JP2020028240A - Non-archaebacterium organism having novel mevalonate pathway - Google Patents

Abstract

To find out a novel mevalonate pathway, and provide an isoprenoid compound production technology using the pathway.SOLUTION: An archaebacterium organism contains polynucleotide containing a coding sequence of archaebacterium AcnX protein, and polynucleotide containing a coding sequence of archaebacterium UbiD protein homolog.SELECTED DRAWING: None

Description

  The present invention relates to non-archaeal organisms having a novel mevalonate pathway.

  Isoprenoids are the largest group of natural organic compounds in nature, with over 70,000 species believed to exist. Isoprenoids play a physiologically important role in all biological domains. For example, respiratory chain quinones, fat-soluble vitamins such as vitamin A and vitamin K in higher animals, steroids such as constituents of membrane lipids and hormones, carotenoids in higher plants, plant hormones such as abscisic acid and gibberellin, etc. Are typical examples. In addition, all membrane lipids in Archia are composed of hydrocarbon chains by isoprenoids, and are involved in adaptation to the extreme environment.

  Isoprenoids are synthesized using, as precursors, isopentenyl diphosphate (IPP), an active isoprene unit having 5 carbon atoms, and dimethylallyl diphosphate (DMAPP), a structural isomer thereof. The mevalonic acid (MVA) pathway is known as a pathway for synthesizing these precursors. The MVA pathway is a pathway in which acetyl-CoA is used as a starting material to synthesize IPP via MVA. DMAPP is synthesized by isomerization of IPP.

  Isoprenoids are compounds that constitute various substances themselves, such as medicines, vitamins, terpenes, and rubbers, or are raw materials for these substances, and various methods for producing isoprenoids using the mevalonic acid pathway are known (Patent Document 1). ). However, both methods utilize the existing mevalonate pathway (FIG. 1).

JP 2017-148063 A

  The present inventors have focused on finding a novel mevalonate pathway. An object of the present invention is to find a novel mevalonic acid pathway and to provide an isoprenoid compound production technique using the same.

  The present inventor has conducted intensive studies and found that a polynucleotide containing a coding sequence of an archaeal AcnX protein, and a polynucleotide containing a coding sequence of an archaeal UbiD protein homolog, as long as the subject is a non-archaeal organism, Can be solved.

  That is, the present invention includes the following embodiments.

Item 1.
A non-archaeal organism comprising a polynucleotide comprising a coding sequence for an archaeal AcnX protein and a polynucleotide comprising a coding sequence for an archaeal UbiD protein homolog.

Item 2.
Item 2. The non-archaeal organism according to Item 1, further comprising a polynucleotide comprising a coding sequence for flavin prenyl transferase.

Item 3.
Item 3. The archaeal AcnX protein is a protein derived from the phylum Clearchaeota or Juliachiota, and the archaeal UbiD protein homolog is a protein derived from the phylum Clearchaeota or Juliachyota. Non-archaeal organisms.

Item 4.
Item 4. The non-archaeal organism according to any one of Items 1 to 3, wherein the archaeal AcnX protein and the archaeal UbiD protein homolog are both proteins derived from the phylum Clenarchota.

Item 5.
The archaeal AcnX protein is a complex protein according to the following (A) or (B):
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOs: 1 and 2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOs: 3 to 4, or B) A large subunit consisting of an amino acid sequence having 70% or more identity with the amino acid sequence shown in any of SEQ ID NOs: 1 and 2, and 70% or more with the amino acid sequence shown in any of SEQ ID NOs: 3 to 4 A complex protein comprising a small subunit having an amino acid sequence having the same identity as described above, and a complex protein having 5-phosphomevalonate (MVA5P) dehydratase activity;
And the archaeal UbiD protein homolog is a protein described in the following (C) or (D):
(C) a protein consisting of the amino acid sequence shown in any of SEQ ID NOs: 5-6, or (D) consisting of an amino acid sequence having 70% or more identity with the amino acid sequence shown in any of SEQ ID NOs: 5-6. A protein having transanhydro 5-phosphomevalonate (tAHMP) decarboxylase activity, and
Item 5. The non-archaeal organism according to any one of Items 1 to 4.

Item 6.
Item 6. The non-archaeal organism according to any one of Items 1 to 5, wherein the non-archaeal organism is Enterobacteriaceae, actinomycetes, lactic acid bacteria, clostridia, cyanobacteria, yeast, algae, filamentous fungi, or plants.

Item 7.
Item 7. The non-archaeal organism according to any one of Items 1 to 6, further comprising a polynucleotide containing a coding sequence of another enzyme on the mevalonate pathway.

Item 8.
The other enzyme is a group consisting of acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase (MVK), isopentenyl phosphate kinase (IPK), and isopentenyl diphosphate isomerase (IDI). Item 8. The non-archaeal organism according to item 7, which is at least one selected from the group consisting of:

Item 9.
Item 10. A culture of a non-archaeal organism according to any one of Items 1 to 8.

Item 10.
From the culture according to item 9, the compound represented by the general formula (1):

[In the formula, X represents a phosphate group, a hydroxy group, or hydrogen. ]
And / or the general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
A method for producing a mevalonic acid pathway intermediate or an analog thereof, comprising obtaining a compound represented by the formula:

Item 11.
General formula (1):

[In the formula, X represents a hydroxy group, a phosphate group, or hydrogen. ]
And / or the general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
Or a salt thereof, or a solvate thereof.

Item 12.
From the culture according to item 9,
(A) an isoprenoid compound, and / or (b) a general formula (1):

[In the formula, X represents a hydroxy group, a phosphate group, or hydrogen. ]
And / or a general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
A decarboxylation product of the compound represented by
A method for producing a compound, comprising obtaining

Item 13.
An isolated polynucleotide comprising a coding sequence for an archaeal AcnX protein and a coding sequence for an archaeal UbiD protein homolog.

Item 14.
An MVA5P dehydratase enzyme preparation containing an archaeal AcnX protein.

Item 15.
A tAHMP decarboxylase enzyme preparation containing an archaeal UbiD protein homolog.

  According to the present invention, it is possible to provide a technique for producing an isoprenoid compound using a novel mevalonate pathway.

1 shows a schematic diagram of the mevalonic acid pathway. Shaded arrows indicate 5-diphosphomevalonate decarboxylase (DMD) and its homologs. [Fig. 3] Fig. 3 shows analysis results of an enzymatic activity of archaeal AcnX protein (Example 2-2). MVA5P: 5-phosphomevalonic acid, ApAcnX: Recombinant AcnX protein derived from Aeropyrum pernix. The analysis result of the enzymatic activity of archaeal UbiD protein homolog (Example 4-2) is shown. anhydro MVA5P: trans anhydro 5-phosphomevalonic acid (tAHMP), IP: isopentenyl phosphate, purified enzyme solution: purified UbiD protein homolog solution. The verification result of the archaeal UbiD protein homolog product (Example 4-3) is shown. MVA: mevalonic acid, MVA5P: 5-phosphomevalonic acid, MVA5PP: 5-diphosphomevalonic acid, anhydro MVA5P: trans anhydro 5-phosphomevalonic acid (tAHMP), IP: isopentenyl phosphate, IPP: isopentenyl diphosphate. GGOH: Geranylgeraniol The scheme for preparing the plasmid prepared in Example 5-1 is shown. The result of a lycopene production test (Example 5-2) is shown. The numbers indicate the sample numbers shown in Table 3.

  In this specification, the expressions “contain” and “include” include the concepts of “contain”, “include”, “consisting essentially of”, and “consisting only of”.

  As used herein, the term "identity" of an amino acid sequence refers to the degree of coincidence of two or more comparable amino acid sequences with each other. Thus, the higher the identity between certain two amino acid sequences, the higher the identity or similarity between those sequences. The level of amino acid sequence identity is determined, for example, using FASTA, a tool for sequence analysis, using default parameters. Alternatively, an algorithm BLAST by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc. Natl. Acad. Sci. USA. 87: 2264-2268 (1990) KarlinS, Altschul SF, "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc. Natl. Acad. Sci. USA. 90: 5873-7 (1993)). A program called BLASTX based on such a BLAST algorithm has been developed. Specific techniques for these analysis methods are known, and may be referred to the website of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/). The “identity” of the nucleotide sequence is also defined according to the above. As used herein, “conservative substitution” means that an amino acid residue is substituted with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having a basic side chain such as lysine, arginine, and histidine is a conservative substitution. In addition, aspartic acid, amino acid residues having an acidic side chain such as glutamic acid; glycine, asparagine, glutamine, serine, threonine, tyrosine, amino acid residues having a non-charged polar side chain such as cysteine; alanine, valine, leucine, isoleucine, Amino acid residues having non-polar side chains such as proline, phenylalanine, methionine and tryptophan; amino acid residues having β-branched side chains such as threonine, valine and isoleucine; having aromatic side chains such as tyrosine, phenylalanine, tryptophan and histidine Similarly, substitution between amino acid residues corresponds to conservative substitution.

