JP2022043100A - Production of odd chain fatty acid derivatives in recombinant microbial cells - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide recombinant microbial cells engineered to produce fatty acid derivatives having linear chains containing an odd number of carbon atoms by the fatty acid biosynthetic pathway, and to provide methods for making odd chain fatty acid derivatives using the recombinant microbial cells, and compositions comprising odd chain fatty acid derivatives produced by such methods.

SOLUTION: According to the present invention, a recombinant microbial cell comprises polynucleotides respectively encoding a polypeptide having enzymatic activity effective to produce an increased amount of propionyl-CoA, a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate, and a polypeptide having fatty acid derivative enzyme activity. Here, the recombinant microbial cell produces a fatty acid derivative composition comprising odd chain fatty acid derivatives when cultured in the presence of a carbon source under conditions effective to express the polynucleotides, and at least 10% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives.

SELECTED DRAWING: None

COPYRIGHT: (C)2022,JPO&INPIT

Description

Cross-references to related applications This application is in particular US Patent Application Nos. 13 / 232,927 filed September 14, 2011 and filed September 15, 2010, which is incorporated herein by reference in its entirety. It is a partial continuation application of provisional application No. 61 / 383,086, and claims their priority interests.

Incorporation by reference to electronic submissions This application is submitted in ASCII form by EFS-Web and includes a sequence listing, which is incorporated herein by reference in its entirety. The ASCII copy made on March 7, 2012 is LS0033PC. It is called txt and has a size of 350,776 bytes.

Crude oil is a very complex mixture containing a wide range of hydrocarbons. Crude oil is converted into a wide variety of fuels and chemicals in refineries through various chemical processes. Crude oil is a source of transportation fuel and a source of raw materials for producing petrochemical products. Petrochemicals are used to make specialized chemicals such as plastics, resins, fibers, elastomers, pharmaceuticals, lubricants and gels.

The most important transport fuels, namely gasoline, diesel and jet fuels, contain various mixtures of unique hydrocarbons prepared for optimum engine performance. For example, gasoline generally contains linear, branched and aromatic hydrocarbons ranging from about 4 to 12 carbon atoms, while diesel primarily contains about 9 to 23 carbon atoms. Includes a range of straight chain hydrocarbons. The quality of diesel fuel is evaluated by parameters such as cetane number, kinematic viscosity, oxidative stability and cloud point (Knose G., Fuel Process Technology 86: 1059-1070 (2005) (Non-Patent Document 1)). .. These parameters are particularly affected by the length of the hydrocarbon chain as well as the degree or saturation of hydrocarbon branching.

Fatty acid derivatives produced by microorganisms can be specially prepared by genetic engineering. By metabolic manipulation, the microbial strain can produce, for example, various mixtures of fatty acid derivatives that can be optimized to meet or exceed fuel standards or other commercially relevant product standards. be. Microbial species can be engineered to produce chemicals or precursor molecules normally obtained from petroleum. In some cases, it is desirable to mimic the product profile of an existing product, eg, the product profile of an existing petroleum-derived fuel or chemical product, for provisional and efficient adaptation or substitution. The recombinant cells and methods described herein vary in odd: even length chain ratios, for example, as a means of precisely controlling the structure and function of hydrocarbon-based fuels and chemicals. Demonstrate the production of fatty acid derivatives by microorganisms.

There is a need for cost-effective petroleum product alternatives that do not require exploration, extraction, long-distance transport or sufficient refining and can avoid the environmental hazards associated with petroleum processing. For similar reasons, alternative sources of chemicals normally obtained from petroleum are needed. There is also a need for efficient and cost-effective methods of producing high quality biofuels, fuel alternatives and chemicals from renewable energy sources.

Using recombinant microbial cells engineered to produce fatty acid precursor molecules with the desired chain length (eg, chains with odd carbons) and fatty acid derivatives made from them, these recombinant microbial cells. And a method of producing a composition comprising a fatty acid derivative having a desired acyl chain length and a desired odd: even length chain ratio, as well as the compositions produced by these methods, solve these needs. ..

