JP7216396B2 - Non-archaeal organisms with a novel mevalonate pathway - Google Patents

Description

The present invention relates to non-archaeal organisms and the like having a novel mevalonate pathway.

Isoprenoids are the largest group of natural organic compounds in nature, with more than 70,000 species. Isoprenoids play important physiological roles in all biological domains. Examples include respiratory chain quinones, fat-soluble vitamins such as vitamin A and vitamin K in higher animals, steroids such as components of membrane lipids and hormones, carotenoids in higher plants, and plant hormones such as abscisic acid and gibberellin. is a typical example. All membrane lipids in archaea are composed of hydrocarbon chains by isoprenoids and are involved in adaptation to extreme environments.

Isoprenoids are synthesized from the precursors isopentenyl diphosphate (IPP), an active isoprene unit with 5 carbon atoms, and its structural isomer dimethylallyl diphosphate (DMAPP). The mevalonate (MVA) pathway is known as a pathway for synthesizing these precursors. The MVA pathway is a pathway that uses acetyl-CoA as a starting material and synthesizes IPP via MVA. DMAPP is synthesized by isomerization of IPP.

Isoprenoids are compounds that constitute various substances such as pharmaceuticals, vitamins, terpenes, and gums, or are raw materials for these substances. Various methods for producing isoprenoids using the mevalonate pathway are known (Patent Document 1). ). However, both methods utilize the existing mevalonate pathway (Fig. 1).

Japanese Patent Application Laid-Open No. 2017-148063

The present inventor focused on finding a novel mevalonate pathway. An object of the present invention is to discover a novel mevalonate pathway and to provide a technology for producing isoprenoid compounds using this pathway.

As a result of intensive research, the present inventors have found that if a non-archaeal organism contains a polynucleotide containing the coding sequence of the archaeal AcnX protein and a polynucleotide containing the coding sequence of the archaeal UbiD protein homologue, the above problems can be solved.

That is, the present invention includes the following aspects.

Section 1.
A non-archaeal organism comprising a polynucleotide comprising a coding sequence for an archaeal AcnX protein and a polynucleotide comprising a coding sequence for an archaeal UbiD protein homologue.

Section 2.
2. The non-archaeal organism of paragraph 1, further comprising a polynucleotide comprising a flavinprenyltransferase coding sequence.

Item 3.
Item 3. Item 1 or 2, wherein the archaeal AcnX protein is a protein derived from the phylum Crenarchaeota or the phylum Euriachiota, and the archaeal UbiD protein homologue is a protein derived from the phylum Crenarchaeota or the phylum Euriachiota. non-archaeal organisms.

Section 4.
Item 4. The non-archaeal organism according to any one of items 1 to 3, wherein said archaeal AcnX protein and said archaeal UbiD protein homologue are both proteins from the phylum Crenarchaeota.

Item 5.
The archaeal AcnX protein is a complex protein according to (A) or (B) below:
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 1-2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 3-4, or ( B) A large subunit consisting of an amino acid sequence having 70% or more identity with the amino acid sequence shown in any of SEQ ID NOS: 1-2 and 70% or more with the amino acid sequence shown in any of SEQ ID NOS: 3-4 a complex protein comprising a small subunit consisting of an amino acid sequence having the identity of and having 5-phosphomevalonate (MVA5P) dehydratase activity,
and the archaeal UbiD protein homolog is a protein according to (C) or (D) below:
(C) a protein consisting of the amino acid sequence shown in any of SEQ ID NOS: 5-6, or (D) consisting of an amino acid sequence having 70% or more identity with the amino acid sequence shown in any of SEQ ID NOS: 5-6 and a protein having trans anhydro 5-phosphomevalonate (tAHMP) decarboxylase activity,
Item 5. The non-archaeal organism according to any one of items 1 to 4, which is

Item 6.
Item 6. The non-archaebacterial organism according to any one of Items 1 to 5, wherein the non-archaeal organism is Enterobacteriaceae, actinomycetes, lactic acid bacteria, Clostridia, cyanobacteria, yeast, algae, filamentous fungi, or plants.

Item 7.
7. The non-archaeal organism of any of Items 1-6, further comprising a polynucleotide comprising coding sequences for other enzymes on the mevalonate pathway.

Item 8.
the other enzyme is the group consisting of acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase (MVK), isopentenyl phosphate kinase (IPK), and isopentenyl diphosphate isomerase (IDI) Item 8. The non-archaebacterial organism according to Item 7, which is at least one species selected from the above.

Item 9.
Item 9. A culture of a non-archaeal organism according to any one of Items 1 to 8.

Item 10.
From the culture of paragraph 9, general formula (1):

[In the formula, X represents a phosphate group, a hydroxy group, or hydrogen. ]
A compound represented by and / or general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
A method for producing a mevalonate pathway intermediate or an analog thereof comprising obtaining a compound represented by

Item 11.
General formula (1):

[In the formula, X represents a hydroxy group, a phosphate group or hydrogen. ]
A compound represented by and / or general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
Compounds represented by, salts thereof, or solvates thereof.

Item 12.
From the culture of item 9,
(a) an isoprenoid compound, and/or (b) general formula (1):

[In the formula, X represents a hydroxy group, a phosphate group or hydrogen. ]
and/or general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
The decarboxylation product of the compound represented by
A method of making a compound, comprising obtaining

Item 13.
An isolated polynucleotide comprising a coding sequence for an archaeal AcnX protein and a coding sequence for an archaeal UbiD protein homologue.

Item 14.
An MVA5P dehydratase enzymatic preparation containing an archaeal AcnX protein.

Item 15.
A tAHMP decarboxylase enzyme preparation containing an archaeal UbiD protein homologue.

ADVANTAGE OF THE INVENTION According to this invention, the isoprenoid compound manufacturing technique using a novel mevalonate pathway can be provided.

Figure 2 shows a schematic representation of the mevalonate pathway. Shaded arrows indicate 5-diphosphomevalonate decarboxylase (DMD) and its homologues. 2 shows the analysis results of the enzymatic activity of the archaeal AcnX protein (Example 2-2). MVA5P: 5-phosphomevalonic acid, ApAcnX: recombinant AcnX protein from Aeropyrum pernix. 4 shows the analysis results of enzymatic activity of archaeal UbiD protein homologs (Example 4-2). anhydro MVA5P: trans anhydro 5-phosphomevalonate (tAHMP), IP: isopentenyl phosphate, purified enzyme solution: purified UbiD protein homolog solution. Figure 3 shows validation results of archaeal UbiD protein homolog products (Examples 4-3). MVA: mevalonate, MVA5P: 5-phosphomevalonate, MVA5PP: 5-diphosphomevalonate, anhydro MVA5P: trans-anhydro 5-phosphomevalonate (tAHMP), IP: isopentenyl phosphate, IPP: isopentenyl diphosphate. GGOH: Geranylgeraniol 1 shows a construction scheme of a plasmid constructed in Example 5-1. The results of a lycopene production test (Example 5-2) are shown. Numbers indicate the sample numbers shown in Table 3.

As used herein, the expressions "contain" and "include" include the concepts "contain", "include", "consist essentially of" and "consist only of".

As used herein, the term “identity” of amino acid sequences refers to the degree of amino acid sequence identity between two or more comparable amino acid sequences. Therefore, the higher the identity or similarity between two amino acid sequences, the higher the identity or similarity between those sequences. The level of amino acid sequence identity is determined, for example, using the sequence analysis tool FASTA, using default parameters. or Algorithm BLAST by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc. Natl. Acad. Sci. USA. 87:2264-2268 (1990)). , Karlin S, Altschul SF."Applications and statistics for multiple high-scoring segments in molecular sequences."Proc. Natl. Acad. Sci. USA.90:5873-7 (1993)). A program called BLASTX based on such a BLAST algorithm has been developed. Specific methods of these analysis methods are known, and the website of the National Center of Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/) can be referred to. The “identity” of base sequences is also defined according to the above. As used herein, "conservative substitution" means that an amino acid residue is replaced with an amino acid residue having a similar side chain. For example, substitutions between amino acid residues having basic side chains such as lysine, arginine, and histidine correspond to conservative substitutions. In addition, amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine and cysteine; alanine, valine, leucine, isoleucine, amino acid residues with nonpolar side chains such as proline, phenylalanine, methionine, tryptophan; amino acid residues with β-branched side chains, such as threonine, valine, isoleucine; and aromatic side chains, such as tyrosine, phenylalanine, tryptophan, histidine. Substitutions between amino acid residues are also conservative substitutions.