In the present specification, known chemical modifications may be applied to polynucleotides such as DNA and RNA, as exemplified below. In order to prevent degradation by a hydrolase such as nuclease, the phosphate residue (phosphate) of each nucleotide is replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate or phosphorodithionate. Can be. Further, the hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide is represented by -OR (R is, for example, CH ₃ (2′-O-Me), CH ₂ CH ₂ OCH ₃ (2′-O-MOE), CH ₂ CH ₂ NHC (NH) NH ₂ , CH ₂ CONHCH ₃ , CH ₂ CH ₂ CN, etc.). Further, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or a cationic functional group at the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl. Is mentioned. Furthermore, those in which the phosphate moiety or the hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, an acetyl group, and the like can be given, but not limited thereto. In addition, BNA (LNA) or the like in which the conformation of the sugar moiety is fixed to the N-type by crosslinking the 2 ′ oxygen and 4 ′ carbon of the sugar moiety of the nucleotide can also be preferably used. In the present specification, the term “archaea” is not particularly limited and includes, for example, Clenarchota, Uriaquiota, Taumarchota, Aiguachiota, Koruarchota, Batachiota, Loki Archaea such as Archaeota are preferred, and archaea such as Clenarchota and Juliachiota are preferred. Archaea of the phylum Clenarchota preferably include archaea of the family Desulfurocox, more preferably archaea of the genus Aeropyrum, and even more preferably Aeropyrum pernix. Archaea of the phylum Uriliachiota preferably include archaea of the family Methanosarcina, more preferably archaea of the genus Methanosarcina, and even more preferably Methanosarcina mazei.

  In the present specification, R in the ester (—COOR) is, for example, a C1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl, and n-butyl; for example, C3-8 cycloalkyl such as cyclopentyl and cyclohexyl. Groups; for example, C6-12 aryl groups such as phenyl and α-naphthyl; phenyl-C1-2 alkyl groups such as benzyl and phenethyl; and C7 such as α-naphthyl-C1-2 alkyl groups such as α-naphthylmethyl. -14 aralkyl group; pivaloyloxymethyl group and the like are used.

1． Non-archaeal organisms In one aspect, the invention provides a polynucleotide comprising a coding sequence for an archaeal AcnX protein (sometimes referred to herein as an "AcnX-encoding polynucleotide"), and an archaeal UbiD protein homolog. Non-archaeal organisms (also referred to herein as "organisms of the present invention"), including polynucleotides comprising the coding sequence of (UbiD homolog encoding polynucleotide). There is). Hereinafter, this will be described.

1-1. Archaeal AcnX Protein Archaeal AcnX protein is a complex protein composed of a large subunit (AcnXL) and a small subunit (AcnXS), and is not particularly limited as long as it is an archaebacterial AcnX protein.

  Specific examples of archaeal AcnX proteins are shown in Table 1 below. For each ID, an ID including an underscore (_) is an ID in MBGD (mgbd.genome.ad.jp). The AcnX protein in archaea other than the species shown in Table 1 can be easily determined by searching for identity and homology.

  The archaeal AcnX protein may have a mutation introduced into the endogenous protein as long as it has 5-phosphomevalonate (MVA5P) dehydratase activity. Here, MVA5P dehydratase activity is obtained by converting MVA5P into the formula:

It is an activity of converting into a compound represented by the formula (transanhydro 5-phosphomevalonic acid (tAHMP)).

  The presence or absence of MVA5P dehydratase activity is determined by reacting the substrate (MVA5P) with the protein to be determined, analyzing the reaction product (eg, by chromatography), and examining whether the reaction product contains tAHMP. Can be determined. Specifically, for example, it can be determined by the method described in the second embodiment.

  The mutant protein is preferably 70% or more (preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, even more preferably 97% or more, of the amino acid sequence of the endogenous archaeal AcnX large subunit. Particularly preferably, a protein consisting of an amino acid sequence having an identity of 99% or more, and 70% or more (preferably 80% or more, more preferably 90% or more, and still more preferably) the amino acid sequence of an endogenous archaeal AcnX small subunit. Is a complex protein comprising an amino acid sequence having an identity of 95% or more, still more preferably 97% or more, particularly preferably 99% or more), and a complex protein having MVA5P dehydratase activity. . Mutations include, for example, substitutions, deletions, additions, insertions, and the like, preferably substitutions, and more preferably conservative substitutions. The number of mutant amino acids is preferably one or more, more preferably 1 to 8, still more preferably 1 to 4, and still more preferably 1.

One preferred embodiment of the archaeal AcnX protein is a complex protein according to (A) or (B) below:
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOs: 1 and 2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOs: 3 to 4, or B) 70% or more (preferably 80% or more, more preferably 90% or more, further preferably 95% or more, still more preferably 97% or more, particularly preferably 70% or more of the amino acid sequence shown in any of SEQ ID NOS: 1 and 2; A large subunit consisting of an amino acid sequence having an identity of 99% or more, and 70% or more (preferably 80% or more, more preferably 90% or more) of the amino acid sequence shown in any of SEQ ID NOS: 3 to 4, Complex tandem comprising an amino acid sequence having an identity of 95% or more, still more preferably 97% or more, and particularly preferably 99% or more. A complex protein that is protein and has MVA5P dehydratase activity,
It is. Mutations include, for example, substitutions, deletions, additions, insertions, and the like, preferably substitutions, and more preferably conservative substitutions. The number of mutant amino acids is preferably one or more, more preferably 1 to 8, still more preferably 1 to 4, and still more preferably 1.

  Note that SEQ ID NO: 1 is AcnXL derived from A. pernix and is an amino acid sequence represented by ID: APE_2087.1 on the KEGG database. SEQ ID NO: 2 is AcnXL derived from M. mazei, and is an amino acid sequence represented by ID: MM_1525 on the KEGG database. SEQ ID NO: 3 is AcnX S derived from A. pernix, and is an amino acid sequence represented by ID: APE — 2089 on the KEGG database. SEQ ID NO: 4 is AcnX S derived from M. mazei, and is an amino acid sequence represented by ID: MM_1524 on the KEGG database.

  The archaeal AcnX protein may be chemically modified as long as it has the above-mentioned "activity".

Archaeal AcnX protein, C-terminal, carboxyl group (-COOH), a carboxylate (-COO ^-), may be any of an amide (-CONH ₂₎ or an ester (-COOR).

  Archaeal AcnX proteins may have amidated or esterified carboxyl groups (or carboxylate) other than the C-terminus. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.

Furthermore, in the archaeal AcnX protein, the amino group of the N-terminal amino acid residue is protected with a protecting group (for example, a C _1-6 acyl group such as a C _1-6 alkanoyl such as a formyl group or an acetyl group). One, an N-terminal glutamine residue that can be generated by cleavage in vivo, pyroglutamine-oxidized, a substituent on the side chain of an amino acid in the molecule (e.g., -OH, -SH, amino group, imidazole group, Indole group, guanidino group, etc.) protected with an appropriate protecting group (eg, C _1-6 acyl group such as C _1-6 alkanoyl group such as formyl group and acetyl group), or a sugar chain bound Complex proteins such as so-called glycoproteins are also included.

  The archaeal AcnX protein may be a protein to which a protein or peptide such as a known protein tag or signal sequence is added, as long as it has the above-mentioned “activity”. Examples of the protein tag include biotin, His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, PA tag and the like.

  Archaeal AcnX proteins may be in the form of salts with acids or bases. The salt is not particularly limited, and any of an acidic salt and a basic salt can be employed. Examples of acidic salts include inorganic salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; acetate, propionate, tartrate, fumarate, maleate, and apple. Organic acid salts such as acid salts, citrate salts, methanesulfonic acid salts, and paratoluenesulfonic acid salts; and amino acid salts such as aspartic acid salts and glutamate. Examples of the basic salt include alkali metal salts such as sodium salt and potassium salt; and alkaline earth metal salts such as calcium salt and magnesium salt.

