CN103725652A - Acyl-coenzyme A synthetase and application thereof - Google Patents

Acyl-coenzyme A synthetase and application thereof Download PDF

Info

Publication number
CN103725652A
CN103725652A CN201310728420.7A CN201310728420A CN103725652A CN 103725652 A CN103725652 A CN 103725652A CN 201310728420 A CN201310728420 A CN 201310728420A CN 103725652 A CN103725652 A CN 103725652A
Authority
CN
China
Prior art keywords
acyl
acs1
coa synthetase
synthetase
sumo
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201310728420.7A
Other languages
Chinese (zh)
Other versions
CN103725652B (en
Inventor
陈辉
王泓雪
余晓丹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhentian (Shanghai) Biotechnology Co.,Ltd.
Original Assignee
WUXI XINHEYUAN FERMENTATION TECHNOLOGY RESEARCH INSTITUTE Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by WUXI XINHEYUAN FERMENTATION TECHNOLOGY RESEARCH INSTITUTE Co Ltd filed Critical WUXI XINHEYUAN FERMENTATION TECHNOLOGY RESEARCH INSTITUTE Co Ltd
Priority to CN201310728420.7A priority Critical patent/CN103725652B/en
Publication of CN103725652A publication Critical patent/CN103725652A/en
Application granted granted Critical
Publication of CN103725652B publication Critical patent/CN103725652B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/32—Nucleotides having a condensed ring system containing a six-membered ring having two N-atoms in the same ring, e.g. purine nucleotides, nicotineamide-adenine dinucleotide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01086—Fatty-acyl-CoA synthase (2.3.1.86)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses acyl-coenzyme A synthetase and an application thereof. The amino acid sequence of the acyl-coenzyme A synthetase is as shown in SEQ ID No.1. Further, genetically engineered bacteria capable of secreting the acyl-coenzyme A synthetase can be established, and the acyl-coenzyme A synthetase can be produced by fermentation of recombinant bacteria. The acyl-coenzyme A synthetase disclosed by the invention is the first enzyme which has been ever found to have an activity on trans-8-methyl-6-nonenoic acid or 8-metyl nonanoic acid, and provides a direct substrate for cloning capsaicinoid synthetase. The acyl-coenzyme A synthetase disclosed by the invention has an activity on medium-chain fatty acid and can also be applied to the field of biodiesel.