As used herein, polynucleotides such as DNA and RNA may be subjected to known chemical modifications as exemplified below. Substitution of the phosphate residue of each nucleotide with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. to prevent degradation by hydrolases such as nucleases can be done. In addition, the hydroxyl group at the 2nd position of the sugar (ribose) of each ribonucleotide is replaced by -OR (R is, for example, CH ₃ (2'-O-Me), CH ₂ CH ₂ OCH ₃ (2'-O-MOE), _{CH2CH2NHC ( NH} ) _NH2 , _{CH2CONHCH3 , CH2CH2CN} , etc.). Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or cationic functional group to the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl. is mentioned. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety has been modified with biotin, an amino group, a lower alkylamine group, an acetyl group, or the like. In addition, BNA (LNA), etc., in which the conformation of the sugar portion is fixed to the N-type by bridging the 2' oxygen and 4' carbon of the sugar portion of a nucleotide, can also be preferably used. As used herein, the term "archaea" is not particularly limited, and includes, for example, phylum Crenarchaeota, Euriachiota, Thaumarchaeota, Aiguachiota, Colarchaeota, Bachiarchaeota, Lochi Examples include archaea such as Archaeota, and among these, archaea such as Crenarchaeota and Euriachiota are preferable. The archaea of the Crenarchaeota phylum preferably include an archaea of the Desulphlococceae family, more preferably an archaea of the genus Aeropyrum, and still more preferably Aeropyrum pernix. The archaebacteria of the phylum Euryarchiota preferably include archaea of the family Methanosarcinae, more preferably archaea of the genus Methanosarcina, and still more preferably Methanosarcina mazei.

As used herein, R in the ester (-COOR) includes, for example, C1-6 alkyl groups such as methyl, ethyl, n-propyl, isopropyl and n-butyl; C3-8 cycloalkyl groups such as cyclopentyl and cyclohexyl C6-12 aryl groups such as phenyl and α-naphthyl; phenyl-C1-2 alkyl groups such as benzyl and phenethyl; C7 such as α-naphthyl-C1-2 alkyl groups such as α-naphthylmethyl -14 aralkyl group; pivaloyloxymethyl group and the like are used.

1. In one aspect of the non-archaeal organisms of the present invention, a polynucleotide comprising a coding sequence for an archaeal AcnX protein (herein sometimes referred to as an "AcnX-encoding polynucleotide"), and an archaeal UbiD protein homologue A non-archaeal organism (also referred to herein as the "organism of the invention") comprising a polynucleotide comprising the coding sequence of There is.) This will be explained below.

1-1. Archaeal AcnX Protein The archaeal AcnX protein is a complex protein consisting of a large subunit (AcnX L) and a small subunit (AcnX S), and is not particularly limited as long as it is an archaeal AcnX protein.

Specific examples of archaeal AcnX proteins are shown in Table 1 below. For each ID, the ID including an underscore (_) is the ID in MBGD (mgbd.genome.ad.jp). AcnX proteins in archaea other than the species shown in Table 1 can also be easily determined by identity and homology searches.

The archaeal AcnX protein may be an endogenous protein into which a mutation has been introduced, as long as it has 5-phosphomevalonate (MVA5P) dehydratase activity. where MVA5P dehydratase activity is defined as MVA5P by the formula:

It is an activity to convert to a compound represented by (trans anhydro 5-phosphomevalonic acid (tAHMP)).

The presence or absence of MVA5P dehydratase activity can be determined by reacting the substrate (MVA5P) with the protein to be determined, analyzing the reaction product (e.g., separation by chromatography), and examining whether tAHMP is contained in the reaction product. can be determined by Specifically, it can be determined by the method described in Example 2, for example.

The mutein is preferably 70% or more (preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, 70% or more (preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, more preferably 90% or more, preferably 99% or more) with the amino acid sequence of the endogenous archaeal AcnX small subunit. is 95% or more, more preferably 97% or more, particularly preferably 99% or more), and has MVA5P dehydratase activity. . Mutations include, for example, substitutions, deletions, additions, insertions, etc., preferably substitutions, and more preferably conservative substitutions. The number of mutated amino acids is preferably 1 or more, more preferably 1-8, still more preferably 1-4, and even more preferably 1.

A preferred embodiment of the archaeal AcnX protein is a complex protein according to (A) or (B) below:
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 1-2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 3-4, or ( B) 70% or more (preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 97% or more, particularly preferably 97% or more, and more preferably 70% or more of the amino acid sequence shown in any of SEQ ID NOs: 1 and 2) is 99% or more), and 70% or more (preferably 80% or more, more preferably 90% or more, (more preferably 95% or more, still more preferably 97% or more, particularly preferably 99% or more) and a small subunit consisting of an amino acid sequence having an identity of 99% or more), and having MVA5P dehydratase activity body protein,
is. Mutations include, for example, substitutions, deletions, additions, insertions, etc., preferably substitutions, and more preferably conservative substitutions. The number of mutated amino acids is preferably 1 or more, more preferably 1-8, still more preferably 1-4, and even more preferably 1.

SEQ ID NO: 1 is AcnX L derived from A. pernix, and has an amino acid sequence of ID: APE_2087.1 on the KEGG database. SEQ ID NO: 2 is AcnX L derived from M. mazei, and is the amino acid sequence shown in ID: MM_1525 on the KEGG database. SEQ ID NO: 3 is AcnX S derived from A. pernix, and is the amino acid sequence shown in ID: APE_2089 on the KEGG database. SEQ ID NO: 4 is AcnX S derived from M. mazei, and its amino acid sequence is ID: MM_1524 on the KEGG database.

The archaeal AcnX protein may be chemically modified as long as it has the above-mentioned "activity".

Archaeal AcnX proteins may have either a carboxyl group (-COOH), carboxylate (-COO- ⁾ , amide ( _-CONH2 ) or ester (-COOR) at the C-terminus.

Archaeal AcnX proteins may be amidated or esterified at carboxyl groups (or carboxylates) other than the C-terminus. As the ester in this case, for example, the above-described C-terminal ester or the like is used.

Furthermore, in the archaeal AcnX protein, the amino group of the amino acid residue at the N-terminus is protected with a protecting group (for example, a formyl group, a _C1-6 acyl group such as a _C1-6 alkanoyl group such as an acetyl group, etc.). Pyroglutamic oxidation of the N-terminal glutamine residue that can be cleaved in vivo, Substituents on the side chain of amino acids in the molecule (e.g., -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) is protected with an appropriate protective group (e.g., formyl group, _C1-6 acyl group such as _C1-6 alkanoyl group such as acetyl group, etc.), or a sugar chain is bound Also included are complex proteins such as so-called glycoproteins.

The archaeal AcnX protein may be one to which a known protein tag, signal sequence, or other protein or peptide has been added, as long as it has the above-mentioned "activity". Examples of protein tags include biotin, His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, PA tag and the like.

Archaeal AcnX proteins may be in the form of salts with acids or bases. Salts are not particularly limited, and both acid salts and basic salts can be employed. Examples of acid salts include mineral salts such as hydrochloride, hydrobromide, sulfate, nitrate, phosphate; acetate, propionate, tartrate, fumarate, maleate, apple organic acid salts such as acid salts, citrates, methanesulfonates, and paratoluenesulfonates; and amino acid salts such as aspartates and glutamates. Examples of basic salts include alkali metal salts such as sodium salts and potassium salts; alkaline earth metal salts such as calcium salts and magnesium salts;

The archaeal AcnX protein may be in the form of a solvate. The solvent is not particularly limited, and examples thereof include water, ethanol, glycerol, acetic acid and the like.

1-2. Archaeal UbiD protein homolog The archaeal UbiD protein homolog is not particularly limited as long as it is an archaeal UbiD protein homolog.

Specific examples of archaeal UbiD protein homologues are shown in Table 1 above. Archaea UbiD protein homologues other than the species shown in Table 1 can also be easily determined by identity and homology searches.