  Archaeal AcnX protein may be in the form of a solvate. The solvent is not particularly limited, and includes, for example, water, ethanol, glycerol, acetic acid and the like.

1-2. Archaeal UbiD protein homologue The archaeal UbiD protein homolog is not particularly limited as long as it is an archaeal UbiD protein homolog.

  Specific examples of archaeal UbiD protein homologs are shown in Table 1 above. UbiD protein homologs in archaea other than the species shown in Table 1 can be easily determined by searching for identity and homology.

  The archaeal UbiD protein homolog may have a mutation introduced into an endogenous protein as long as it has tAHMP decarboxylase activity. Here, the tAHMP decarboxylase activity has the formula:

Is an activity to convert the compound tAHMP represented by the formula into isopentenyl phosphate (IP).

  The presence or absence of tAHMP decarboxylase activity is determined by reacting the substrate (tAHMP) with the protein to be determined, analyzing the reaction product (eg, by chromatography), and examining whether the reaction product contains IP. Thus, the determination can be made. Specifically, for example, it can be determined by the method described in the fourth embodiment.

  The mutant protein is preferably 70% or more (preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, even more preferably 97% or more, particularly the amino acid sequence of the endogenous archaeal UbiD protein homolog. (Preferably 99% or more). It is a protein having an amino acid sequence having the same identity and having tAHMP decarboxylase activity. Mutations include, for example, substitutions, deletions, additions, insertions, and the like, preferably substitutions, and more preferably conservative substitutions. The number of mutant amino acids is preferably one or more, more preferably 1 to 8, still more preferably 1 to 4, and still more preferably 1.

One preferred embodiment of the archaeal UbiD protein homolog is a complex protein according to the following (C) or (D):
(C) a protein consisting of the amino acid sequence shown in any one of SEQ ID NOs: 5 to 6, or (D) 70% or more (preferably 80% or more, more preferably Is a protein comprising an amino acid sequence having an identity of 90% or more, more preferably 95% or more, still more preferably 97% or more, particularly preferably 99% or more, and having tAHMP decarboxylase activity;
It is. Mutations include, for example, substitutions, deletions, additions, insertions, and the like, preferably substitutions, and more preferably conservative substitutions. The number of mutant amino acids is preferably one or more, more preferably 1 to 8, still more preferably 1 to 4, and still more preferably 1.

  Note that SEQ ID NO: 5 is a homolog of UbiD protein derived from A. pernix, and has an amino acid sequence represented by ID: APE — 2078 in the KEGG database. SEQ ID NO: 6 is a UbiD protein homolog derived from M. mazei, and has an amino acid sequence represented by ID: MM_1526 on the KEGG database.

  The archaeal UbiD protein homolog may be chemically modified as long as it has the above "activity".

Archaeal UbiD protein homologues, C-terminal, carboxyl group (-COOH), a carboxylate (-COO ^-), may be any of an amide (-CONH ₂₎ or an ester (-COOR).

  In the archaeal UbiD protein homolog, the carboxyl group (or carboxylate) other than the C-terminal may be amidated or esterified. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.

Further, in the archaeal UbiD protein homolog, the amino group of the N-terminal amino acid residue is protected with a protecting group (for example, a C _1-6 acyl group such as a C _1-6 alkanoyl such as a formyl group or an acetyl group). Or an N-terminal glutamine residue which can be generated by cleavage in vivo, which is pyroglutamine-oxidized, or a substituent (for example, -OH, -SH, amino group, imidazole group) on the side chain of an amino acid in the molecule. , An indole group, a guanidino group, etc.) are protected with a suitable protecting group (eg, a C _1-6 acyl group such as a C _1-6 alkanoyl group such as a formyl group or an acetyl group), or a sugar chain is protected. Complex proteins such as so-called glycoproteins bound thereto are also included.

  The archaeal UbiD protein homolog may be one to which a protein or peptide such as a known protein tag or signal sequence is added as long as it has the above-mentioned "activity". Examples of the protein tag include biotin, His tag, FLAG tag, Halo tag, MBP tag, HA tag, Myc tag, V5 tag, PA tag and the like.

  Archaeal UbiD protein homologs may be in the form of salts with acids or bases. The salt is not particularly limited, and any of an acidic salt and a basic salt can be employed. Examples of acidic salts include inorganic salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; acetate, propionate, tartrate, fumarate, maleate, and apple. Organic acid salts such as acid salts, citrate salts, methanesulfonic acid salts, and paratoluenesulfonic acid salts; and amino acid salts such as aspartic acid salts and glutamate. Examples of the basic salt include alkali metal salts such as sodium salt and potassium salt; and alkaline earth metal salts such as calcium salt and magnesium salt.

  Archaeal UbiD protein homologs may be in the form of a solvate. The solvent is not particularly limited, and includes, for example, water, ethanol, glycerol, acetic acid and the like.

1-3. AcnX encoding polynucleotide, UbiD homolog encoding polynucleotide
An AcnX-encoding polynucleotide comprises a coding sequence for an archaeal AcnX protein. UbiD homolog encoding polynucleotides include coding sequences for archaeal UbiD protein homologs.

The archaeal AcnX protein coding sequence is not particularly limited as long as it is a polynucleotide consisting of a base sequence encoding the archaeal AcnX protein. The AcnXL coding sequence includes, for example, a base sequence described in the following (PL) or (QL):
70% or more (preferably 80% or more, more preferably 90% or more, more preferably 95% or more) of the nucleotide sequence shown in (PL) SEQ ID NOS: 39 to 40 or the nucleotide sequence shown in (QL) SEQ ID NOs: 39 to 40 % Or more, more preferably 97% or more, particularly preferably 99% or more). Examples of the AcnX S coding sequence include, for example, the following (PS) or (QS): :
70% or more (preferably 80% or more, more preferably 90% or more, more preferably 95% or more) of the nucleotide sequence shown in (PS) SEQ ID NOS: 41 to 42 or the nucleotide sequence shown in (QS) SEQ ID NOs: 41 to 42. % Or more, more preferably 97% or more, particularly preferably 99% or more). Mutations include, for example, substitutions, deletions, additions, insertions, etc., preferably substitutions. The number of mutant bases is preferably one or more, more preferably 1 to 8, still more preferably 1 to 4, and still more preferably 1.

  Note that SEQ ID NO: 39 is an AcnXL coding sequence derived from A. pernix, and is a base sequence represented by ID: APE_2087.1 on the KEGG database. SEQ ID NO: 40 is an AcnXL coding sequence derived from M. mazei, and is a base sequence represented by ID: MM_1525 on the KEGG database. SEQ ID NO: 41 is an AcnX S coding sequence derived from A. pernix, and is a base sequence represented by ID: APE — 2089 on the KEGG database. SEQ ID NO: 42 is an AcnX S coding sequence derived from M. mazei, and is a base sequence represented by ID: MM_1524 on the KEGG database.

The archaeal UbiD protein homolog coding sequence is not particularly limited as long as it is a polynucleotide consisting of a base sequence encoding the archaeal UbiD protein homolog. Archebacterial UbiD protein homolog coding sequences include, for example, the following nucleotide sequences (X) or (Y):
(X) 70% or more (preferably 80% or more, more preferably 90% or more, and still more preferably 95% or more of the nucleotide sequence shown in SEQ ID NOS: 43 to 44 or (Y) the nucleotide sequence shown in SEQ ID NOS: 43 to 44) % Or more, more preferably 97% or more, particularly preferably 99% or more). Mutations include, for example, substitutions, deletions, additions, insertions, etc., preferably substitutions. The number of mutant bases is preferably one or more, more preferably 1 to 8, still more preferably 1 to 4, and still more preferably 1.

  Note that SEQ ID NO: 43 is a UbiD protein homologue coding sequence derived from A. pernix, and is a base sequence represented by ID: APE_2078 in the KEGG database. SEQ ID NO: 44 is a UbiD protein homologue coding sequence derived from M. mazei, and is a base sequence represented by ID: MM_1526 on the KEGG database.

  The polynucleotide, in one embodiment thereof, comprises a promoter upstream of the coding sequence for expressing the archaeal AcnX protein, an archaeal UbiD protein homolog. The promoter is not particularly limited and can be appropriately selected depending on the host. Examples of the promoter include tryptophan promoters such as trc and tac, lac promoter, T7 promoter, T5 promoter, T3 promoter, SP6 promoter, arabinose inducible promoter, cold shock promoter, tetracycline inducible promoter and the like. Other examples include TDH3 promoter, GAL10 promoter, CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, CAG promoter and the like.