The present invention provides novel recombinant microbial cells that produce odd chain length fatty acid derivatives and cell cultures containing such novel recombinant microbial cells. The present invention also comprises a method of making a composition comprising an odd chain length fatty acid derivative comprising culturing the recombinant microbial cells of the present invention, the composition made by such method and other properties revealed by further investigation. (Fature) is provided.

In a first aspect, the invention relates to the production of propionyl-CoA in parental microbial cells that lack or have reduced amounts of enzymatic activity effective to increase the production of propionyl-CoA. A recombinant microbial cell containing a polynucleotide encoding a polypeptide having said enzymatic activity effective for increasing the production of propionyl-CoA in the cell, wherein the cell expresses the polynucleotide in the presence of a carbon source. To provide recombinant microbial cells that produce fatty acid derivative compositions comprising odd chain fatty acid derivatives when cultured under effective conditions. Recombinant microbial cells (a) to the amount of propionyl-CoA produced in parent microbial cells lacking or reduced in effective enzymatic activity to produce increased amounts of propionyl-CoA. In contrast, a polynucleotide encoding a polypeptide having said enzymatic activity effective for producing an increased amount of propionyl-CoA in recombinant microbial cells, and whether the polypeptide is exogenous to recombinant microbial cells. , Or a polynucleotide whose expression of the polynucleotide is modulated in recombinant microbial cells as compared to the expression of the polynucleotide in the parent microbial cell, (b) β-ketoacyl-ACP synthase utilizing propionyl-CoA as the substrate. Recombinant microbial cells comprising a polynucleotide encoding a polypeptide having (“FabH”) activity and a polynucleotide encoding a polypeptide having (c) fatty acid derivative enzyme activity, the recombinant microbial cell is (a) in the presence of a carbon source. ), (B) and (c) to produce a fatty acid derivative composition comprising an odd chain fatty acid derivative when cultured under conditions effective for expressing the polynucleotide. In some embodiments, the expression of at least one polynucleotide according to (a) is modulated by the overexpression of the polynucleotide, such as by manipulative linkage of the polynucleotide to an exogenous promoter.

In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60 of the fatty acid derivatives in the composition produced by the microbial cells of the first embodiment. %, At least 70%, at least 80% or at least 90% are odd chain fatty acid derivatives. In some embodiments, recombinant microbial cells are cultured in a culture medium containing a carbon source under conditions effective for expressing the polynucleotide according to (a), (b) and (c). , At least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10000 mg / L odd-chain fatty acid derivatives. To generate.

In some embodiments, a polynucleotide encoding a polypeptide having an enzymatic activity effective for producing an increased amount of propionyl-CoA in recombinant microbial cells according to (a) is (i) aspart kinase activity. , One or more polynucleotides encoding a polypeptide having homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity or threonine deaminase activity, (ii) (R) -citramalic acid synthase activity, isopropylmalic acid. One or more polynucleotides encoding polypeptides having isomerase activity or beta-isopropylaroic acid dehydroenzyme activity and (iii) methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase activity, methylmalonyl-CoA carboxylase It is selected from one or more polynucleotides encoding a polypeptide having kinase activity or methylmalonyl-CoA epimerase activity. In some embodiments, the microbial cell comprises one or more polynucleotides according to (i) and one or more polynucleotides according to (ii). In some embodiments, the microbial cell comprises one or more polynucleotides according to (i) and / or (ii) and one or more polynucleotides according to (iii).

In some embodiments, the polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate is exogenous to recombinant microbial cells. In a further specific embodiment, the expression of a polypeptide having β-ketoacyl-ACP synthase activity endogenous to recombinant microbial cells is attenuated.