Archaeal UbiD protein homologues may be endogenous proteins into which mutations have been introduced, as long as they have tAHMP decarboxylase activity. where the tAHMP decarboxylase activity is expressed by the formula:

The activity of converting the compound tAHMP represented by to isopentenyl phosphate (IP).

The presence or absence of tAHMP decarboxylase activity is determined by reacting the substrate (tAHMP) with the protein to be determined, analyzing the reaction product (e.g., separating it by chromatography), and examining whether IP is contained in the reaction product. It can be determined by Specifically, it can be determined by the method described in Example 4, for example.

The mutein is preferably 70% or more (preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, especially (preferably 99% or more), and has tAHMP decarboxylase activity. Mutations include, for example, substitutions, deletions, additions, insertions, etc., preferably substitutions, and more preferably conservative substitutions. The number of mutated amino acids is preferably 1 or more, more preferably 1-8, still more preferably 1-4, and even more preferably 1.

A preferred embodiment of an archaeal UbiD protein homologue is a complex protein according to (C) or (D) below:
(C) a protein consisting of the amino acid sequence shown in any of SEQ ID NOS: 5-6, or (D) 70% or more (preferably 80% or more, more preferably 80% or more) of the amino acid sequence shown in any of SEQ ID NOS: 5-6 is 90% or more, more preferably 95% or more, still more preferably 97% or more, particularly preferably 99% or more), and has tAHMP decarboxylase activity,
is. Mutations include, for example, substitutions, deletions, additions, insertions, etc., preferably substitutions, and more preferably conservative substitutions. The number of mutated amino acids is preferably 1 or more, more preferably 1-8, still more preferably 1-4, and even more preferably 1.

SEQ ID NO: 5 is an A. pernix-derived UbiD protein homolog, and has an amino acid sequence of ID: APE_2078 on the KEGG database. SEQ ID NO: 6 is the UbiD protein homologue derived from M. mazei, and the amino acid sequence shown in ID: MM_1526 on the KEGG database.

The archaeal UbiD protein homolog may be chemically modified as long as it has the above-mentioned "activity".

Archaeal UbiD protein homologues may have either a carboxyl group (-COOH), carboxylate (-COO- ⁾ , amide ( _-CONH2 ) or ester (-COOR) at the C-terminus.

Archaeal UbiD protein homologs may be amidated or esterified at carboxyl groups (or carboxylates) other than the C-terminus. As the ester in this case, for example, the above-described C-terminal ester or the like is used.

Furthermore, archaeal UbiD protein homologues have the amino group of the N-terminal amino acid residue protected with a protecting group (e.g., formyl group, _C1-6 acyl group such as _C1-6 alkanoyl such as acetyl group, etc.). pyroglutamic oxidation of the N-terminal glutamine residue that can be cleaved in vivo, substituents on the side chains of amino acids in the molecule (e.g. -OH, -SH, amino group, imidazole group , indole group, guanidino group, etc.) is protected with an appropriate protecting group (e.g., _C1-6 acyl group such as formyl group, _C1-6 alkanoyl group such as acetyl group, etc.), or the sugar chain is Also included are conjugated proteins such as so-called glycoproteins.

An archaea UbiD protein homolog may be one to which a known protein tag, signal sequence, or other protein or peptide has been added, as long as it has the above-mentioned "activity". Examples of protein tags include biotin, His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, PA tag and the like.

Archaeal UbiD protein homologues may be in the form of salts with acids or bases. Salts are not particularly limited, and both acid salts and basic salts can be employed. Examples of acid salts include mineral salts such as hydrochloride, hydrobromide, sulfate, nitrate, phosphate; acetate, propionate, tartrate, fumarate, maleate, apple organic acid salts such as acid salts, citrates, methanesulfonates, and paratoluenesulfonates; and amino acid salts such as aspartates and glutamates. Examples of basic salts include alkali metal salts such as sodium salts and potassium salts; alkaline earth metal salts such as calcium salts and magnesium salts;

An archaeal UbiD protein homologue may be in the form of a solvate. The solvent is not particularly limited, and examples thereof include water, ethanol, glycerol, acetic acid and the like.

1-3. AcnX-encoding polynucleotide, UbiD homolog-encoding polynucleotide
An AcnX-encoding polynucleotide contains the coding sequence for an archaeal AcnX protein. A UbiD homolog-encoding polynucleotide comprises a coding sequence for an archaeal UbiD protein homolog.

The archaeal AcnX protein coding sequence is not particularly limited as long as it is a polynucleotide consisting of a base sequence encoding the archaeal AcnX protein. The AcnX L coding sequence includes, for example, the base sequences described in (PL) or (QL) below:
(PL) the nucleotide sequences shown in SEQ ID NOS: 39-40, or (QL) the nucleotide sequences shown in SEQ ID NOS: 39-40 and 70% or more (preferably 80% or more, more preferably 90% or more, more preferably 95 % or more, more preferably 97% or more, and particularly preferably 99% or more). :
(PS) the nucleotide sequences shown in SEQ ID NOS: 41-42, or (QS) the nucleotide sequences shown in SEQ ID NOS: 41-42 and 70% or more (preferably 80% or more, more preferably 90% or more, more preferably 95 % or more, more preferably 97% or more, particularly preferably 99% or more). Mutations include, for example, substitutions, deletions, additions, and insertions, preferably substitutions. The number of mutated bases is preferably 1 or more, more preferably 1 to 8, still more preferably 1 to 4, and even more preferably 1.

SEQ ID NO: 39 is the AcnX L coding sequence derived from A. pernix, and is the nucleotide sequence shown in ID: APE_2087.1 on the KEGG database. SEQ ID NO: 40 is an AcnX L coding sequence derived from M. mazei, and is the nucleotide sequence indicated by ID: MM_1525 on the KEGG database. SEQ ID NO: 41 is the AcnX S coding sequence derived from A. pernix, and is the nucleotide sequence indicated by ID: APE_2089 on the KEGG database. SEQ ID NO: 42 is an AcnX S coding sequence derived from M. mazei, and is the nucleotide sequence indicated by ID: MM_1524 on the KEGG database.

The archaeal UbiD protein homolog coding sequence is not particularly limited as long as it is a polynucleotide consisting of a base sequence encoding an archaeal UbiD protein homolog. Archaea UbiD protein homolog coding sequences include, for example, the nucleotide sequences described in (X) or (Y) below:
(X) the base sequence shown in SEQ ID NOS: 43-44, or (Y) the base sequence shown in SEQ ID NOS: 43-44 and 70% or more (preferably 80% or more, more preferably 90% or more, more preferably 95 % or more, more preferably 97% or more, particularly preferably 99% or more). Mutations include, for example, substitutions, deletions, additions, and insertions, preferably substitutions. The number of mutated bases is preferably 1 or more, more preferably 1 to 8, still more preferably 1 to 4, and even more preferably 1.

SEQ ID NO: 43 is an A. pernix-derived UbiD protein homolog coding sequence, and is the nucleotide sequence shown in ID: APE_2078 on the KEGG database. SEQ ID NO: 44 is a UbiD protein homolog coding sequence derived from M. mazei, and is the base sequence shown in ID: MM_1526 on the KEGG database.

The polynucleotide, in one aspect thereof, comprises, upstream of the coding sequence, a promoter for expressing the archaeal AcnX protein, the archaeal UbiD protein homologue. The promoter is not particularly limited and can be appropriately selected according to the host. Examples of promoters include tryptophan promoters such as trc and tac, lac promoters, T7 promoters, T5 promoters, T3 promoters, SP6 promoters, arabinose-inducible promoters, cold shock promoters, tetracycline-inducible promoters, and the like. Other examples include TDH3 promoter, GAL10 promoter, CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, CAG promoter and the like.

The polynucleotide may contain other elements (eg, multiple cloning site (MCS), drug resistance gene, origin of replication, etc.) as necessary. For example, in the polynucleotide, if the promoter, the archaeal AcnX protein coding sequence and/or the archaeal UbiD protein homolog coding sequence are arranged in this order from the 5′ side, between the promoter and the coding sequence (preferably one or both) and the MCS is arranged on the 3' side (preferably adjacent) of the coding sequence. MCS is not particularly limited as long as it contains multiple (eg, 2 to 50, preferably 2 to 20, more preferably 2 to 10) restriction enzyme sites.