  The polynucleotide may contain other elements as necessary (eg, a multiple cloning site (MCS), a drug resistance gene, an origin of replication, etc.). For example, in the case where the polynucleotide is arranged in the order of the promoter, the archaeal AcnX protein coding sequence and / or the archaeal UbiD protein homologous coding sequence from the 5 'side, preferably between the promoter and the coding sequence (preferably MCS is arranged on the 3 'side (preferably adjacent) of the coding sequence, adjacent to one or both of them. The MCS is not particularly limited as long as it contains a plurality (for example, 2 to 50, preferably 2 to 20, and more preferably 2 to 10) of restriction enzyme sites.

  The polynucleotide may constitute a vector. The type of the vector is not particularly limited, and is appropriately selected depending on the host. For example, in Escherichia coli, a ColE1-based plasmid typified by a pBR322 derivative, a pACYC-based plasmid having a p15A origin, a pSC-based plasmid, a Bac-based mini-F plasmid derived from F factor and the like can be mentioned.

  The AcnX-encoding polynucleotide and the UbiD homolog-encoding polynucleotide may be separate polynucleotides, respectively, or may be one (one molecule) polynucleotide in total.

  The AcnX-encoding polynucleotide and UbiD homolog-encoding polynucleotide may be integrated into the genome of the non-archaeal organism, or may be present outside the genome.

  Each of the AcnX-encoding polynucleotide and the UbiD homolog-encoding polynucleotide may be a single species or a combination of two or more species.

  The above-mentioned polynucleotide can be easily prepared according to a known genetic engineering technique. For example, it can be prepared using PCR, restriction enzyme cleavage, DNA ligation technology and the like.

1-4. Flavin prenyl transferase-encoding polynucleotide The organism of the present invention preferably comprises a polynucleotide comprising a flavin prenyl transferase-encoding sequence (sometimes referred to herein as "flavin prenyl transferase-encoding polynucleotide"). Thus, it is considered that the activity of the archaeal UbiD protein homolog can be further enhanced.

  The flavin prenyltransferase is not particularly limited, and may be a UbiX protein homolog derived from archaebacteria or a flavin prenyl transferase derived from other organisms (for example, yeast YDR538W or the like).

  Specific examples of archaeal UbiX protein homologs are shown in Table 1 below. UbiX protein homologs in archaea other than the species shown in Table 1 can also be easily determined by searching for identity and homology.

  The flavin prenyltransferase may be one in which a mutation is introduced into an endogenous protein as long as it has flavin prenyl transferase activity. The mutant protein is preferably 70% or more (preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, still more preferably 97% or more, particularly preferably 99% or more of the amino acid sequence of flavin prenyltransferase. Above) and a flavin prenyltransferase activity. Mutations include, for example, substitutions, deletions, additions, insertions, and the like, preferably substitutions, and more preferably conservative substitutions. The number of mutant amino acids is preferably one or more, more preferably 1 to 8, still more preferably 1 to 4, and still more preferably 1.

  Flavin prenyltransferase may be in the form of a chemically modified form, a known protein tag, a form to which a protein or peptide such as a signal sequence is added, a salt form, or a solvate, as long as it has the above-mentioned “activity”. Is also good. These modes are the same as the above “1-1” and “1-2”.

  The flavin prenyl transferase-encoding polynucleotide may be a separate polynucleotide from the AcnX-encoding polynucleotide and the UbiD homolog-encoding polynucleotide, or may be one (one molecule) polynucleotide in combination with either or both of them. You may. The flavin prenyl transferase-encoding polynucleotide may be integrated into the genome of a non-archaeal organism, or may be present outside the genome. In addition, the flavin prenyl transferase-encoding polynucleotide is the same as in the above “1-1” and “1-2”.

  The above-mentioned polynucleotide can be easily prepared according to a known genetic engineering technique. For example, it can be prepared using PCR, restriction enzyme cleavage, DNA ligation technology and the like.

1-5. Polynucleotides Encoding Other Enzymes The organism of the present invention includes polynucleotides encoding other enzymes as necessary (for example, depending on the target compound produced using the organism).

  Examples of other enzymes include acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase (MVK), isopentenyl phosphate kinase (IPK), and isopentenyl diphosphate isomerase (IDI). And enzymes on the mevalonate pathway. In addition, various enzymes on the isoprenoid compound synthesis pathway can be mentioned.

  Other enzymes may be used alone or in combination of two or more.

  The polynucleotide encoding the other enzyme may be a separate polynucleotide from the AcnX-encoding polynucleotide and the UbiD homolog-encoding polynucleotide, or one (one molecule) of the polynucleotide in combination with either or both of them. It may be. A polynucleotide encoding another enzyme may be integrated into the genome of a non-archaeal organism, or may be present outside the genome. Other than that, the polynucleotides encoding other enzymes are the same as in the above “1-1” and “1-2”.

  The above-mentioned polynucleotide can be easily prepared according to a known genetic engineering technique. For example, it can be prepared using PCR, restriction enzyme cleavage, DNA ligation technology and the like.

1-6. The biological organism is not particularly limited as long as it is a non-archaeal organism, that is, an organism of a species other than archaea. The non-archaeal organism is not particularly limited as long as it is an organism (including cells) that can drive the mevalonate pathway by endogenous and / or exogenous factors. Examples of the organism include bacteria such as Enterobacteriaceae, fungi such as yeast, insect cells, animal cells, plant cells, and plants such as algae.

  Examples of the bacteria include gram-positive bacteria and gram-negative bacteria.

  Examples of the gram-positive bacteria include Bacillus bacteria, Listeria bacteria, Staphylococcus bacteria, Streptococcus bacteria, Enterococcus bacteria, Clostridium bacteria, and the like. , Bacteria of the genus Corynebacterium, bacteria of the genus Streptomyces, and the like, and bacteria of the genus Bacillus, bacteria of the genus Corynebacterium, actinomycetes, and lactic acid bacteria are preferred.

  Examples of the bacterium belonging to the genus Bacillus include Bacillus subtilis, Bacillus anthracis, and Bacillus cereus, and Bacillus subtilis is more preferable.

  Examples of the bacteria belonging to the genus Corynebacterium include Corynebacterium glutamicum, Corynebacterium efficiens, Corynebacterium callunae, and the like, and Corynebacterium glutamicum. Is more preferred.

  Examples of gram-negative bacteria include Escherichia bacteria, Pantoea bacteria, Salmonella bacteria, Vibrio bacteria, Serratia bacteria, Enterobacter bacteria, and the like. Preferred are bacteria belonging to the genus Escherichia, bacteria belonging to the genus Pantoea, bacteria belonging to the genus Enterobacter, cyanobacteria and the like.

  As the bacterium belonging to the genus Escherichia, Escherichia coli is preferable.

  Examples of the bacteria belonging to the genus Pantoea include Pantoea ananatis, Pantoea stewartii, Pantoea agglomerans, Pantoea citrea, and Pantoea anatatis. Pantoea ananatis and Pantoea citrea are preferred.

  Examples of the bacteria belonging to the genus Enterobacter include Enterobacter agglomerans, Enterobacter aerogenes, and the like, with Engerobacter aerogenes being preferred.

  Fungi include microorganisms of the genera Saccharomyces, Schizosaccharomyces, Yarrowia, Trichoderma, Aspergillus, Fusarium, and Mucor. Microorganisms and filamentous fungi of the genus Saccharomyces, the genus Schizosaccharomyces, the genus Yarrowia, or the genus Trichoderma are preferred.

  The Saccharomyces (Saccharomyces) microorganisms of the genus, Saccharomyces carlsbergensis (Saccharomyces carlsbergensis), Saccharomyces cerevisiae (Saccharomyces cerevisiae), Saccharomyces Deer statics (Saccharomyces diastaticus), Saccharomyces Dougurashi (Saccharomyces douglasii), Saccharomyces Kuruibera (Saccharomyces kluyveri), Saccharomyces norbensis, and Saccharomyces oviformis, with Saccharomyces cerevisiae being preferred.

  As the microorganism belonging to the genus Schizosaccharomyces, Schizosaccharomyces pombe is preferable.

  As a microorganism of the genus Yarrowia, Yarrowia lipolytica is preferable.

  Examples of microorganisms belonging to the genus Trichoderma include Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma reema de. And Trichoderma reesei is preferred.

  The organism of the present invention can be produced according to or according to a known method, for example, by introducing the above-described polynucleotide into the organism, by a transformation method, or the like.