The fatty acid derivative enzyme activity may be endogenous (“natural”) or exogenous. In some embodiments, the fatty acid derivative enzyme activity comprises thioesterase activity and the fatty acid derivative compositions produced by recombinant microbial cells include odd chain fatty acids and even chain fatty acids. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90 of the fatty acids in the composition. % Is an odd chain fatty acid. In some embodiments, recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective for expressing the polynucleotide. It produces 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10000 mg / L odd-chain fatty acids.

In some embodiments of the first embodiment, the fatty acid derivative enzyme activity comprises an ester synthase activity, and the fatty acid derivative composition produced by the recombinant microorganism comprises an odd chain fat ester and an even chain fat ester. Is done. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the fatty esters in the composition. 90% are odd chain fatty esters. In some embodiments, recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective for expressing the polynucleotide. It produces 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10000 mg / L odd-chain fatty esters.

In some embodiments of the first embodiment, the fatty acid derivative enzyme activity comprises a fatty aldehyde biosynthetic activity and the fatty acid derivative composition produced by the recombinant microbial cells is an odd chain fatty aldehyde and an even chain fatty aldehyde. Is included. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the fatty aldehyde in the composition. 90% are odd chain fatty aldehydes. In some embodiments, recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective for expressing the polynucleotide. It produces 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L, or at least 10000 mg / L odd-chain fatty aldehydes.

In some embodiments of the first embodiment, the fatty acid derivative enzyme activity comprises fatty alcohol biosynthetic activity and the fatty acid derivative composition produced by recombinant microbial cells is an odd chain fatty alcohol and an even chain fatty alcohol. Is included. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the fatty alcohol in the composition. 90% are odd chain fatty alcohols. In some embodiments, recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective for expressing the polynucleotide. It produces 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L, or at least 10000 mg / L odd-chain fatty alcohols.

In some embodiments of the first embodiment, the fatty acid derivative enzyme activity comprises a hydrocarbon biosynthetic activity and the fatty acid derivative composition produced by the recombinant microbial cells is an alkane composition, an alkene composition, a terminal. It is a hydrocarbon composition such as an olefin composition, an internal olefin composition or a ketone composition, and the hydrocarbon composition includes an odd-chain hydrocarbon and an even-chain hydrocarbon. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the hydrocarbons in the composition. 90% are even chain hydrocarbons. In some embodiments, recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective for expressing the polynucleotide. It produces 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10000 mg / L even-chain hydrocarbons.

In various embodiments, the carbon source includes carbohydrates such as sugars such as monosaccharides, disaccharides, oligosaccharides or polysaccharides. In some embodiments, the carbon source is obtained from biomass, such as a cellulose hydrolyzate.

In various embodiments, the parent (eg, host) microbial cell is a prokaryotic cell such as a filamentous fungus, algae, yeast or bacterium. In various preferred embodiments, the host cell is a bacterial cell. In a more preferred embodiment, the host cell is E. coli. E. coli cells or Bacillus cells.

Examples of routes for making even-chain fatty acid derivatives and odd-chain fatty acid derivatives are shown in FIGS. 1A and 1B, respectively. FIGS. 2 and 3 provide an overview of various approaches to metabolic flow through propionyl-CoA to increase odd-chain fatty acid derivative production, and FIG. 2 shows the pathway through the intermediate α-ketobutyric acid. An example is shown, with FIG. 3 showing an example of the pathway through the intermediate methylmalonyl-CoA.