The polynucleotide may constitute a vector. The type of vector is not particularly limited and is appropriately selected according to the host. Examples of E. coli include ColE1-based plasmids typified by pBR322 derivatives, pACYC-based plasmids having a p15A origin, pSC-based plasmids, and F factor-derived mini-F plasmids such as Bac-based plasmids.

The AcnX-encoding polynucleotide and the UbiD homolog-encoding polynucleotide may be separate polynucleotides, or may be combined into one (one molecule) polynucleotide.

The AcnX-encoding polynucleotides and UbiD homolog-encoding polynucleotides may be integrated into the genome of the non-archaeal organism, or may exist extragenomically.

Each of the AcnX-encoding polynucleotide and the UbiD homolog-encoding polynucleotide may be used singly or in combination of two or more.

The polynucleotides described above can be easily produced according to known genetic engineering techniques. For example, it can be produced using PCR, restriction enzyme cleavage, DNA ligation technology, and the like.

1-4. Flavinprenyltransferase -Encoding Polynucleotides Organisms of the invention preferably comprise a polynucleotide comprising a flavinprenyltransferase-encoding sequence (also referred to herein as a "flavinprenyltransferase-encoding polynucleotide"). It is believed that this can further enhance the activity of the archaeal UbiD protein homologue.

The flavinprenyltransferase is not particularly limited, and archaea-derived UbiX protein homologs and other organism-derived flavinprenyltransferases (eg, yeast YDR538W, etc.) can be employed.

Specific examples of archaeal UbiX protein homologues are shown in Table 1 below. UbiX protein homologs in archaea other than the species shown in Table 1 can also be easily determined by identity and homology searches.

The flavinprenyltransferase may be an endogenous protein into which a mutation has been introduced as long as it has flavinprenyltransferase activity. The mutant protein preferably has an amino acid sequence of 70% or more (preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% above) and has flavin prenyltransferase activity. Mutations include, for example, substitutions, deletions, additions, insertions, etc., preferably substitutions, and more preferably conservative substitutions. The number of mutated amino acids is preferably 1 or more, more preferably 1-8, still more preferably 1-4, and even more preferably 1.

As long as the flavin prenyltransferase has the above-mentioned "activity", it may be in a chemically modified form, a known protein tag, a form to which a protein or peptide such as a signal sequence is added, a salt form, or a solvate form. good too. These forms are the same as "1-1" and "1-2" above.

The flavin prenyltransferase-encoding polynucleotide may be a separate polynucleotide from the AcnX-encoding polynucleotide and the UbiD homolog-encoding polynucleotide, or may be combined with either or both of these to form one (one molecule) polynucleotide. may Also, the flavinprenyltransferase-encoding polynucleotide may be integrated into the genome of the non-archaeal organism, or it may exist extragenomically. Other flavinprenyltransferase-encoding polynucleotides are the same as those in "1-1" and "1-2" above.

The polynucleotides described above can be easily produced according to known genetic engineering techniques. For example, it can be produced using PCR, restriction enzyme cleavage, DNA ligation technology, and the like.

1-5. Polynucleotides Encoding Other Enzymes The organisms of the present invention optionally contain polynucleotides encoding other enzymes (eg, depending on the target compound to be produced using the organism).

Other enzymes include, for example, acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase (MVK), isopentenyl phosphate kinase (IPK), and isopentenyl diphosphate isomerase (IDI). enzymes on the mevalonate pathway of Other examples include various enzymes on the isoprenoid compound synthesis pathway.

Other enzymes may be used singly or in combination of two or more.

The polynucleotides encoding other enzymes may be separate polynucleotides from the AcnX-encoding polynucleotides and UbiD homolog-encoding polynucleotides, or may be combined with either or both of these to form one (one molecule) polynucleotide. may be Polynucleotides encoding other enzymes may also be integrated into the genome of the non-archaeal organism, or may be present extragenome. Other polynucleotides encoding other enzymes are the same as above "1-1" and "1-2".

The polynucleotides described above can be easily produced according to known genetic engineering techniques. For example, it can be produced using PCR, restriction enzyme cleavage, DNA ligation technology, and the like.

1-6. Biological organisms are not particularly limited as long as they are non-archaeal organisms, that is, organisms of species other than archaea. Non-archaeal organisms are not particularly limited as long as they are organisms (including cells) capable of driving the mevalonate pathway by endogenous and/or exogenous factors. Examples of the organism include bacteria such as bacteria of the family Enterobacteriaceae, fungi such as yeast, insect cells, animal cells, plant cells, and plants such as algae.

Bacteria include, for example, Gram-positive bacteria, Gram-negative bacteria, and the like.

Gram-positive bacteria include Bacillus bacteria, Listeria bacteria, Staphylococcus bacteria, Streptococcus bacteria, Enterococcus bacteria, Clostridium bacteria, etc. Clostridia, bacteria belonging to the genus Corynebacterium, bacteria belonging to the genus Streptomyces, etc., and bacteria belonging to the genus Bacillus, Corynebacterium, actinomycetes, lactic acid bacteria and the like are preferred.

Bacillus genus bacteria include Bacillus subtilis, Bacillus anthracis, Bacillus cereus, etc. Bacillus subtilis is more preferable.

Corynebacterium bacteria include Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium callunae, etc. Corynebacterium glutamicum is more preferred.

Examples of Gram-negative bacteria include Escherichia bacteria, Pantoea bacteria, Salmonella bacteria, Vibrio bacteria, Serratia bacteria, Enterobacter bacteria, and the like. Examples include bacteria of the genus Escherichia, bacteria of the genus Pantoea, bacteria of the genus Enterobacter, cyanobacteria, and the like.

As Escherichia (Escherichia) bacteria, Escherichia coli (Escherichia coli) is preferable.

Pantoea bacteria include Pantoea ananatis, Pantoea stewartii, Pantoea agglomerans, and Pantoea citrea. Pantoea ananatis, Pantoea citrea are preferred.

Examples of Enterobacter bacteria include Enterobacter agglomerans, Enterobacter aerogenes, etc., and Enerobacter aerogenes is preferred.

Examples of fungi include microorganisms of the genus Saccharomyces, the genus Schizosaccharomyces, the genus Yarrowia, the genus Trichoderma, the genus Aspergillus, the genus Fusarium, the genus Mucor. and preferably microorganisms, filamentous fungi, etc. of the genus Saccharomyces, Schizosaccharomyces, Yarrowia, or Trichoderma.

Examples of microorganisms belonging to the genus Saccharomyces include Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, and Saccharomyces kruibella. kluyveri), Saccharomyces norbensis, Saccharomyces oviformis, and Saccharomyces cerevisiae is preferred.

Schizosaccharomyces pombe is preferable as the microorganism belonging to the genus Schizosaccharomyces.

Yarrowia lipolytica is preferable as the microorganism belonging to the genus Yarrowia.

Examples of microorganisms belonging to the genus Trichoderma include Ttichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma viride. and Trichoderma reesei is preferred.

The organism of the present invention can be produced according to or according to a known method, for example, by an operation of introducing the above-described polynucleotide into an organism, a transformation method, or the like.

2. Cultures, mevalonate pathway intermediates or analogs thereof, isoprenoid compounds or decarboxylation products methods, methods for producing isoprenoid compounds or decarboxylation products, and the like. These are described below.

2-1. Culture The culture can be obtained by culturing the organism of the present invention. Examples of culturing methods when the organism of the present invention is a microorganism are described below. Even when the organism of the present invention is a relatively large organism, it is possible to adopt a known culture method suitable for the species using a medium containing nutrients in the following culture methods.