2． Culture, mevalonate pathway intermediate or analog thereof, isoprenoid compound or decarboxylation product The present invention provides, in some embodiments thereof, a culture of the cell of the present invention, production of mevalonate pathway intermediate or analog thereof. And a method for producing an isoprenoid compound or a decarboxylation product. Hereinafter, these will be described.

2-1. Culture By culturing the organism of the present invention, a culture can be obtained. An example of a culture method when the organism of the present invention is a microorganism will be described below. Even when the organism of the present invention is a relatively large organism, a known culture method according to the species can be employed using a nutrient-containing medium in the following culture method.

  The medium for culturing the organism of the present invention preferably contains a carbon source for conversion to mevalonic acid or isoprene. Examples of the carbon source include carbohydrates such as monosaccharides, disaccharides, oligosaccharides, and polysaccharides; invert sugars obtained by hydrolyzing sucrose; glycerol; one having one carbon atom such as methanol, formaldehyde, formate, carbon monoxide, and carbon dioxide. (Hereinafter referred to as C1 compound); oils such as corn oil, palm oil and soybean oil; acetate; animal fats and oils; animal oils; fatty acids such as saturated fatty acids and unsaturated fatty acids; lipids; phospholipids; glycerolipids; Glycerin fatty acid esters such as diglyceride and triglyceride; polypeptides such as microbial proteins and vegetable proteins; renewable carbon sources such as hydrolyzed biomass carbon sources; yeast extracts; and combinations thereof. As the nitrogen source, inorganic ammonium salts such as ammonium sulfate, ammonium chloride and ammonium phosphate, organic nitrogen such as soybean hydrolysate, ammonia gas, aqueous ammonia and the like can be used. As organic trace nutrients, it is desirable to include required substances such as vitamin B1, L-homoserine, yeast extract and the like in appropriate amounts. In addition to these, small amounts of potassium phosphate, magnesium sulfate, iron ions, manganese ions, and the like may be added as needed. The medium used in the present invention may be any of a natural medium and a synthetic medium as long as the medium contains a carbon source, a nitrogen source, inorganic ions, and if necessary, other organic trace components.

  Examples of the monosaccharides include trioses such as ketotriose (dihydroxyacetone) and aldotriose (glyceraldehyde); tetroses such as ketotetroose (erythrulose) and aldotetroose (erythrose, threose); Pentoses such as ribose, arabinose, xylose and lyxose) and deoxy sugars (deoxyribose); ketohexose (psicose, fructose, sorbose, tagatose) and aldhexose (allose, altrose, glucose, mannose, gulose, idose, galactose, talose) ), Deoxysugars (fucose, fucrose, rhamnose) and the like; heptose such as sedoheptulose, fructose, manno Scan, galactose, C6 sugars such as glucose; xylose, carbohydrates C5 sugars arabinose and the like are preferable.

  Examples of the disaccharide include sucrose, lactose, maltose, trehalose, turanose, cellobiose and the like, and sucrose and lactose are preferred.

  Examples of the oligosaccharides include trisaccharides such as raffinose, melezitose, and maltotriose; tetrasaccharides such as acarbose and stachyose; and other oligosaccharides such as fructooligosaccharide (FOS), galactooligosaccharide (GOS), and mannan oligosaccharide (MOS). No.

  Examples of the polysaccharide include glycogen, starch (amylose, amylopectin), cellulose, dextrin, and glucan (β1,3-glucan). Starch and cellulose are preferred.

  Microbial proteins include polypeptides that can be obtained from yeast or bacteria.

  Vegetable proteins include polypeptides that can be obtained from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, cottonseed, palm kernel oil, olives, safflower, sesame, linseed.

  Examples of lipids include substances containing one or more C4 or more saturated or unsaturated fatty acids.

  As the oil, C4 or more saturated, unsaturated fatty acids containing one or more, lipids that are liquid at room temperature are preferred, soybean, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, cottonseed, palm kernel oil, Olive, safflower, sesame, flaxseed, oily microbial cells, peanut, or lipids obtainable from a combination of two or more thereof.

  Examples of the fatty acid include compounds represented by the formula RCOOH (“R” represents a hydrocarbon group).

  Unsaturated fatty acids are compounds having at least one carbon-carbon double bond at “R”, and include oleic acid, vaccenic acid, linoleic acid, palmiteridic acid, arachidonic acid and the like.

  The saturated fatty acid is a compound in which “R” is a saturated aliphatic group, and examples thereof include docosanoic acid, icosanoic acid, octadecanoic acid, hexadecanoic acid, tetradecanoic acid, and dodecanoic acid.

  Among them, those containing one or more C2 to C22 fatty acids are preferable, and those containing C12 fatty acids, C14 fatty acids, C16 fatty acids, C18 fatty acids, C20 fatty acids, and C22 fatty acids are more preferable.

  Examples of the carbon source include salts, derivatives, and salts of these fatty acids. Examples of the salt include a lithium salt, a potassium salt, a sodium salt and the like.

  Examples of the carbon source include a combination of lipids, oils, fats, fatty acids, glycerin fatty acid esters, and carbohydrates such as glucose.

  Renewable carbon sources include hydrolyzed biomass carbon sources.

  Biomass carbon sources include wood, paper, and pulp waste, cellulosic substrates such as leafy plants and pulp; and plant parts such as stalks, grains, roots and tubers.

  Plants used as a biomass carbon source include corn, wheat, rye, sorghum, triticale, rice, millet, barley, legumes such as cassava, peas, potato, sweet potato, banana, sugar cane, tapioca and the like.

  When a renewable carbon source such as biomass is added to the medium, pretreatment is preferably performed. Examples of pretreatment include enzymatic pretreatment, chemical pretreatment, and a combination of enzymatic pretreatment and chemical pretreatment.

  In an exemplary method for culturing the organism of the present invention according to the present invention, the organism is preferably cultured in a standard medium containing physiological saline and nutrients.

  The culture medium is not particularly limited, and includes a commercially available ready-made medium such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, and Yeast medium (YM) broth. A medium suitable for culturing a specific host can be appropriately selected and used.

  The cell culture medium contains, in addition to a suitable carbon source, suitable minerals, salts, cofactors, buffers and components known to those skilled in the art to be suitable for culture or to enhance isoprene production. Is desirable.

  In the organism of the present invention, in order to maintain the expression of the target protein, it is preferable that sugars, metal salts, antibacterial substances and the like are added to the medium.

  The culture conditions of the organism of the present invention are not particularly limited as long as the target protein can be expressed, and standard culture conditions can be used.

The culturing temperature is preferably 20 ° C. to 37 ° C., the gas composition is preferably such that the CO ₂ concentration is about 6% to about 84%, and the pH is preferably about 5 to about 9.

  The organism of the present invention is preferably cultured under aerobic, anoxic, or anaerobic conditions depending on the nature of the host.

  Examples of the method for culturing an organism of the present invention include a method of culturing using a known fermentation method such as a batch culture method, a fed-batch culture method, or a continuous culture method.

2-2. Method for producing mevalonate pathway intermediate or analog thereof By culturing the organism of the present invention under appropriate conditions, a novel mevalonate pathway intermediate or analog thereof, specifically, general formula (1):

[In the formula, X represents a phosphate group, a hydroxy group, or hydrogen. ]
And / or the general formula (2):

[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
The compound represented by is obtained.

  A novel mevalonate pathway intermediate or an analog thereof can be obtained by recovering the compound represented by the general formula (1) and / or the compound represented by the general formula (2) from a culture according to a known method. Can be obtained.

  The compound represented by the general formula (1) and / or the compound represented by the general formula (2) may be in the form of a salt with an acid or a base. The salt is not particularly limited, and any of an acidic salt and a basic salt can be employed. Examples of acidic salts include inorganic salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; acetate, propionate, tartrate, fumarate, maleate, and apple. Organic acid salts such as acid salts, citrate salts, methanesulfonic acid salts, and paratoluenesulfonic acid salts; and amino acid salts such as aspartic acid salts and glutamate. Examples of the basic salt include alkali metal salts such as sodium salt and potassium salt; and alkaline earth metal salts such as calcium salt and magnesium salt.

  The compound represented by the general formula (1) and / or the compound represented by the general formula (2) may be in the form of a solvate. The solvent is not particularly limited, and includes, for example, water, ethanol, glycerol, acetic acid and the like.

2-3. Method for producing isoprenoid compound or decarboxylation product The isoprenoid compound is produced by culturing the organism of the present invention under appropriate conditions. Further, by culturing the organism of the present invention under appropriate conditions, the decarboxylation products of the compounds represented by the general formula (1) and the compounds represented by the general formula (2) other than tAHMP can be obtained. It can also be caused.