Description

A kind of acyl-CoA synthetase and application thereof
Technical field
The present invention relates to a kind of acyl-CoA synthetase and application thereof, belong to technical field of enzyme engineering.
Background technology
Capsaicine, formal name used at school is trans-8-methyl-N-vanillyl-nonenamide is a kind of secondary metabolite with pungency taste of peppery pepper (Capsicum).Capsaicine is synthetic by capsaicine synthetic enzyme (CS), and capsaicine synthetic enzyme is a kind of acyltransferase.Although the gene of coding CS is not yet decrypted at present, known its Main Function is from 8-methyl enoyl CoA in the ninth of the ten Heavenly Stems, 8-methyl nonene acyl group to be transferred on vanilla amine, thereby forms acid amides mixture.The substrate of CS, 8-methyl nonene acyl is under the effect of acyl-CoA synthetase (ACS), by trans-8-methyl-6 nonanoyl acid, is transformed.
The process that ACS catalysis carboxylic acid changes corresponding acyl-CoA thioesterase into experiences two stages altogether.First stage, free fatty acid is converted into a kind of acyl group-AMP intermediate product that can discharge pyrophosphate salt.Subordinate phase, the carboxyl groups of activation is connected on the sulfydryl of coenzyme A, and discharges AMP and acyl-CoA product (Groot et al., 1976).ACS and some associated protein are considered to have 12 aminoacid sequences of one section of high conservative, and this sequence can form and connect the core (PROSITTEPS00455) that AMP connects main body.In the plant model of Arabic mustard, approximately there is the ACS gene of 44 supposition identified (Shockey et al., 2003).At present; approximately there is the biochemical function of half identified; comprising long acyl coenzyme A synthetic enzyme, acyl-acp synthetic enzyme, 4-coumaric acyl CoA ligase; ethanoyl coenzyme A synthetic enzyme; OPC-8:0 CoA ligase, succinyl-benzoyl-CoA ligase enzyme, malonyl coenzyme A synthetic enzyme; grass acyl-CoA synthetase (Shockey et al., 2003; Koo., 2005; Koo et al., 2006; Kim et al., 2008; Lin and Oliver, 2008; Chen et al., 2011; Foster et al., 2012).In paprike, the supposition ACS gene of three kinds of total lengths is cloned (Lee et al., 2001; Mazourek et al., 2009).Yet the biochemical function of above-mentioned protein is not yet identified.
Because the genome sequence of peppery pepper is still unavailable, applicant uses RNA sequencing technologies to carry out transcript group analysis to the green fruit of India ghost green pepper.India ghost green pepper is a kind of crossbred of sheep's hay and crowndaisy chrysanthemum chrysanthemum.Applicant obtains 18987 contigs by the overlapping assembling to former RNA sequence data, wherein has 33 kinds of codings and the similar protein of acyl-CoA synthetase.In these contigs, Comp2147-1 has shown with CaSIG4 and can mate well.CaSIG4 is a kind of supposition acyl-CoA synthetase (Lee et al., 2001) of cDNA coding of the pathogen-inducible from paprike.In addition, Comp66462 and Comp79520 can mate with capsicum ACS1 (GenBank:EU616571), Comp167_c0, and Comp167_c1 and Comp46218 can mate with capsicum ACS2 (GenBank:EU616572).ACS1 and ACS2 are the material standed fors (Mazourek et al., 2009) that two kinds of acyl-CoA synthetases are transported lipid acid from plastid.
In the present invention, the ACS1 that applicant provides be a kind of in/long acyl coenzyme A synthetic enzyme, trans-8-methyl-6-nonenoic acid can be transformed on relevant 8-methyl nonene base coenzyme A, be intermediate product crucial in a kind of capsaicine biosynthetic pathway.
Summary of the invention
The invention provides a kind of acyl-CoA synthetase, aminoacid sequence is as shown in SEQ ID NO.1.
The present invention also provides a kind of construction process that contains acyl-CoA synthetase genetic engineering bacterium, comprises following steps:
(1) utilize the ACS1 gene of ACS1-sumo-F and ACS1-sumo-R primer amplification India ghost green pepper green fruit;
(2) by after the amplification of step (1) gained gene PCR purifying, be connected on linearizing pETite N-His SUMO Kan expression vector, obtain recombinant plasmid;
(3) by the recombinant plasmid of step (2) gained, be converted in intestinal bacteria HI-control10G cell, obtain genetic engineering bacterium.
The present invention also provides a kind of method of fermentative production acyl-CoA synthetase, is that acyl-CoA synthetase is expressed in microorganism, collects the acyl-CoA synthetase in tunning.