A medium for culturing the organism of the present invention preferably contains a carbon source for conversion to mevalonic acid or isoprene. Carbon sources include carbohydrates such as monosaccharides, disaccharides, oligosaccharides, and polysaccharides; invert sugar obtained by hydrolyzing sucrose; glycerol; methanol, formaldehyde, formate, carbon monoxide, carbon dioxide, etc. (hereinafter referred to as C1 compound); oils such as corn oil, palm oil, soybean oil; acetate; animal fats and oils; animal oils; fatty acids such as saturated fatty acids and unsaturated fatty acids; glycerin fatty acid esters such as , diglycerides and triglycerides; polypeptides such as microbial proteins and vegetable proteins; renewable carbon sources such as hydrolyzed biomass carbon sources; yeast extracts; or combinations thereof. As the nitrogen source, inorganic ammonium salts such as ammonium sulfate, ammonium chloride and ammonium phosphate, organic nitrogen such as soybean hydrolysate, ammonia gas, aqueous ammonia, and the like can be used. As an organic trace nutrient source, it is desirable to contain required substances such as vitamin B1 and L-homoserine or yeast extract in an appropriate amount. In addition to these, small amounts of potassium phosphate, magnesium sulfate, iron ions, manganese ions, and the like may be added as necessary. The medium used in the present invention may be either a natural medium or a synthetic medium as long as it contains a carbon source, a nitrogen source, inorganic ions and, if necessary, other organic trace components.

Examples of monosaccharides include trioses such as ketotriose (dihydroxyacetone) and aldotriose (glyceraldehyde); tetroses such as ketotetrose (erythrulose) and aldotetrose (erythrose, threose); ketohexose (psicose, fructose, sorbose, tagatose), aldohexose (allose, altrose, glucose, mannose, gulose, idose, galactose, talose) ), hexoses such as deoxy sugars (fucose, fucrose, rhamnose); heptoses such as sedoheptulose; C6 sugars such as fructose, mannose, galactose and glucose; and C5 sugars such as xylose and arabinose.

Disaccharides include sucrose, lactose, maltose, trehalose, turanose, cellobiose and the like, with sucrose and lactose being preferred.

Oligosaccharides include trisaccharides such as raffinose, melezitose and maltotriose; tetrasaccharides such as acarbose and stachyose; mentioned.

Polysaccharides include glycogen, starch (amylose, amylopectin), cellulose, dextrin, and glucan (β1,3-glucan). Starch and cellulose are preferred.

Microbial proteins include polypeptides that can be obtained from yeast or bacteria.

Vegetable proteins include polypeptides obtainable from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, cottonseed, palm kernel oil, olive, safflower, sesame, flaxseed.

Lipids include substances containing one or more C4 or higher saturated or unsaturated fatty acids.

The oil preferably contains one or more C4 or higher saturated and unsaturated fatty acids and is liquid at room temperature, such as soybean, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, cottonseed, palm kernel oil, Lipids obtainable from olives, safflowers, sesame seeds, flaxseeds, oleaginous microbial cells, bed gobies, or combinations of two or more thereof are included.

Fatty acids include compounds represented by the formula RCOOH ("R" represents a hydrocarbon group).

Unsaturated fatty acids are compounds having at least one carbon-carbon double bond at "R" and include oleic acid, vaccenic acid, linoleic acid, palmiteraidic acid, arachidonic acid, and the like.

Saturated fatty acids are compounds in which "R" is a saturated aliphatic group, and include docosanoic acid, icosanoic acid, octadecanoic acid, hexadecanoic acid, tetradecanoic acid, dodecanoic acid and the like.

Among them, the fatty acid preferably contains one or more C2 to C22 fatty acids, more preferably C12 fatty acid, C14 fatty acid, C16 fatty acid, C18 fatty acid, C20 fatty acid, and C22 fatty acid.

Carbon sources also include salts, derivatives, and salts of these fatty acids. Salts include lithium salts, potassium salts, sodium salts and the like.

Examples of carbon sources include combinations of lipids, oils, fats, fatty acids, glycerin fatty acid esters, and carbohydrates such as glucose.

Renewable carbon sources include hydrolyzed biomass carbon sources.

Biomass carbon sources include cellulosic substrates such as wood, paper and pulp waste, foliage, pulp; plant parts such as stalks, grains, roots, tubers and the like.

Plants used as biomass carbon sources include corn, wheat, rye, sorghum, triticate, rice, millet, barley, cassava, legumes such as peas, potatoes, sweet potatoes, bananas, sugar cane, tapioca, and the like.

When adding a renewable carbon source such as biomass to the medium, pretreatment is preferred. Pretreatments include enzymatic pretreatments, chemical pretreatments, and combinations of enzymatic and chemical pretreatments.

As an exemplary method of culturing the organisms of the invention in connection with the present invention, the organisms are preferably cultured in standard media containing saline and nutrient sources.

The culture medium is not particularly limited, and includes commercially available ready-made media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, Yeast medium (YM) broth, and the like. A medium suitable for culturing a specific host can be appropriately selected and used.

In addition to a suitable carbon source, the cell culture medium contains suitable minerals, salts, cofactors, buffers, and ingredients known to those skilled in the art to be suitable for culturing or to promote isoprene production. It is desirable to be

In order to maintain the expression of the target protein in the organism of the present invention, it is preferable to add sugars, metal salts, antibacterial substances, etc. to the medium.

Culture conditions for the organism of the present invention are not particularly limited as long as the target protein can be expressed, and standard culture conditions can be used.

The culture temperature is preferably 20°C to 37°C, the gas composition preferably has a CO ₂ concentration of about 6% to about 84%, and the pH is preferably about 5 to about 9.

Organisms of the invention are preferably cultured under aerobic, anoxic or anaerobic conditions depending on the nature of the host.

Examples of methods for culturing the organism of the present invention include methods of culturing using known fermentation methods such as batch culture, fed-batch culture, and continuous culture.

2-2. A method for producing a mevalonate pathway intermediate or an analogue thereof By culturing the organism of the present invention under appropriate conditions, a novel mevalonate pathway intermediate or an analogue thereof, specifically, the general formula (1):

[In the formula, X represents a phosphate group, a hydroxy group, or hydrogen. ]
A compound represented by and / or general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
A compound represented by is formed.

A novel mevalonate pathway intermediate or an analog thereof is obtained by recovering the compound represented by the general formula (1) and/or the compound represented by the general formula (2) from the culture according to a known method. can be obtained.

The compound represented by the general formula (1) and/or the compound represented by the general formula (2) may be in the form of salts with acids or bases. Salts are not particularly limited, and both acid salts and basic salts can be employed. Examples of acid salts include mineral salts such as hydrochloride, hydrobromide, sulfate, nitrate, phosphate; acetate, propionate, tartrate, fumarate, maleate, apple organic acid salts such as acid salts, citrates, methanesulfonates, and paratoluenesulfonates; and amino acid salts such as aspartates and glutamates. Examples of basic salts include alkali metal salts such as sodium salts and potassium salts; alkaline earth metal salts such as calcium salts and magnesium salts;

The compound represented by the general formula (1) and/or the compound represented by the general formula (2) may be in the form of a solvate. The solvent is not particularly limited, and examples thereof include water, ethanol, glycerol, acetic acid and the like.

2-3. Method for Producing Isoprenoid Compounds or Decarboxylation Products By culturing the organisms of the present invention under suitable conditions, isoprenoid compounds are produced. Further, by culturing the organism of the present invention under appropriate conditions, decarboxylation products of compounds other than tAHMP among the compounds represented by the general formula (1) and the compounds represented by the general formula (2) It is also possible to generate

Isoprenoid compounds consist of one or more isoprene units having the molecular formula _{( C5H8} ) _n . Precursors of isoprene units are isopentenyl pyrophosphate or dimethylallyl pyrophosphate. 30,000 isoprenoid compounds have been identified and new compounds are being identified. Isoprenoids are also known as terpenoids. The difference between terpenes and terpenoids is that terpenes are hydrocarbons whereas terpenoids contain additional functional groups. Terpenes are classified according to the number of isoprene units in the molecule [e.g., hemiterpene (C5), monoterpene (C10), sesquiterpene (C15), diterpene (C20), sesterterpene (C25), triterpene (C30), sescalterpene (C35), tetraterpene (C40), polyterpene, norisoprenoid]. Monoterpenes include, for example, pinene, nerol, citral, camphor, menthol, limonene, and linalool. Sesquiterpenes include, for example, nerolidol and farnesol. Diterpenes include, for example, phytol and vitamin A1. Squalene is an example of a triterpene and carotene (provitamin A1) is a tetraterpene. The isoprenoid compound may be various substances such as medicines, vitamins, terpenes, and gums, or may be compounds that are raw materials thereof.