Isoprenoid compound, composed of one or more isoprene units having a molecular formula (C ₅ H _{8) n.} The precursor of the isoprene unit is isopentenyl pyrophosphate or dimethylallyl pyrophosphate. 30,000 isoprenoid compounds have been identified and new compounds have been identified. Isoprenoids are also known as terpenoids. The difference between terpenes and terpenoids is that terpenes are hydrocarbons, whereas terpenoids contain additional functional groups. Terpenes are classified by the number of isoprene units in the molecule [eg, hemiterpenes (C5), monoterpenes (C10), sesquiterpenes (C15), diterpenes (C20), sesterterpenes (C25), triterpenes (C30), Sescal terpenes (C35), tetraterpenes (C40), polyterpenes, norisoprenoids]. Monoterpenes include, for example, pinene, nerol, citral, camphor, menthol, limonene, and linalool. Sesquiterpenes include, for example, nerolidol and farnesol. Diterpenes include, for example, phytol, and vitamin A1. Squalene is an example of a triterpene, and carotene (provitamin A1) is a tetraterpene. The isoprenoid compound may be various substances such as a medicine, a vitamin, a terpene, a rubber, or the like, or may be a compound serving as a raw material thereof.

  By recovering the isoprenoid compound and / or decarboxylation product from the culture according to a known method, the compound can be obtained.

3． Polynucleotides In one aspect, the present invention relates to an isolated polynucleotide comprising a coding sequence for an archaeal AcnX protein and a coding sequence for an archaeal UbiD protein homolog.

  “Isolated” means, for example, not genomic DNA itself. In this respect, the base length of the polynucleotide is, for example, 50 kb or less, 20 kb or less, 10 kb or less, 6 kb or less, or 3 kb or less. The lower limit of the base length is the base length of the coding sequence.

  Other definitions of each term are the same as those described in the above “1-1”.

Four. Enzyme Agent In one aspect, the present invention relates to an MVA5P dehydratase enzyme agent containing an archaeal AcnX protein. In one aspect, the present invention relates to a tAHMP decarboxylase enzyme agent containing an archaeal UbiD protein homolog.

  The enzymatic agent may consist solely of an archaeal AcnX protein or archaeal UbiD protein homolog, or may contain other components. Other components include, for example, bases, carriers, solvents, dispersants, emulsifiers, buffers, osmotic pressure regulators, absorption enhancers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners Agents, humectants, coloring agents, fragrances, chelating agents and the like.

  Other definitions of each term are the same as those described in the above “1-1”.

  Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited to these Examples.

  Hereinafter, unless otherwise specified, the notation of the plasmid vector is indicated by "plasmid name-name of introduced gene". Gene names are indicated by IDs in the KEGG database (https://www.genome.jp/kegg/kegg_ja.html). For example, the plasmid vector “pET15b-APE_2087.1” refers to a vector in which the APE_2087.1 gene on the KEGG database has been introduced into pET15b. Unless otherwise specified, the meanings of the abbreviations of enzymes and substrates are shown in FIG.

Embodiment 1 FIG. Search for novel mevalonate pathway 1
Classify archaebacteria into species with / without the gene for the 5-diphosphomevalonate decarboxylase (DMD) homolog, and identify orthologous genes that are not present in the genome of the retained species but specifically present in the non-retained species. I searched. As a result, a gene encoding a protein aconitase X (AcnX) of unknown function consisting of two subunits was found.

Embodiment 2. FIG. Functional analysis of archaeal AcnX protein Using archaeal AcnX protein from A. pernix (large subunit: APE_2087.1 of KEGG, small subunit: Ape_2089 of KEGG) derived from A. pernix belonging to Crenarchaeota And analyzed its function.

<Example 2-1. Expression and purification of recombinant archaeal AcnX protein>
(1) pET15b-APE_2087.1 and pET15b-Ape_2089 were respectively introduced into E. coli Rosetta2 (DE3).

(2) The obtained cells of the present invention were cultured in an Auto Induction medium (ampicillin: 100 μg / mL, chloramphenicol: 30 μg / mL) at 37 ° C. for 18 hours. Auto Induction medium (composition: 6 g of Na ₂ HPO ₄ , ₃ g of KH ₂ PO ₄ , 20 g of Tryptone, 5 g of yeast extract, 5 g of NaCl, Up to 950 μL) was prepared, sterilized in an autoclave, and sterile-filtered immediately before inoculation. Solution A (composition: glucose 0.5 g, lactose 2 g, Up to 50 μL) was added.

  (3) After collecting two types of cells of the present invention, 3 g of each cell was mixed, and 30 ml of Histrap binding buffer II (composition: 20 mM of sodium phosphate (pH 7.4), 500 mM of NaCl, 25 mM of Imidazole 25 mM) ).

  (4) The cells were disrupted using an ultrasonic generator UP200S (Hielscher Ultrasonics) at a setting of Cycle 0.3 and Amplitude 60. Ultrasonic crushing operation was performed on ice for 2 min, and this operation was repeated three times.

  (5) The cell lysate was centrifuged at 15,000 rpm for 30 minutes at 4 ° C., and the supernatant was recovered. The obtained supernatant was filtered with a syringe filter having a pore size of 0.45 μm.

(6) After equilibrating a Histrap FF column (GE Healthcare, column volume 1 ml) supplemented with Ni2 ⁺ with 10 ml of Histrap binding buffer II, the supernatant was applied to the column.

  (7) After washing with 10 ml of Histrap binding buffer II, the target protein was eluted with Histrap elute buffer III (composition: 20 mM sodium phosphate (pH 8.0), 500 mM NaCl, 500 mM Imidazole). This eluate was used as archaeal AcnX protein in subsequent experiments.

<Example 2-2. Analysis of enzyme activity of archaeal AcnX protein>
(1) the reaction solution ^{(composition: [2- 14 C] MVA5P 45.5nmol} (5,550,000dpm), archaeal AcnX protein 0.5nmol, Sodium phosphate (pH8.0) 5μmol , Up to 50μL) was prepared and 1 at 90 ° C. Allowed to react for hours.

  (2) MVA5P and ApAcnX products were separated using normal phase TLC. TLC conditions: TLC plate TLC silica gel 60, developing solvent chloroform: pyridine: formic acid: water = 12: 28: 6: 4.

  (3) The imaging plate (BAS-IP) was contact-exposed to the TLC plate. After reading the imaging plate with Typhoon FLA9000, image analysis was performed using analysis software Image Quant TL.

  (4) The Rf value of the ApAcnX product was determined based on the results of the image analysis, and the silica in the range of the value ± 0.05 was scraped off.

  (5) 300 μL of 1 M ammonium acetate buffer (pH 7.5) was added to the scraped silica to extract the ApAcnX product. This operation was repeated twice.

  (6) After centrifugation to collect only the extract, the mixture was heated at 100 ° C. and concentrated to about 100 μL. This solution was the radiolabeled ApAcnX product.

  (7) A reaction solution (composition: radioactively labeled ApAcnX product 54.6 pmol (6,660 dpm), purified ApAcnX 0.3 nmol, sodium phosphate (pH 8.0) 3 μmol, Up to 30 μL) was prepared and reacted at 90 ° C. for 1 hour. .

  (8) Normal phase TLC analysis was performed in the same manner as in (2) above.

<Example 2-3. NMR analysis of ApAcnX product>
(1) Reaction solution (composition: [U- ¹³ C] 5-phosphomevalonic acid (MVA5P) 3 μmol, archaeal AcnX protein 2 μmol, sodium phosphate (pH8.0) 20 μmol, Up to 200 μL with 10% D2O) Was prepared and reacted at 90 ° C. for 2 hours.

(2) After protein removal by a centrifugal filter for ultrafiltration, NMR analysis was performed according to a standard method.

<Example 2-4. Result>
FIG. 2 shows the results of Example 2-2. It was found that a product was produced by reacting the archaeal AcnX protein with MVA5P (1-2 lanes from the left in FIG. 2). This reaction was also found to be reversible (3-4 lanes from the left in FIG. 2).

The results of Example 2-3 are as follows: ¹³ C NMR (600 MHz, _{H 2 O / D 2 O)} δ: 177.0, 122.8, 145.1, 40.1, 62.6, 17.8. From this result, the ApAcnX product has the following formula:

The compound was found to be tAHMP.