In one embodiment, the recombinant microbial cells according to the first embodiment are β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, preferably β-ketoacyl-classified as EC23.1.180. Includes a polynucleotide encoding a polypeptide having ACP synthase III activity. In one embodiment, the polypeptide having β-ketoacyl-ACP synthase activity is encoded by the fabH gene. In one embodiment, the polypeptide having β-ketoacyl-ACP synthase activity is endogenous to the parent microbial cell. In another embodiment, the polypeptide having β-ketoacyl-ACP synthase activity is exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having β-ketoacyl-ACP synthase activity utilizes propionyl-CoA as a substrate and is an odd chain acyl in vitro or in vivo, preferably in vivo. -SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, having β-ketoacyl-ACP synthase activity that catalyzes the condensation of propionyl-CoA and malonyl-ACP to form ACP, Contains sequences selected from 10, 11, 12, 13, 146, 147, 148 or 149 or variants or fragments thereof. In another embodiment, a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate comprises one or more sequence motifs selected from SEQ ID NOs: 14-19 and is in vitro or in vivo. In vivo, preferably in vivo, the condensation of propionyl-CoA and malonyl-ACP is catalyzed to form an odd chain acyl-ACP.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises an endogenous polynucleotide sequence (eg, an endogenous fabH gene) encoding a polypeptide having β-ketoacyl-ACP synthase activity, but recombinant. The expression of such endogenous polynucleotide sequences in microbial cells is diminished. In some embodiments, expression of the endogenous polynucleotide is attenuated by deletion of all or part of the sequence of the endogenous polynucleotide in recombinant microbial cells. Such recombinant microbial cells containing the attenuated endogenous β-ketoacyl-ACP synthase gene are further polys encoding exogenous polypeptides with β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate. It preferably contains a nucleotide sequence.

In one embodiment, the recombinant microbial cell according to the first embodiment is a polynucleotide encoding a polypeptide having aspart kinase activity (FIG. 2, pathway (A)) classified as EC 2.7.2.4. include. In some embodiments, the polypeptide having aspart kinase activity is encoded by the thrA, dapG or hom3 gene. In one embodiment, the polypeptide having aspart kinase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having aspart kinase activity is modulated in recombinant microbial cells. In some cases, the expression of a polynucleotide is regulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having aspartic kinase activity has aspartic kinase activity and catalyzes the conversion of aspartic acid to aspartic phosphate in vitro or in vivo, preferably in vivo, SEQ ID NO: Contains sequences selected from 20, 21, 22, 23, 24 or variants or fragments thereof.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having homoserine dehydrogenase activity classified as EC 1.1.1.13. In some embodiments, the polypeptide having homoserine dehydrogenase activity is encoded by the thrA, hom or hom6 gene. In one embodiment, the polypeptide having homoserine dehydrogenase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having homoserine dehydrogenase activity is regulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having homoserine dehydrogenase activity has homoserine dehydrogenase activity and catalyzes the conversion of aspartic acid semialdehyde to homoserine in vitro or in vivo, preferably in vivo. Includes sequences selected from numbers 20, 21, 25, 26, 27 or variants or fragments thereof.

In certain embodiments, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having both aspart kinase and homoserine dehydrogenase activity. In one embodiment, the polypeptide having aspart kinase and homoserine dehydrogenase activity is endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, the expression of polynucleotides encoding polypeptides with aspart kinase and homoserine dehydrogenase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In one embodiment, a polypeptide having aspartic kinase and homoserine dehydrogenase activity is in vitro or in vivo, preferably in vivo, aspartate to aspartyl phosphate conversion and aspartate semialdehyde to homoserine conversion. Includes variants or fragments thereof such as SEQ ID NO: 20 or SEQ ID NO: 21 that catalyze.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having homoserine kinase activity classified as EC2.7.1.39. In some embodiments, the polypeptide having homoserine kinase activity is encoded by the thrB or thrI gene. In one embodiment, the polypeptide having homoserine kinase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having homoserine kinase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having homoserine kinase activity has homoserine kinase activity and catalyzes the conversion of homoserine to O-phospho-L-homoserin in vitro or in vivo, preferably in vivo. Contains sequences selected from 28, 29, 30, 31 or variants or fragments thereof.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having threonine synthase activity classified as EC 4.2.3.1. In one embodiment, the polypeptide having threonine synthase activity is encoded by the thrC gene. In one embodiment, the polypeptide having threonine synthase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having threonine synthase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having threonine synthase activity has threonine synthase activity and catalyzes the conversion of O-phospho-L-homoserin to threonine in vitro or in vivo, preferably in vivo. Contains sequences selected from SEQ ID NOs: 32, 33, 34 or variants or fragments thereof.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having threonine deaminase activity, which is classified as EC4.3.1.19. In some embodiments, the polypeptide having threonine deaminase activity is encoded by the tdcB gene or the ilvA gene. In one embodiment, the polypeptide having threonine deaminase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having threonine deaminase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having threonine deaminase activity has threonine deaminase activity and catalyzes the conversion of threonine to 2-ketobutyric acid in vitro or in vivo, preferably in vivo, SEQ ID NOs: 35, 36. , 37, 38, 39 containing sequences selected from, or variants or fragments thereof.