The compounds can be obtained by recovering the isoprenoid compounds and/or decarboxylation products from the culture according to known methods.

3. Polynucleotides The present invention, in one aspect thereof, relates to an isolated polynucleotide comprising a coding sequence for an archaeal AcnX protein and a coding sequence for an archaeal UbiD protein homologue.

"Isolated" means, for example, not the genomic DNA itself. From this point of view, the base length of the polynucleotide is, for example, 50 kb or less, 20 kb or less, 10 kb or less, 6 kb or less, or 3 kb or less. The lower limit of the base length is the base length of the coding sequence.

Definitions of other terms are the same as described in "1-1" above.

Four. Enzyme agent In one aspect, the present invention relates to an MVA5P dehydratase enzyme agent containing an archaeal AcnX protein. In one aspect, the present invention also relates to a tAHMP decarboxylase enzymatic agent containing an archaeal UbiD protein homologue.

The enzymatic agent may consist solely of the archaeal AcnX protein or the archaeal UbiD protein homolog, or may contain other components. Other components include, for example, bases, carriers, solvents, dispersants, emulsifiers, buffers, osmotic pressure regulators, absorption enhancers, stabilizers, excipients, binders, disintegrants, lubricants, and thickeners. agents, moisturizing agents, coloring agents, fragrances, chelating agents, and the like.

Definitions of other terms are the same as described in "1-1" above.

EXAMPLES The present invention will be described in detail below based on examples, but the present invention is not limited by these examples.

In addition, hereinafter, unless otherwise specified, the notation of the plasmid vector is indicated by "plasmid name-introduced gene name". Gene names are indicated by IDs in the KEGG database (https://www.genome.jp/kegg/kegg_ja.html). For example, a plasmid vector "pET15b-APE_2087.1" indicates a vector obtained by introducing the APE_2087.1 gene on the KEGG database into pET15b. For the meaning of abbreviations for enzymes and substrates, see FIG. 1 unless otherwise specified.

Example 1. Exploring a novel mevalonate pathway 1
We classified archaea into species that possess or do not possess genes for 5-diphosphomevalonate decarboxylase (DMD) homologues, and identified orthologous gene clusters that are absent in the genomes of reservoir species and specifically present in non-reservoir species. explored. As a result, we found a gene encoding a protein of unknown function, aconitase X (AcnX), which consists of two subunits.

Example 2. Functional analysis of archaeal AcnX protein Archaeal AcnX protein derived from A. pernix belonging to the phylum Crenarchaeota (large subunit: APE_2087.1 of KEGG, small subunit: Ape_2089 of KEGG) was used as the archaeal AcnX protein. , analyzed its function.

<Example 2-1. Expression and Purification of Recombinant Archaeal AcnX Protein>
(1) pET15b-APE_2087.1 and pET15b-Ape_2089 were each introduced into E. coli Rosetta2 (DE3).

(2) Each of the obtained cells of the present invention was cultured in Auto Induction medium (ampicillin: 100 µg/mL, chloramphenicol: 30 µg/mL) at 37°C for 18 hours. Auto Induction medium (Composition: Na ₂ HPO ₄ 6 g, KH ₂ PO ₄ 3 g, Tryptone 20 g, Yeast extract 5 g, NaCl 5 g, Up to 950 μL) was sterilized in an autoclave after preparation, and further sterile-filtered just before inoculation. Solution A (composition: 0.5 g glucose, 2 g lactose, Up to 50 μL) was added.

(3) After collecting each of the two types of cells of the present invention, 3 g of each cell was mixed and added to 30 ml of Histrap binding buffer II (Composition: Sodium phosphate (pH 7.4) 20 mM, NaCl 500 mM, Imidazole 25 mM ).

(4) Using an ultrasonic generator UP200S (Hielscher Ultrasonics), the cells were disrupted at Cycle 0.3 and Amplitude 60. Ultrasonic crushing operation was performed on ice for 2 minutes, and this operation was repeated 3 times.

(5) The cell lysate was centrifuged at 15,000 rpm for 30 minutes at 4°C, and the supernatant was recovered. The resulting supernatant was filtered through a syringe filter with a pore size of 0.45 μm.

(6) A Histrap FF column (GE Healthcare, column volume 1 ml) to which Ni2 ⁺ was added was equilibrated with 10 ml of Histrap binding buffer II, and the supernatant was applied to the column.

(7) After washing with 10 ml of Histrap binding buffer II, the target protein was eluted with Histrap elute buffer III (composition: sodium phosphate (pH 8.0) 20 mM, NaCl 500 mM, imidazole 500 mM). This eluate was used as the archaeal AcnX protein in subsequent experiments.

<Example 2-2. Analysis of enzymatic activity of archaeal AcnX protein>
(1) Prepare a reaction solution (composition: [2- ¹⁴ C] MVA5P 45.5 nmol (5,550,000 dpm), Archaea AcnX protein 0.5 nmol, Sodium phosphate (pH8.0) 5 μmol, Up to 50 μL) reacted over time.

(2) MVA5P and ApAcnX products were separated using normal phase TLC. TLC conditions: TLC plate TLC silica gel 60, developing solvent chloroform:pyridine:formic acid:water=12:28:6:4.

(3) The imaging plate (BAS-IP) was exposed in close contact with the TLC plate. After reading the imaging plate with Typhoon FLA 9000, image analysis was performed using analysis software Image Quant TL.

(4) Based on the results of image analysis, the Rf value of the ApAcnX product was determined, and silica was scraped off in the region of ±0.05 of that value.

(5) 300 µL of 1 M ammonium acetate buffer (pH 7.5) was added to the scraped silica to extract the ApAcnX product. This operation was repeated twice.

(6) After centrifuging to collect only the extract, it was heated at 100° C. and concentrated to about 100 μL. This solution was the radiolabeled ApAcnX product.

(7) A reaction solution (composition: radioactively labeled ApAcnX product 54.6 pmol (6,660 dpm), purified ApAcnX 0.3 nmol, sodium phosphate (pH 8.0) 3 μmol, up to 30 μL) was prepared and reacted at 90°C for 1 hour. .

(8) Normal-phase TLC analysis was performed in the same manner as in (2) above.

<Example 2-3. NMR Analysis of ApAcnX Product>
(1) Reaction mixture (composition: [U- ¹³ C]5-phosphomevalonic acid (MVA5P) 3 µmol, archaeal AcnX protein 2 µmol, sodium phosphate (pH8.0) 20 µmol, Up to 200 µL with 10% D2O) was prepared and reacted at 90°C for 2 hours.

(2) Deproteinization was performed using a centrifugal filter for ultrafiltration, followed by NMR analysis according to a standard method.

<Example 2-4. Results>
The results of Example 2-2 are shown in FIG. It was found that a product was produced by reacting the archaeal AcnX protein with MVA5P (1-2 lanes from the left in FIG. 2). It was also found that this reaction is reversible (lanes 3-4 from the left in Figure 2).

The results of Examples 2-3 are as follows:¹³C NMR (600 MHz, H.₂O/D₂O) δ: 177.0, 122.8, 145.1, 40.1, 62.6, 17.8. From this result, the ApAcnX product has the following formula:

It was found to be the compound tAHMP represented by

From the above, it was found that the archaeal AcnX protein has a dehydratase activity against MVA5P on the mevalonate pathway and is an enzyme that produces tAHMP.

Example 3. Search for novel mevalonate pathway 2
tAHMP is a novel intermediate on the mevalonate pathway. Therefore, we searched for an enzyme responsible for the pathway leading to the existing intermediate via this intermediate. Specifically, the function provided by the Microbial Genome Darabase for Comparative Analysis (MBGD) (http://mbgd.genome.ad.jp) is used to preserve AcnX orthologous genes on the genome. We selected archaea with MVA pathways and other archaea species, and searched for orthologous gene clusters specifically conserved in the former. As a result, a gene encoding a UbiD protein homolog and a gene encoding a UbiX protein homolog were found. Based on the findings so far, UbiX protein homologs were considered to have flavin prenyltransferase activity to synthesize prenylated flavin (prFMN), which is a kind of coenzyme. Therefore, it was thought that the activity on the mevalonate pathway was borne by the UbiD protein homologue.