  From the above, it was found that the archaeal AcnX protein is an enzyme having dehydratase activity against MVA5P on the mevalonate pathway and producing tAHMP.

Embodiment 3 FIG. Search for new mevalonate pathway 2
tAHMP is a novel intermediate on the mevalonate pathway. Therefore, an enzyme that plays a route through the intermediate to the existing intermediate was searched. Specifically, using the function provided by the Microbial Genome Darabase for Comparateive Analysis (MBGD) (http://mbgd.genome.ad.jp), the ortholog gene of AcnX is stored on the genome, Archaea with MVA pathway and other Archia species were selected, and orthologous genes conserved specifically in the former were searched. As a result, a gene encoding a UbiD protein homolog and a gene encoding a UbiX protein homolog were found. From the findings so far, it was considered that the UbiX protein homolog has a flavin prenyltransferase activity for synthesizing prenylated flavin (prFMN), which is a type of coenzyme. For this reason, it was thought that the main body of the activity on the mevalonate pathway was borne by the UbiD protein homolog.

Embodiment 4 FIG. Functional analysis of archaeal UbiD protein homologue The function of the archaeal UbiD protein homolog was analyzed using an archaeal UbiD protein homologue (Ape_2078 of KEGG) derived from A. pernix belonging to the Clenarchota.

<Example 4-1. Expression and purification of recombinant archaeal UbiD protein homolog>
(1) The gene Ape_2078 encoding the UbiD protein homolog and the gene Ape_1647 encoding the UbiX protein homolog were each amplified by PCR using the following primers. At this time, PCR was performed using KOD-Plus (TOYOBO) with the genome of A. pernix (RIKEN BRC Microbial Materials Development Laboratory (JCM)) as a template.
Ape_2078 Fw: GGGATTAGAAGGAGTTATATATGGAGGATGCGAGTCTAAAG (SEQ ID NO: 9)
Ape_2078Rv: GTGGTGGTGGTGGTGCTCGAGGTCTCCCGGCTGGTGGC (SEQ ID NO: 10)
Ape_1647 Fw: TTAAGAAGGAGATATACATATGTCCTGCAGACCTAGCTCG (SEQ ID NO: 11)
Ape_1647Rv: TCCTCCATATATAACTCCTTCTAATCCCCCTCCTCGGG (SEQ ID NO: 12)

(2) After digesting the pET22b (+) vector with the restriction enzymes NdeI and XhoI, the two insert DNAs amplified were inserted into the vector cleavage sites using the In Fusion Cloning Kit (Takara). It was designed so that His-tag was attached only to the C-terminal side of the expressed Ape_2078.

  (3) The constructed plasmid pET22b (+)-Ape_1647-Ape_2078 was introduced into E. coli Rosetta2 (DE3).

  (4) The obtained cells of the present invention were cultured in an Auto Induction medium (ampicillin: 100 μg / mL, chloramphenicol: 30 μg / mL) at 37 ° C. for 24 hours.

(5) The collected cells were suspended in 20 ml of Histrap binding buffer I. Further, 10 mM DTT and 2.5 mM MnCl ₂ were added to this suspension.

  (6) The cells were disrupted using an ultrasonic generator UP200S (Hielscher Ultrasonics) at a setting of Cycle 0.3 and Amplitude 60. Ultrasonic crushing operation was performed on ice for 2 min, and this operation was repeated three times.

  (7) The cell lysate was centrifuged at 15,000 rpm for 30 minutes at 4 ° C, and then heat-treated at 60 ° C for 30 minutes.

  (8) After centrifugation again at 15,000 rpm for 30 minutes at 4 ° C., the supernatant was recovered. The obtained supernatant was filtered with a syringe filter having a pore size of 0.45 μm.

(9) After equilibrating a Histrap FF column (GE Healthcare, column volume 1 ml) supplemented with Ni ²⁺ with 10 ml of Histrap binding buffer I, the supernatant was applied to the column.

  (10) After washing with 10 ml of Histrap binding buffer I, the target protein was eluted with Histrap elute buffer I. This eluate was used as archaeal UbiD protein homolog in subsequent experiments.

<Example 4-2. Analysis of enzyme activity of archaeal UbiD protein homologue>
A reaction solution (composition: 54.6 pmol of radiolabeled ApAcnX product (tAHMP), 6.2 μg of archaeal UbiD protein homolog, 3 μmol of sodium phosphate (pH7.5), Up to 30 μL) was prepared and reacted at 60 ° C. for 1 hour. The reaction product was subjected to normal phase TLC analysis in the same manner as in Example 2-2.

<Example 4-3. Verification of Archaeal UbiD Protein Homolog Products>
The reaction solution (composition: Each radiolabeled compound ^{([2- 14 C] MVA,} [2- 14 C] MVA5P, [2- 14 C] MVA5PP, radiolabeled ApAcxX ^{product, [4- 14 C] IP,} [1 ^{- 14 C] IPP) 0.1nmol (} 12,200dpm), ATP 0.8μmol, MgCl 2 1μmol, dimethylallyl diphosphate (DMAPP) 3nmol, Sodium phosphate ( pH7.5) 5μmol, archaeal UbiD protein homologs 7.5 [mu] g, Thermoplasma acidophilum 0.1 nmol of IPK (derived from Sulfolobus acidocaldarius, excess amount of geranylgeranyl diphosphate (GGPP) synthase, Up to 100 μL) was prepared and reacted at 60 ° C. for 1 hour. The hydrophobic reaction product was subjected to acid phosphatase treatment at 37 ° C. overnight after extraction with butanol. Reversed phase TLC analysis was performed after pentane extraction. TLC conditions: TLC plate TLC silica gel 60 RP-18 F _254S , developing solvent acetone: water = 9: 1.

<Example 4-4. Result>
FIG. 3 shows the results of Example 4-2. Reaction of the archaeal UbiD protein homolog with the ApAcnX product (tAHMP) was found to produce a product with a spot confirmed at the same position as the IP.

  FIG. 4 shows the results of Example 4-3. Efficient conversion of ApAcnX product (tAHMP) to GGPP could be confirmed. This indicates that the archaeal UbiD protein homolog had decarboxylase activity on the ApAcnX product (tAHMP) and produced IP.

Embodiment 5 FIG. In vivo assay coupled to lycopene production Polynucleotides containing the coding sequences of each of the novel mevalonate pathway enzymes (archaeal AcnX protein and archaeal UbiD protein homologue) found in Examples 1-4 were introduced into Escherichia coli Then, it was examined whether a terpenoid compound (lycopene) was produced in the presence of the substrate. Lycopene is a compound that exhibits a red color, and if lycopene is produced, the E. coli pellet will exhibit a red color. Specifically, the procedure was performed as follows. In addition, refer to Table 1 for plasmid notation.

<Example 5-1. Plasmid construction>
M. mazei (RIKEN BRC microbial material development room (JCM)), A. pernix (RIKEN BRC microbial material development room (JCM)), DNA extraction kit Geno Plu (registered trademark) Mini (VIOGENE, (USA) was used to extract genomic DNA.

  Using the extracted M. mazei genomic DNA as a template DNA, the putative mevalonate kinase (MVK) gene MM_1762 was amplified by PCR. The amplified MM_1762 was treated with KpnI and XhoI with restriction enzymes, and ligated with a pBAD18 fragment treated with the same restriction enzymes to prepare pBAD-MVK. pJBEI-2999 (Peralta-Yahya et al. Nature Communications, 2, 483, 2011) was used as a template DNA to amplify the isopentenyl diphosphate isomerase (IDI) gene JW2857, and together with a pBAD-MVK fragment cut with EcoRI, E. coli strain ME9783 (Asai et al. The EMBO Journal, 12 (8), 3287-3295, 1993). The plasmid into which JW2857 was inserted was extracted by homologous recombination in Escherichia coli cells (Oliner et al. Nucleic Acids Research, 21 (22), 5192-5197, 1993) and designated as pBAD-mMP2. Using the genomic DNA of M. mazei as the template DNA, the putative isopentenyl kinase (IPK) gene MM_1763 was amplified and introduced into E. coli ME9783 along with the pBAD-mMP2 fragment cut with EcoRI. The plasmid into which MM_1763 was inserted was extracted and designated as pBAD-mMP3.

