponding sequence complementation of this retention sequence and reverse primer) of the reverse primer that the sequence " CAAGCCAACCACAAAGAATT " that sequence end represents take italic overstriking is used in obtaining promotor process, altogether 20bp; In this DNA sequence dna, remaining part is available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that the promotor mentioned both can refer to above-mentioned whole DNA sequence dna herein, also can refer to remove above-mentioned primer and retain the DNA sequence dna after sequence.

In sum, the present inventor's separating clone from the fine paddy rice of Japan (Oryza sativa L cv.Nipponbare) obtains the DNA sequence dna of the 1923bp of structure including transcription initiation site, and by the SEQ ID No:1 in its called after PCole1(sequence table).This sequence after cutting, enzyme is connected on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (being recombinant expression vector), utilize this recombinant plasmid transformed agrobacterium tumefaciens bacterial strain EHA105, then by agriculture bacillus mediated method, carry out the conversion of paddy rice, obtain transgenic rice plant.The transgenic paddy rice obtaining is carried out to histological chemistry and detect discovery, transfer-gen plant Gus gene expression dose is on the whole relatively low, only aobvious blue at coleoptile place, thereby the sequence that proves this 1923bp has the activity that drives genetic expression, and the Gus gene of this promoters driven is specific expressed in EMBRYO IN RICE bud scale.

Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.And, this promoter sequence can link with required target gene, build recombinant plant expression vector, after transforming, can drive specific expressed in coleoptile of target gene, thereby improve the expression amount of external source target gene in plant embryos bud scale, increase genetically modified effect, alleviate the impact on crop character due to overexpression of external source target gene.

Technique effect

The rice starter PCole1 that the present invention clones can concentrate and express by regulatory gene in coleoptile, has in actual applications remarkable value.By this promotor, variety of crops is carried out to genetic modification, as specific expressed in coleoptile by this promoter regulation target gene, can improve and improve growth characteristics and the mechanism of paddy rice, thereby cultivate new rice variety desirable, that quality is better, because it has feature specific expressed in coleoptile, available its replaces the constitutive promoters such as 35S, thereby cultivates the transgenic plant kind that desirable biological safety is high.

Accompanying drawing explanation

Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:

Figure 1A-1B is implemented in the schematic diagram in pCAMBIA1391 vector plasmid by PCole1 promotor, wherein Figure 1A is pCAMBIA1391 schematic diagram, Figure 1B is pCAMBIA1391-PCole1 schematic diagram, wherein shows the gus gene that utilizes PCole1 promoters driven to be positioned at its downstream and expresses;

Fig. 2 is the result schematic diagram of utilizing PCole1 promoters driven Gus genetic expression, and wherein a in figure represents root; B represents stem; C represents leaf; D represents leaf sheath; E represents pulvinus; F represents flower; G represents fruit; H represents seed; I represents coleoptile; J represents the coleoptile after amplification, and result shows the only obviously expression in coleoptile of PCole1 promoters driven Gus gene, and does not all express at other position.

Fig. 3 is the result schematic diagram of promotor of the present invention being carried out enzyme and cut checking.

Embodiment

Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiment are only for the present invention is described, the scope that it does not limit the present invention in any way.

Experimental technique in following embodiment, if no special instructions, is ordinary method.In following embodiment, medicinal raw material used, reagent material etc., if no special instructions, be commercially available purchase product.

The acquisition of the PCole1 promotor that contains restriction enzyme site

The design of step 1, primer

According to the rice varieties Japan providing in NCBI fine (Oryza sativa L cv.Nipponbare) whole genome sequence, according to the sequences Design amplimer of paddy rice PCole1 gene, and according to the feature of the carrier of selecting and target gene, the restriction enzyme site of design primer.

In the present embodiment with paddy rice binary expression vector pCAMBIA1391(Figure 1A, come from CAMBIA, openly use carrier, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) be example, target gene is Gus gene, the primer of specific design is: forward primer (SEQ ID No:2) 5 ' end band HindIII, restriction enzyme site (AAGCTT), reverse primer (SEQ ID No:3) 5 ' end band BamHI, restriction enzyme site (GGATCC), primer sequence is as follows:

Forward primer: AAGCTTGCGTGTTGCGGAGTATGAGGTC HindIII

Reverse primer: GGATCCAATTCTTTGTGGTTGGCTTGTG BamHI

Synthetic by Shenzhen Hua Da genome company.

The acquisition of step 2, promotor PCole1

Take the fine DNA of rice varieties Japan as template, utilize forward primer, reverse primer amplification promotor PCole1, PCR system routinely, adopts following amplification program:

95 ℃ of denaturation 5min; 95 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 2min30s, 35 circulations from 95 ℃ of denaturation to 72 ℃ extensions; Last 72 ℃ are extended 10min.

Reclaim the object fragment of pcr amplification, object fragment length 1923bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, in the ratio in carrier specification sheets, mix) on, according to heat shock method, transform after intestinal bacteria XL-Blue competent cell, competent cell is activated, and then object fragment is transferred in the competent cell of activation, then, through bacterium colony PCR screening, obtain positive colony, picking mono-clonal shakes bacterium liquid upgrading grain, carries out double digestion checking with HindIII and BamHI, as shown in Figure 3.The order-checking of Invitrogen company will be delivered through the positive colony of identifying.Verify that correct clone is the promotor PCole1 that will obtain, its nucleotide sequence is as shown in SEQ ID No:1.