Further, the method for production acyl-CoA synthetase provided by the invention, comprises following steps:
(1) utilize the ACS1 gene of ACS1-sumo-F and ACS1-sumo-R primer amplification India ghost green pepper green fruit;
(2) by after the amplification of step (1) gained gene PCR purifying, be connected on linearizing pETite N-His SUMO Kan expression vector, obtain recombinant plasmid;
(3) by the recombinant plasmid of step (2) gained, be converted in intestinal bacteria HI-control10G cell, obtain genetic engineering bacterium;
(4) utilize the genetic engineering bacterium fermentative production acyl-CoA synthetase of step (3) gained.
The present invention also provides a kind of application of acyl-CoA synthetase, it is characterized in that, is that acyl-CoA synthetase is expressed in microorganism, collects the acyl-CoA synthetase in tunning, and making substrate conversion is acyl-CoA.
Described substrate is middle longer chain fatty acid.
Described substrate is trans 8-methyl-6-nonenoic acid or 8-methyl nonanoic acid.
The invention provides a kind of new acyl-CoA synthetase, can be capsaicine synthetic enzyme substrate is provided.Described new enzyme also can be in biofuel industry for the preparation of the derivative of fatty acid of medium chain.
Importance of ACS1 is, can make it have the effect of capsaicine level in potential regulating plant by transgenic technology.Overexpression by ACS1 realizes capsaicin content level in raising capsicum plant.By knocking out or strike low ACS1 gene, reduce the capsaicin content level of capsicum plant.
In natural capsicum, except accumulation capsaicine, outside Dihydrocapsaicin, also produce the capsaicine analogue (7-11 carbon atom) of other many different side chain lengths.ACS1 can provide for capsaicine synthetic enzyme (CS) acyl-CoA of different chain length, thereby controls the structure of capsaicine analogue.In current biofuel industry, medium chain acyl-CoA synthetase is widely used.Therefore, ACS1 has the prospect of applying in biofuel industry.
Described acyl-CoA synthetase gene can be expressed by the cell system of bacterium or yeast.Described ACS gene can be from LCAS4 and the LCAS5 gene of terrible green pepper ACS1, Arabidopis thaliana, or other sources.
Beneficial effect of the present invention: acyl-CoA synthetase centering chain lipid acid provided by the present invention has activity to can be used for field of biodiesel oil; be found up to now first to trans 8-methyl-6-nonenoic acid or the activated enzyme of 8-methyl nonanoic acid, can be clone's capsaicine synthase gene direct substrate be provided.
Accompanying drawing explanation
Fig. 1 is that His-SUMO-ACS1 is at the SDS-PAGE of BL21 (DE3) cells figure;
(0,20 represents that respectively IPTG induction is front and induces the total protein after 20 hours; C is that IPTG induces solubility crude protein extract after 20 hours; E1-E4 is the separated portion of Ni-NTA post).
Fig. 2 is the activity of ACS1 to different carboxylic acids;
(C2, acetic acid; C4, butyric acid; C6, caproic acid; C8 is sad; C10, capric acid; C12, lauric acid; C14, myristic acid; C16, palmitinic acid; C18, stearic acid).
Fig. 3 is that trans 8-methyl-6-nonenoic acid or 8-methyl nonanoic acid are as the HPLC spectrogram of the enzyme reaction product of substrate.
Fig. 4 analyzes the MS/MS of the trans 8-methyl-6 nonene base coenzyme A after purifying under negatively charged ion pattern.
Fig. 5 analyzes the MS/MS of the 8-methyl nonyl coenzyme A after purifying under negatively charged ion pattern.
Fig. 6 is-impact of different pH damping fluids on ACS1 activity;
（-◆-：Acetate；-■-：Phosphate；-▲-：Tris；-×-：Glycine）。
Embodiment
The invention discloses a kind of acyl-CoA synthetase and application thereof; specific embodiments comprises the genetic engineering bacterium that structure contains acyl-CoA synthetase; the expression of acyl-CoA synthetase in microorganism system; and in reaction system, add zymolyte, utilizing recombinant protein is acyl-CoA by substrate conversion.
Substrate be in/long-chain carboxylic acid, wherein long-chain carboxylic acid is generally the carboxylic acid that contains 16 or 18 carbon atoms, medium chain is the carboxylic acid that contains 10 or 12 carbon atoms.
The construction and expression of embodiment 1 India ghost green pepper ACS1 genetic engineering bacterium