Example 4. Functional Analysis of Archaeal UbiD Protein Homolog As an archaeal UbiD protein homolog, we used an archaeal UbiD protein homolog (KEGG Ape_2078) from A. pernix belonging to the phylum Crenarchaeota and analyzed its function.

<Example 4-1. Expression and Purification of Recombinant Archaeal UbiD Protein Homologs>
(1) The gene Ape_2078 encoding the UbiD protein homolog and the gene Ape_1647 encoding the UbiX protein homolog were amplified by PCR using the primers shown below. At this time, PCR reaction was performed using KOD-Plus (TOYOBO) using the genome of A. pernix (Riken BRC Microbial Materials Development Laboratory (JCM)) as a template.
Ape_2078 Fw: GGGATTAGAAGGAGTTATATATGGAGGATGCGAGTCTAAAG (SEQ ID NO: 9)
Ape_2078Rv: GTGGTGGTGGTGGTGCTCGAGGTCTCCCGGCTGGTGGC (SEQ ID NO: 10)
Ape_1647 Fw: TTAAGAAGGAGATATACATATGTCCTGCAGACCTAGCTCG (SEQ ID NO: 11)
Ape_1647Rv: TCCTCCATATATAACTCCTTCTAATCCCCCTCCTCGGG (SEQ ID NO: 12)

(2) After digesting the pET22b(+) vector with restriction enzymes NdeI and XhoI, the two amplified insert DNAs were inserted into the cleavage site of the vector using the In Fusion Cloning Kit (Takara). A His-tag was designed to attach only to the C-terminal side of the expressed Ape_2078.

(3) The constructed plasmid pET22b(+)-Ape_1647-Ape_2078 was introduced into E. coli Rosetta2 (DE3).

(4) Obtained cells of the present invention Each of the obtained cells of the present invention was cultured in Auto Induction medium (ampicillin: 100 µg/mL, chloramphenicol: 30 µg/mL) at 37°C for 24 hours.

(5) The collected cells were suspended in 20 ml of Histrap binding buffer I. Additionally, 10 mM DTT and 2.5 mM MnCl ₂ were added to this suspension.

(6) Using an ultrasonic generator UP200S (Hielscher Ultrasonics), the cells were disrupted at Cycle 0.3 and Amplitude 60. Ultrasonic crushing operation was performed on ice for 2 minutes, and this operation was repeated 3 times.

(7) The cell lysate was centrifuged at 15,000 rpm for 30 minutes at 4°C and then heat-treated at 60°C for 30 minutes.

(8) After centrifuging again at 15,000 rpm for 30 minutes at 4°C, the supernatant was recovered. The resulting supernatant was filtered through a syringe filter with a pore size of 0.45 μm.

(9) A Histrap FF column (GE Healthcare, column volume 1 ml) supplemented with Ni ²⁺ was equilibrated with 10 ml of Histrap binding buffer I, and the supernatant was applied to the column.

(10) After washing with 10 ml of Histrap binding buffer I, the target protein was eluted with Histrap elute buffer I. This eluate was used as the archaeal UbiD protein homologue in subsequent experiments.

<Example 4-2. Analysis of enzymatic activity of archaeal UbiD protein homologs>
A reaction solution (composition: radiolabeled ApAcnX product (tAHMP) 54.6 pmol, archaeal UbiD protein homolog 6.2 μg, sodium phosphate (pH 7.5) 3 μmol, up to 30 μL) was prepared and allowed to react at 60° C. for 1 hour. The reactants were subjected to normal phase TLC analysis in the same manner as in Example 2-2.

<Example 4-3. Validation of Archaeal UbiD Protein Homolog Products>
Reaction mixture (composition: each radiolabeled compound ([2- ¹⁴ C] MVA, [2- ¹⁴ C] MVA5P, [2- ¹⁴ C] MVA5PP, radiolabeled ApAcxX product, [4- ¹⁴ C] IP, [1 - ¹⁴ C]IPP) 0.1 nmol (12,200 dpm), ATP 0.8 μmol, MgCl ₂ 1 μmol, dimethylallyl diphosphate (DMAPP) 3 nmol, sodium phosphate (pH 7.5) 5 μmol, archaea UbiD protein homologue 7.5 μg, Thermoplasma acidophilum Derived IPK 0.1 nmol, Sulfolobus acidocaldarius derived geranylgeranyl diphosphate (GGPP) synthase excess amount, Up to 100 μL) was prepared and reacted at 60° C. for 1 hour. For hydrophobic reactions, extraction with butanol was followed by acid phosphatase treatment at 37° C. overnight. Reversed-phase TLC analysis was performed after pentane extraction. TLC conditions: TLC plate TLC silica gel 60 RP-18 F _254S , developing solvent acetone:water=9:1.

<Example 4-4. Results>
The results of Example 4-2 are shown in FIG. We found that the reaction of the archaeal UbiD protein homologue with the ApAcnX product (tAHMP) yielded a product with a spot identified at the same position as the IP.

The results of Example 4-3 are shown in FIG. Efficient conversion of the ApAcnX product (tAHMP) to GGPP could be confirmed. This indicates that the archaeal UbiD protein homolog had decarboxylase activity on the ApAcnX product (tAHMP) to generate IP.

Example 5. In vivo assay coupled with lycopene production Polynucleotides containing the coding sequences of the enzymes responsible for the novel mevalonate pathway (archaeal AcnX protein and archaeal UbiD protein homolog) found in Examples 1-4 were introduced into E. coli. and examined whether a terpenoid compound (lycopene) is produced in the presence of the substrate. Lycopene is a red-colored compound, and if lycopene is produced, the E. coli pellet will appear red. Specifically, it was carried out as follows. See Table 1 for plasmid notation.

<Example 5-1. Plasmid Construction>
DNA extraction kit Geno Plu (registered trademark) Mini (VIOGENE, USA) was used to extract genomic DNA.

The putative mevalonate kinase (MVK) gene MM_1762 was amplified by PCR using the extracted M. mazei genomic DNA as a template. The amplified MM_1762 was treated with KpnI and XhoI restriction enzymes and ligated with the pBAD18 fragment treated with the same restriction enzymes to prepare pBAD-MVK. The isopentenyl diphosphate isomerase (IDI) gene JW2857 was amplified using pJBEI-2999 (Peralta-Yahya et al. Nature Communications, 2, 483, 2011) as a template DNA, and the E.coli strain ME9783 (Asai et al. The EMBO Journal, 12(8), 3287-3295, 1993). A plasmid into which JW2857 was inserted was extracted by intracellular homologous recombination in Escherichia coli (Oliner et al. Nucleic Acids Research, 21(22), 5192-5197, 1993) and designated as pBAD-mMP2. The putative isopentenyl kinase (IPK) gene MM_1763 was amplified using the genomic DNA of M. mazei as a template, and introduced into Escherichia coli strain ME9783 together with the pBAD-mMP2 fragment cleaved with EcoRI. A plasmid into which MM_1763 was inserted was extracted and designated as pBAD-mMP3.

The putative aconitase X-small subunit (AcnX-S) gene MM_1524 was amplified using the genomic DNA of M. mazei as a template, and introduced into Escherichia coli strain ME9783 together with the pBAD18 fragment cleaved with EcoRI. A plasmid into which MM_1524 was inserted was extracted and designated as pBAD-mUA1. The putative aconitase X-large subunit (AcnX-L) gene MM_1525 was amplified using the genomic DNA of M. mazei as a template and introduced into Escherichia coli strain ME9783 together with the EcoRI-cleaved pBAD-mUA1 fragment. A plasmid into which MM_1525 was inserted was extracted and designated as pBAD-mUA2. The putative UbX gene MM_1871 was amplified using the genomic DNA of M. mazei as a template, and introduced into Escherichia coli strain ME9783 together with the EcoRI-cleaved pBAD-mUA2 fragment. A plasmid into which MM_1871 was inserted was extracted and designated as pBAD-mUA3. The putative UbiD gene MM_1526 was amplified using the genomic DNA of M. mazei as a template, and introduced into Escherichia coli strain ME9783 together with the EcoRI-cleaved pBAD-mUA3 fragment. A plasmid into which MM_1526 was inserted was extracted and designated as pBAD-mUA4. DNA fragments containing MM_1526, MM_1871, MM_1525 and MM_1524 were amplified using pBAD-mUA4 as a template DNA, and introduced into Escherichia coli strain ME9783 together with EcoRI-cleaved pBAD-mMP3 fragment. A plasmid into which MM_1526, MM_1871, MM_1525 and MM_1524 were inserted was extracted and named pBAD-mMP7 (Fig. 5).