The structure of plant expression vector and the conversion of Agrobacterium

In the positive colony obtaining " acquisition of promotor PCole1 " process from above, extract plasmid, with HindIII and BamHI double digestion, reclaim promotor PCole1 fragment.Utilize HindIII and BamHI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned PCole1 fragment is connected with T4 ligase enzyme for pCAMBIA1391 fragment (being purchased from TaKaRa company), obtain plant expression vector pCAMBIA1391-PCole1(Figure 1B of promotor PCole1 and Gus gene fusion), utilizing freeze-thaw method that plant expression vector is proceeded to agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105(Academy of Agri-Science and Technology Anhui Province genetically modified organism product composition supervision and inspection center of Ministry of Agriculture paddy rice group preserves), from freeze-thaw method products therefrom, extract positive plasmid, with HindIII and BamHI, carry out enzyme and cut checking, the result as shown in Figure 3.

Utilize promotor PCole1 to drive Gus reporter gene to express in paddy rice

Step 1: agriculture bacillus mediated rice transformation

Mature seed removes after clever shell, with 70% alcohol-pickled seed 1min, outwells alcohol.With 50% clorox that contains 1 Tween20 (stoste effective chlorine density is greater than 4%) solution soaking seed 40min(150r/min).Outwell clorox, aseptic washing 5 times is to solution clarification, without clorox taste.Sterilized water soaks seed and spends the night.With embryo being peeled along aleurone layer of scalper seed, embryo is inoculated on calli induction media.Dark cultivation after 11 days callus and endosperm and germ separation at 30 ℃, by go bud in good condition, divide vigorous elementary callus carry out preculture after 3～5 days for Agrobacterium-mediated Transformation.

Adopt the agrobacterium tumefaciens that has proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process to carry out agriculture bacillus mediated genetic transformation, this genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan(Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phosphomannose isomerase positive selection in Japonica rice (Oryza sativa L.) [J] .Plant Cell Report, method 2012.DOI10.1007/s00299-012-1275-3.) etc. proposing.

Obtain altogether 27 strain PCole1-pCAMBIA1391 plant (PCole1::gus transgenic rice plant).

Step 2, GUS histochemical stain

With reference to Jefferson (the people .GUS fusion such as Jefferson RA: β-Glucuronidase as a sensitive and versatile gene fusion marker in higher plant[J] .EMBO J., 1987, method 6:3901-3907) etc. proposing, the tissue of needs dyeing is vacuumized, then immerse in staining fluid, 37 ℃ are dyeed 24 hours.During decolouring, under 37 ℃ of conditions, use 95% Ethanol Treatment, extremely negative control material is white in color.

By GUS tissue staining, detect promotor PCole1 startup activity to GUS in Transgenic Rice Plants.Result demonstration, the coleoptile of PCole1::gus transgenic paddy rice seed presents blueness after GUS dyeing, and other parts are organized dye-free.Presentation of results, promotor PCole1 can drive the high-caliber expression of specificity in EMBRYO IN RICE bud scale of Gus gene, the results are shown in Figure 2.

Specific description of embodiments of the present invention above does not limit the present invention, and those skilled in the art can make according to the present invention various changes or distortion, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.

Claims

1. a plant embryos bud scale specific expressing promoter, is characterized in that, described plant embryos bud scale specific expressing promoter comprises the DNA sequence dna shown in SEQ ID No:1.

2. plant embryos bud scale specific expressing promoter according to claim 1, is characterized in that, the DNA sequence dna of described plant embryos bud scale specific expressing promoter is the sequence shown in SEQ ID No:1.

3. plant embryos bud scale specific expressing promoter according to claim 1, is characterized in that, the DNA sequence dna shown in the DNA sequence dna of described plant embryos bud scale specific expressing promoter and SEQ ID No:1 has at least 80% homology;

Or described plant embryos bud scale specific expressing promoter is to add, replace, insert or delete mutant or allelotrope or the derivative that one or more Nucleotide generate in the DNA sequence dna shown in SEQ ID No:1;

Or described plant embryos bud scale specific expressing promoter has the product with the DNA sequence dna hybridization shown in SEQ ID No:1.

4. an expression cassette, is characterized in that, described expression cassette comprises the plant embryos bud scale specific expressing promoter described in any one in claim 1-3.

5. a recombinant expression vector, it is characterized in that, described recombinant expression vector comprises the plant embryos bud scale specific expressing promoter described in any one in claim 1-3, in described recombinant expression vector, described plant embryos bud scale specific expressing promoter is connected in the upstream of gene order to be expressed in carrier;

Preferably, described gene to be expressed is Gus gene, and described recombinant expression vector is pCAMBIA1391-PCole1, and wherein pCAMBIA1391 is plant binary expression vector.

6. a Host Strains, it is characterized in that, described Host Strains comprises plant embryos bud scale specific expressing promoter, expression cassette claimed in claim 4 or the recombinant expression vector according to claim 5 described in any one in claim 1-3, and wherein, described Host Strains is agrobacterium tumefaciens.

7. a transformant, it is characterized in that, described transformant comprises plant embryos bud scale specific expressing promoter, expression cassette claimed in claim 4 or recombinant expression vector according to claim 5 or the Host Strains claimed in claim 6 described in any one in claim 1-3.

8. the application in cultivation transgenic plant according to the plant embryos bud scale specific expressing promoter described in any one in claim 1-3, it is characterized in that, described application comprises: will be connected in gene order upstream to be expressed in carrier according to the plant embryos bud scale specific expressing promoter described in any one in claim 1-3, thereby build recombinant expression vector; Described recombinant expression vector is transformed in vegetable cell, tissue or organ and is cultivated.

9. application according to claim 8, is characterized in that, described application is used for improveing plant embryos bud scale proterties, and described plant is monocotyledons: paddy rice, wheat, corn, barley, Chinese sorghum or oat.