The ACS1 gene that utilizes the cDNA of ACS1-sumo-F and ACS1-sumo-R primer amplification India ghost green pepper green fruit, the sequence of above-mentioned two primers is respectively: CGC GAA CAG ATT GGA GGT GCAACAGATAAATTTATTATTG and GTG GCG GCC GCT CTA TTA TCACTTGGTACCCTTGTACAT.Pcr amplification product is purified with 1% sepharose, and mixes (Lucigen, Middleton, WI) with linearizing pETite N-His SUMO Kan expression vector.By thermal shocking method, DNA mixture is converted in intestinal bacteria HI-control10G cell (Lucigen).Gene after inserting is checked order, guarantee that its sequence is correct.The aminoacid sequence of its coding is as shown in SEQ ID NO.1.By pETiet N-His SUMO-ghost green pepper ACS1 gene transformation, to HI-Control BL21 (DE31) cell (Lucigen), the expression of His-SUMO-ACS1 is used the IPTG of 0.5mM at 16 ℃, induces 20 hours.Mixing protein carries out purifying (see figure 1) by Ni-NTA post.The molecular weight of ACS1 is about 73.5KDa, and His-SUMO tag is about 12KDa.The migration of the ACS1 mixing protein of His-SUMO-ghost green pepper in SDS-PAGE approaches prediction (85KDa is shown in Fig. 1).
Embodiment 2ACS1 determination of activity
Utilize HPLC to measure the activity (Chen et al., 2011) of terrible green pepper ACS1.Be specially, reaction mixture (400 μ L) comprises the Tris-HCl of 0.1M, pH7.5, the DTT of 2mM, 5mM ATP, 10mM MgCl2,0.5mM CoA, 0.1% trotyl and 200 μ M carboxylic acids.Reaction starts by adding the purifying enzyme of 20 μ L, reacts and after 30 minutes, adds 20 μ L acetic acid termination reactions.HPLC is used
Figure BDA0000445807090000042
3000LC system (Thermo Scientific), adopts 120C18 reverse-phase chromatographic column (Thermo Scientific; 3 μ,
Figure BDA0000445807090000044
150x3mm).The composition of mobile phase has solvent orange 2 A (0.1% trifluoroacetic acid) and solvent B(acetonitrile).The program of gradient elution is as follows: 0 to 5 minute, and 5% solvent B; 5 to 9 minutes, solvent B concentration from 5% to 80% is linear to be increased; 9 to 11 minutes, solvent B concentration 80%; 11 to 12 minutes, solvent B concentration 5%.Flow velocity is 0.6mL/min.The sensing range of diode-array detector is 200 to 400nm.The qualitative, quantitative of substrate and product is composed peak under 257nm area by calculating obtains.Result shows: ACS1 enzyme is 0.57mM when take the Km value of 8-methyl nonanoic acid during as substrate, and Vmax value is 0.14 μ mol/min/mg; ACS1 enzyme is 0.49mM when take the Km value of (6E)-8-methyl-6-nonenoic acid during as substrate, and Vmax value is 0.1214 μ mol/min/mg.
The selection of embodiment 3ACS effect substrate
In enzyme reaction system, add respectively 5mM acetic acid, butyric acid, caproic acid, sad, capric acid, lauric acid, myristic acid, palmitinic acid and stearic acid.
As shown in Figure 2, in different substrates, the high reactivity of India ghost green pepper ACS1 is capric acid.On the contrary, ACS1 to acetic acid and butyric acid without any activity.
The production of embodiment 4 acyl-CoAs
Utilize the intermediate product of interior life in capsaicine biosynthetic pathway trans-8-methyl-6 n-nonanoic acids (6E) and 8-methyl nonanoic acid (8M), as substrate, produce acyl-CoA.
As shown in Figure 3, ACS1 is take in the measurement that above-mentioned two materials are substrate, higher to the activity of 6E.Collected corresponding HPLC detached peaks, after utilizing SpeedVac concentrator dry, with MS/MS, be further analyzed.
Each dry sample is used 40 μ L methyl alcohol: water: the buffered soln that acetonitrile ratio is 1:1:2.Use TriVersa
Figure BDA0000445807090000041
(Advion, Ithaca, NY) directly injects 10 μ L.Mass spectrograph (LTQ-Qrbitrap Velo (Thermo Fisher Scientific, Waltham, MA)) adopts negatively charged ion pattern to carry out.The scope of mass scanning is 300-2000m/z.Resolving power is made as 60000400m/z.The broken MS/MS that adopts of CID, detects the separated trap that adopts separator window 1.5m/z.Broken with 35% of normalization method collision energy.As shown in Figure 4 and Figure 5, the molecular weight of mass-spectrometric data and trans-8-methyl-6-nonene base coenzyme A and 8-methyl nonyl coenzyme A matches.
The pH stability of embodiment 5 acyl-CoA synthetases
Adopt acetate, phosphoric acid salt, Tris and glycine/NaOH buffered soln, regulate pH4.0 to 10.5, measures the pH stability of the acyl-CoA synthetase of producing.As shown in Figure 6, the optimal pH of ACS1 is 9.5 to result.
Figure IDA0000445807170000011
Figure IDA0000445807170000021
Figure IDA0000445807170000031