The AcnX-S gene APE_2089 was amplified using A. pernix genomic DNA as template DNA, and introduced into Escherichia coli strain ME9783 together with the pBAD18 fragment cleaved with EcoRI. A plasmid into which APE_2089 was inserted was extracted and designated as pBAD-asUA1. Using A. pernix genomic DNA as a template, AcnX-L gene APE_2087.1 was amplified and introduced into Escherichia coli strain ME9783 together with EcoRI-cleaved pBAD-asUA1 fragment. A plasmid containing APE_2087.1 was extracted and named pBAD-asUA2. Prenyl-flavin synthase gene YDR538W (Arunrattanamook et al. Biochemistry, 57(5), 696-700, 2017), which is a homolog of UbiX in S. cerevisiae, was amplified using the genomic DNA of S. cerevisiae as a template DNA, and ligated with EcoRI. It was introduced into Escherichia coli strain ME9783 together with the cleaved pBAD-asUA1 fragment. A YDR538W-inserted plasmid was extracted and named pBAD-asUA3. The UbiD gene APE_2078 was amplified using A. pernix genomic DNA as template DNA, and introduced into E. coli strain ME9783 together with the pBAD-asUA3 fragment cleaved with EcoRI. A plasmid into which APE_2078 was inserted was extracted and designated as pBAD-asUA4. A DNA fragment containing APE_2078, YDR538W, APE_2087.1 and APE_2089 was amplified using pBAD-asUA4 as a template DNA, and introduced into Escherichia coli strain ME9783 together with EcoRI-cleaved pBAD-mMP3 fragment. A plasmid inserted with APE_2078, YDR538W, APE_2087.1 and APE_2089 was extracted and designated as pBAD-asMP7 (Fig. 5).

KOD plus polymerase (TOYOBO, Japan) and the primers shown in Table 2 were used in the above PCR reaction.

<Example 5-2. Lycopene production>
E. coli TOP10 strain was transformed with pACYC-CrtIBE (Hemmi et al. The Journal of Biochemistry, 123(6), 1088-1096, 1998) and pBAD-mMP7 or pBAD-asMP7, and TOP10/pBAD-mMP7/pACYC-CrtIBE A strain TOP10/pBAD-asMP7/pACYC-CrtIBE strain was generated. As a control, TOP10 strain of E. coli was transformed with pACYC-CrtIBE and pBAD-18 to prepare TOP10/pBAD18/pACYC-CrtIBE strain. Each strain was shake-cultured in 5 ml of LB medium (containing 100 mg of ampicillin and 20 mg of tetracycline) at 37° C. overnight. A culture solution of each strain was inoculated into 5 ml of LB medium (containing 100 mg of ampicillin, 20 mg of tetracycline, 0.2% of L-arabinose, and 2.5 mg of mevalonolactone), followed by static culture at 37°C for 48 hours. After culturing, the culture solution was centrifuged at 13000 rpm for 1 min to collect the cells. In addition, the test was performed in triplicate. Table 3 shows the presence or absence of the introduced plasmid and substrate (MVL) for each sample.

The results are shown in FIG. A sample ( In Nos. 10-12 and 16-18), the E. coli pellet was red in color. This indicated that a terpenoid compound (lycopene) was specifically produced in these samples.

Claims (13)

a polynucleotide comprising a coding sequence for an archaeal AcnX protein and a polynucleotide comprising a coding sequence for an archaeal UbiD protein homolog;
The archaeal AcnX protein is a complex protein according to (A) or (B) below:
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 1-2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 3-4, or ( B) A large subunit consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in any of SEQ ID NOS: 1-2 and 90% or more with the amino acid sequence shown in any of SEQ ID NOS: 3-4 a complex protein comprising a small subunit consisting of an amino acid sequence having the identity of and having 5-phosphomevalonate (MVA5P) dehydratase activity,
and the archaeal UbiD protein homolog is a protein according to (C) or (D) below: (C) a protein consisting of the amino acid sequence shown in any one of SEQ ID NOs: 5 to 6, or (D) SEQ ID NO: A protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in any one of 5 to 6 and having trans-anhydro-5-phosphomevalonate (tAHMP) decarboxylase activity,
is
non-archaeal organisms. 2. The non-archaeal organism of claim 1, further comprising a polynucleotide comprising a flavinprenyltransferase coding sequence. 3. The method of claim 1 or 2, wherein the archaeal AcnX protein is a protein from the phylum Crenarchaeota or the phylum Euriachiota, and the archaeal UbiD protein homologue is a protein from the phylum Crenarchaeota or the phylum Euriachiota. A non-archaeal organism as described. A non-archaeal organism according to any one of claims 1 to 3, wherein said archaeal AcnX protein and said archaeal UbiD protein homologue are both proteins from the phylum Crenarchaeota. 5. The non-archaeal organism according to any one of claims 1 to 4, wherein the non-archaeal organism is Enterobacteriaceae, actinomycetes, lactobacilli, clostridia, cyanobacteria, yeasts, algae, filamentous fungi, or plants. . 6. The non-archaeal organism of any of claims 1-5, further comprising polynucleotides comprising coding sequences for other enzymes on the mevalonate pathway. the other enzyme is the group consisting of acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase (MVK), isopentenyl phosphate kinase (IPK), and isopentenyl diphosphate isomerase (IDI) 7. The non-archaeal organism according to claim 6, which is at least one species selected from . The cultured fungus of the non-archaeal organism according to any one of claims 1 to 7 . culturing a non-archaeal organism according to any one of claims 1 to 7, and
From the cultured cells or culture supernatant obtained by the culture, general formula (1):

[In the formula, X represents a phosphate group, a hydroxy group, or hydrogen. ]
A compound represented by and / or general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
A method for producing a mevalonate pathway intermediate or an analog thereof comprising obtaining a compound represented by culturing a non-archaeal organism according to any one of claims 1 to 7, and
From the cultured cells or culture supernatant obtained by the culture,
(a) an isoprenoid compound, and/or (b) general formula (1):

[In the formula, X represents a hydroxy group, a phosphate group or hydrogen. ]
and/or general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
The decarboxylation product of the compound represented by
A method of making a compound, comprising obtaining comprising a coding sequence for an archaeal AcnX protein and a coding sequence for an archaeal UbiD protein homolog;
The archaeal AcnX protein is a complex protein according to (A) or (B) below:
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 1-2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 3-4, or ( B) A large subunit consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in any of SEQ ID NOS: 1-2 and 90% or more with the amino acid sequence shown in any of SEQ ID NOS: 3-4 a complex protein comprising a small subunit consisting of an amino acid sequence having the identity of and having 5-phosphomevalonate (MVA5P) dehydratase activity,
and the archaeal UbiD protein homolog is a protein according to (C) or (D) below: (C) a protein consisting of the amino acid sequence shown in any one of SEQ ID NOs: 5 to 6, or (D) SEQ ID NO: A protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in any one of 5 to 6 and having trans-anhydro-5-phosphomevalonate (tAHMP) decarboxylase activity,
is
an isolated polynucleotide. Contains archaeal AcnX protein,
The archaeal AcnX protein is a complex protein according to (A) or (B) below:
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 1-2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOS: 3-4, or ( B) A large subunit consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in any of SEQ ID NOS: 1-2 and 90% or more with the amino acid sequence shown in any of SEQ ID NOS: 3-4 a complex protein comprising a small subunit consisting of an amino acid sequence having the identity of and having 5-phosphomevalonate (MVA5P) dehydratase activity,
is
MVA5P dehydratase enzymatic agent. contains archaeal UbiD protein homologs,
The archaeal UbiD protein homolog is a protein according to (C) or (D) below: (C) a protein consisting of the amino acid sequence shown in any of SEQ ID NOS: 5-6, or (D) SEQ ID NOS: 5-6 A protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in any one and having trans anhydro 5-phosphomevalonate (tAHMP) decarboxylase activity,
is
tAHMP decarboxylase enzyme agent.

Images