  Using the genomic DNA of M. mazei as template DNA, the putative aconitase X-small subunit (AcnX-S) gene MM_1524 was amplified and introduced into E. coli ME9783 along with the pBAD18 fragment cut with EcoRI. The plasmid into which MM_1524 was inserted was extracted and designated as pBAD-mUA1. Using the genomic DNA of M. mazei as template DNA, the putative aconitase X-large subunit (AcnX-L) gene MM_1525 was amplified and introduced into E. coli ME9783 along with the pBAD-mUA1 fragment cut with EcoRI. The plasmid into which MM_1525 was inserted was extracted and designated as pBAD-mUA2. Using the genomic DNA of M. mazei as the template DNA, the putative UbX gene MM_1871 was amplified and introduced into E. coli ME9783 along with the pBAD-mUA2 fragment cut with EcoRI. The plasmid into which MM_1871 was inserted was extracted and designated as pBAD-mUA3. Using the genomic DNA of M. mazei as the template DNA, the putative UbiD gene MM_1526 was amplified and introduced into E. coli ME9783 along with the pBAD-mUA3 fragment cut with EcoRI. The plasmid into which MM_1526 was inserted was extracted and designated as pBAD-mUA4. Using pBAD-mUA4 as a template DNA, a DNA fragment containing MM_1526, MM_1871, MM_1525, and MM_1524 was amplified and introduced into E. coli strain ME9783 together with the pBAD-mMP3 fragment cut with EcoRI. Plasmids into which MM_1526, MM_1871, MM_1525, and MM_1524 were inserted were extracted and designated as pBAD-mMP7 (FIG. 5).

  The AcnX-S gene APE_2089 was amplified using the genomic DNA of A. pernix as a template DNA, and introduced into E. coli ME9783 along with the pBAD18 fragment cut with EcoRI. The plasmid into which APE_2089 was inserted was extracted and designated as pBAD-asUA1. AcnX-L gene APE_2087.1 was amplified using A. pernix genomic DNA as template DNA, and introduced into E. coli ME9783 together with the pBAD-asUA1 fragment cut with EcoRI. The plasmid into which APE_2087.1 was inserted was extracted and designated as pBAD-asUA2. Using genomic DNA of S. cerevisae as template DNA, a prenyl-flavin synthase gene YDR538W (Arunrattanamook et al. Biochemistry, 57 (5), 696-700, 2017), which is a homolog of UbiX in S. cerevisiae, was amplified with EcoRI. It was introduced into E. coli ME9783 together with the cleaved pBAD-asUA1 fragment. The plasmid into which YDR538W was inserted was extracted and designated as pBAD-asUA3. UbiD gene APE_2078 was amplified using A. pernix genomic DNA as template DNA and introduced into E. coli ME9783 along with the pBAD-asUA3 fragment cut with EcoRI. The plasmid into which APE_2078 was inserted was extracted and designated as pBAD-asUA4. A DNA fragment containing APE_2078, YDR538W, APE_2087.1, and APE_2089 was amplified using pBAD-asUA4 as a template DNA, and introduced into E. coli ME9783 together with the pBAD-mMP3 fragment cut with EcoRI. The plasmid into which APE_2078, YDR538W, APE_2087.1, and APE_2089 were inserted was extracted and designated as pBAD-asMP7 (FIG. 5).

  For the above PCR reaction, KOD plus polymerase (TOYOBO, Japan) and the primers shown in Table 2 were used.

<Example 5-2. Lycopene production>
E. coli TOP10 strain was transformed with pACYC-CrtIBE (Hemmi et al. The Journal of Biochemistry, 123 (6), 1088-1096, 1998) and pBAD-mMP7 or pBAD-asMP7, and TOP10 / pBAD-mMP7 / pACYC-CrtIBE A strain, TOP10 / pBAD-asMP7 / pACYC-CrtIBE strain, was prepared. As a control, Escherichia coli TOP10 strain was transformed with pACYC-CrtIBE and pBAD-18 to prepare TOP10 / pBAD18 / pACYC-CrtIBE strain. Each strain was cultured with shaking at 37 ° C. overnight in 5 ml of LB medium (containing 100 mg of ampicillin and 20 mg of tetracycline). The culture solution of each strain was inoculated into 5 ml of LB medium (containing 100 mg of ampicillin, 20 mg of tetracycline, 0.2% of L-arabinose, and 2.5 mg of mevalonolactone), and then cultured at 37 ° C. for 48 hours. After the culture, the culture was centrifuged at 13000 rpm for 1 min to collect the cells. The test was performed in triplicate. Table 3 shows the presence or absence of the introduced plasmid and substrate (MVL) for each sample.

  FIG. 6 shows the results. A sample obtained by introducing a polynucleotide containing the coding sequence of each of the enzymes (archaeal AcnX protein and archaeal UbiD protein homologue) responsible for the novel mevalonate pathway found in Example 1-4 into Escherichia coli and adding a substrate ( No. 10-12 and 16-18), the E. coli pellet showed a red color specifically. This indicated that terpenoid compounds (lycopene) were specifically produced in these samples.

Claims (15)

A non-archaeal organism comprising a polynucleotide comprising a coding sequence for an archaeal AcnX protein and a polynucleotide comprising a coding sequence for an archaeal UbiD protein homolog. 2. The non-archaeal organism of claim 1, further comprising a polynucleotide comprising a flavin prenyl transferase coding sequence. The archaeal AcnX protein is a protein derived from the phylum Clearchaeota or Juliachiota, and the archaeal UbiD protein homolog is a protein derived from the phylum Clearchaeota or Juliachyota. The non-archaeal organism described. The non-archaeal organism according to any one of claims 1 to 3, wherein both the archaeal AcnX protein and the archaeal UbiD protein homolog are proteins derived from the phylum Clenarchota. The archaeal AcnX protein is a complex protein according to the following (A) or (B):
(A) a complex protein comprising a large subunit consisting of the amino acid sequence shown in any of SEQ ID NOs: 1 and 2 and a small subunit consisting of the amino acid sequence shown in any of SEQ ID NOs: 3 to 4, or B) A large subunit consisting of an amino acid sequence having 70% or more identity with the amino acid sequence shown in any of SEQ ID NOs: 1 and 2, and 70% or more with the amino acid sequence shown in any of SEQ ID NOs: 3 to 4 A complex protein comprising a small subunit having an amino acid sequence having the same identity as described above, and a complex protein having 5-phosphomevalonate (MVA5P) dehydratase activity;
And the archaeal UbiD protein homolog is a protein described in the following (C) or (D):
(C) a protein consisting of the amino acid sequence shown in any of SEQ ID NOs: 5-6, or (D) consisting of an amino acid sequence having 70% or more identity with the amino acid sequence shown in any of SEQ ID NOs: 5-6. A protein having transanhydro 5-phosphomevalonate (tAHMP) decarboxylase activity, and
The non-archaeal organism according to any one of claims 1 to 4, which is: The non-archaeal organism according to any one of claims 1 to 5, wherein the non-archaeal organism is an Enterobacteriaceae bacterium, an actinomycete, a lactic acid bacterium, a clostridia, a cyanobacterium, a yeast, an algae, a filamentous fungus, or a plant. . The non-archaeal organism of any of claims 1 to 6, further comprising a polynucleotide comprising a coding sequence for another enzyme on the mevalonate pathway. The other enzyme is a group consisting of acetoacetyl-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase (MVK), isopentenyl phosphate kinase (IPK), and isopentenyl diphosphate isomerase (IDI). The non-archaeal organism according to claim 7, which is at least one selected from the group consisting of: A culture of a non-archaeal organism according to any of claims 1 to 8. From the culture according to claim 9, general formula (1):
[In the formula, X represents a phosphate group, a hydroxy group, or hydrogen. ]
And / or the general formula (2):
[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
A method for producing a mevalonic acid pathway intermediate or an analog thereof, comprising obtaining a compound represented by the formula: General formula (1):
[In the formula, X represents a hydroxy group, a phosphate group, or hydrogen. ]
And / or the general formula (2):
[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
Or a salt thereof, or a solvate thereof. From the culture of claim 9,
(A) an isoprenoid compound, and / or (b) a general formula (1):
[In the formula, X represents a hydroxy group, a phosphate group, or hydrogen. ]
And / or a general formula (2):
[In the formula, Y represents a methyl group, a vinyl group, or a hydroxy group. ]
A decarboxylation product of the compound represented by
A method for producing a compound, comprising obtaining An isolated polynucleotide comprising a coding sequence for an archaeal AcnX protein and a coding sequence for an archaeal UbiD protein homolog. An MVA5P dehydratase enzyme preparation containing an archaeal AcnX protein. A tAHMP decarboxylase enzyme preparation containing an archaeal UbiD protein homolog.