Claims (7)

1. an acyl-CoA synthetase, is characterized in that, aminoacid sequence is as shown in SEQ ID NO.1.
2. a construction process that contains acyl-CoA synthetase genetic engineering bacterium described in claim 1, is characterized in that, step is as follows:
(1) utilize the ACS1 gene of ACS1-sumo-F and ACS1-sumo-R primer amplification India ghost green pepper green fruit;
(2) by after the amplification of step (1) gained gene PCR purifying, be connected on linearizing pETite N-His SUMO Kan expression vector, obtain recombinant plasmid;
(3) by the recombinant plasmid of step (2) gained, be converted in intestinal bacteria HI-control10G cell, obtain genetic engineering bacterium.
3. a production method for acyl-CoA synthetase described in claim 1, is characterized in that, is that the acyl-CoA synthetase as shown in SEQ ID NO.1 is expressed in microorganism by aminoacid sequence, collects the acyl-CoA synthetase in tunning.
4. method described in claim 3, is characterized in that, step is as follows:
(1) utilize the ACS1 gene of ACS1-sumo-F and ACS1-sumo-R primer amplification India ghost green pepper green fruit;
(2) by after the amplification of step (1) gained gene PCR purifying, be connected on linearizing pETite N-His SUMO Kan expression vector, obtain recombinant plasmid;
(3) by the recombinant plasmid of step (2) gained, be converted in intestinal bacteria HI-control10G cell, obtain genetic engineering bacterium;
(4) utilize the genetic engineering bacterium fermentative production acyl-CoA synthetase of step (3) gained.
5. the application of acyl-CoA synthetase described in claim 1, is characterized in that, is that acyl-CoA synthetase is expressed in microorganism, collects the acyl-CoA synthetase in tunning, and making substrate conversion is acyl-CoA.
6. method described in claim 5, is characterized in that, described substrate is middle longer chain fatty acid.
7. method described in claim 5, is characterized in that, described substrate is trans 8-methyl-6-nonenoic acid or 8-methyl nonanoic acid.
CN201310728420.7A 2013-12-25 2013-12-25 A kind of acyl-CoA synthetase and application thereof Active CN103725652B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310728420.7A CN103725652B (en) 2013-12-25 2013-12-25 A kind of acyl-CoA synthetase and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310728420.7A CN103725652B (en) 2013-12-25 2013-12-25 A kind of acyl-CoA synthetase and application thereof

Publications (2)

Publication Number Publication Date
CN103725652A true CN103725652A (en) 2014-04-16
CN103725652B CN103725652B (en) 2016-06-29

Family

ID=50449945

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310728420.7A Active CN103725652B (en) 2013-12-25 2013-12-25 A kind of acyl-CoA synthetase and application thereof

Country Status (1)

Country Link
CN (1) CN103725652B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015109168A1 (en) * 2014-01-17 2015-07-23 Conagen Inc. Methods of using capsaicin synthase for the microbial production of capsaicinoids
CN105916991A (en) * 2013-11-01 2016-08-31 康纳根有限公司 Methods of using acyl-CoA synthetase for biosynthetic production of acyl-CoAs
CN107083412A (en) * 2017-06-13 2017-08-22 刘超 A kind of application of middle short chain acyl CoA synthase
US10655150B2 (en) 2016-01-07 2020-05-19 Conagen Inc. Methods of making capsinoids by biosynthetic processes
US11459591B2 (en) 2016-07-19 2022-10-04 Conagen Inc. Method for the microbial production of specific natural capsaicinoids

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102618556B (en) * 2012-04-12 2013-09-25 重庆大学 Pepper CaCOI1.2 gene, recombinant expression vector and application thereof
CN103710315B (en) * 2012-10-30 2016-03-23 浙江工业大学 From the long-chain-acyl-CoA synthetase of Cordyceps sinensis, gene and application

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105916991A (en) * 2013-11-01 2016-08-31 康纳根有限公司 Methods of using acyl-CoA synthetase for biosynthetic production of acyl-CoAs
EP3063283A4 (en) * 2013-11-01 2017-07-05 Conagen Inc. Methods of using acyl-coa synthetase for biosynthetic production of acyl-coas
US10392643B2 (en) 2013-11-01 2019-08-27 Conagen Inc. Methods of using acyl-CoA synthetase for biosynthetic production of acyl-CoAs
WO2015109168A1 (en) * 2014-01-17 2015-07-23 Conagen Inc. Methods of using capsaicin synthase for the microbial production of capsaicinoids
US9951358B2 (en) 2014-01-17 2018-04-24 Conagen Inc. Methods of using capsaicin synthase for the microbial production of capsaicinoids
US10655150B2 (en) 2016-01-07 2020-05-19 Conagen Inc. Methods of making capsinoids by biosynthetic processes
US11459591B2 (en) 2016-07-19 2022-10-04 Conagen Inc. Method for the microbial production of specific natural capsaicinoids
US11946083B2 (en) 2016-07-19 2024-04-02 Conagen Inc. Method for the microbial production of specific natural capsaicinoids
CN107083412A (en) * 2017-06-13 2017-08-22 刘超 A kind of application of middle short chain acyl CoA synthase
CN107083412B (en) * 2017-06-13 2021-05-28 刘超 Application of medium-short chain acyl coenzyme A synthetase

Also Published As

Publication number Publication date
CN103725652B (en) 2016-06-29

Similar Documents

Publication Publication Date Title
US11555211B2 (en) Recombinant production systems for prenylated polyketides of the cannabinoid family
Avidan et al. Enhanced acetyl-CoA production is associated with increased triglyceride accumulation in the green alga Chlorella desiccata
ES2470618T3 (en) Obtaining acetone by fermentation from renewable raw materials through a new metabolic route
US9546362B2 (en) Genes and proteins for alkanoyl-CoA synthesis
ES2698500T3 (en) Recombinant host cells for the production of malonate
CN103725652A (en) Acyl-coenzyme A synthetase and application thereof
CN107075536B (en) Process for producing 3-hydroxy-3-methylbutyric acid
CN103906845A (en) Production of odd chain fatty acid derivatives in recombinant microbial cells
BR112019023627A2 (en) method for the production of isobutene, recombinant organism or microorganism, use of a combination and composition
US11603545B2 (en) Recombinant yeast strain for producing nervonic acids and application thereof
EP3094320B1 (en) Methods of using capsaicin synthase for the microbial production of capsaicinoids
US11946083B2 (en) Method for the microbial production of specific natural capsaicinoids
ES2932529T3 (en) Microbial production of fatty amines
JP2022043100A (en) Production of odd chain fatty acid derivatives in recombinant microbial cells
JP6587358B2 (en) Method of using acyl-CoA synthetase for the biosynthetic production of acyl-CoA
CN110713962B (en) Genetic engineering bacterium for high-yield production of malonyl coenzyme A and construction method and application thereof
CN105176848B (en) Mortierella alpine strain overexpressing 3-phosphoglycerol dehydrogenase gene(G3PD1), and construction method and application thereof
EP3913063A1 (en) Non-naturally occurring microorganism for the biosynthetic production of baicalein
US20110189697A1 (en) Recombinant cells and plants for synthesis of very long chains fatty acid (vlcfa)
CN104212772A (en) 4-coumarate coenzyme A ligase originated from ornithogalum caudatum, nucleotide sequence, and applications thereof
TWI665302B (en) Genetically modified microorganisms for producing long-chain dicarboxylic acid and method of using thereof
US10358666B2 (en) Algae and method for producing same, and method for producing biomass using said algae
US8735110B2 (en) Pseudomonas aeruginosa strain developed for improving fatty acid content, and method of manufacturing the same
JP7216396B2 (en) Non-archaeal organisms with a novel mevalonate pathway
KR101305424B1 (en) Method for Preparing Transformed E coli for Over-expression of Fatty Acid Biosynthesis Pathway and Transformed E coli Prepared by the Same

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CB03 Change of inventor or designer information

Inventor after: Chen Hui

Inventor after: Wang Hongxue

Inventor after: Yu Xiaodan

Inventor before: Chen Hui

Inventor before: Wang Hongxue

Inventor before: Yu Xiaodan

COR Change of bibliographic data
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20240418

Address after: G05-119, 7th Floor, Building 11, No. 1569 Yushu Road, Songjiang District, Shanghai, 200000

Patentee after: Zhentian (Shanghai) Biotechnology Co.,Ltd.

Country or region after: China

Address before: Room 1105, Beichuang Phase I Building, 401 Xingyuan North Road, Wuxi City, Jiangsu Province, 214043

Patentee before: WUXI XINHEYUAN FERMENTATION TECHNOLOGY RESEARCH INSTITUTE Co.,Ltd.

Country or region before: China