In one embodiment, the recombinant microbial cell according to the first aspect is a polypeptide having (R) -citramal acid synthase activity (FIG. 2, pathway (B)) classified as EC23.1.182. Contains the polynucleotide to encode. In one embodiment, the polypeptide having (R) -citramal acid synthase activity is encoded by the cima gene. In one embodiment, the polypeptide having (R) -citramal acid synthase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having (R) -citramalic acid synthase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having (R) -citramalate lysogenic activity has (R) -citramalate lysogenic activity and has acetyl-CoA and pyruvate in vitro or in vivo, preferably in vivo. Contains sequences selected from SEQ ID NOs: 40, 41, 42, 43 or variants or fragments thereof that catalyze the reaction to (R) -citramalate.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having isopropylmalic acid isomerase activity classified as EC 4.21.33. In one embodiment, the polypeptide having isopropylmalic acid isomerase activity comprises a large subunit and a small subunit encoded by the leuCD gene. In one embodiment, the polypeptide having isopropylmalic acid isomerase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having isopropylmalic acid isomerase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having isopropylmalic acid isomerase activity comprises a large subunit and a small subunit. In another embodiment, the polypeptide having isopropylmalic acid isomerase activity has isopropylmalic acid isomerase activity and is in vitro or in vivo, preferably in vivo, from (R) -citraconic acid to citraconic acid and from citraconic acid to beta. -Contains a large subunit sequence selected from SEQ ID NOs: 44 and 46 and a small subunit sequence selected from SEQ ID NOs: 45 and 47 or variants or fragments thereof that catalyze the conversion to methyl-D-propylic acid. ..

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having beta-isopropylmalate dehydrogenase activity, which is classified as EC1.1.1.85. In some embodiments, the polypeptide having beta-isopropylmalate dehydrogenase activity is encoded by the leuB gene or the leu2 gene. In one embodiment, the polypeptide having beta-isopropylmalate dehydrogenase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having beta-isopropylmalate dehydrogenase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having beta-isopropylmalate dehydrogenase activity has beta-isopropylmalate dehydrogenase activity and is in vitro or in vivo, preferably in vivo, beta-methyl-D-. Includes sequences selected from SEQ ID NOs: 48, 49, 50 or variants or fragments thereof that catalyze the conversion of malic acid to 2-ketobutyric acid.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA mutase activity (FIG. 3), which is classified as EC5.499.2. In some embodiments, the polypeptide having methylmalonyl-CoA mutase activity is encoded by the scpA (also known as sbm) gene. In one embodiment, the polypeptide having methylmalonyl-CoA mutase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA mutase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having methylmalonyl-CoA mutase activity has methylmalonyl-CoA mutase activity and converts succinyl-CoA to methylmalonyl-CoA in vitro or in vivo, preferably in vivo. Containing sequences selected from SEQ ID NOs: 51, 52, 53, 54, 55, 56, 57, 58 or variants or fragments thereof to catalyze.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA decarboxylase activity classified as EC4.1.1.41. In some embodiments, the polypeptide having methylmalonyl-CoA decarboxylase activity is encoded by the scpB (also known as ygfG) gene. In one embodiment, the polypeptide having methylmalonyl-CoA decarboxylase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA decarboxylase is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having methylmalonyl-CoA decarboxylase activity has methylmalonyl-CoA decarboxylase activity from methylmalonyl-CoA to propionyl-CoA in vitro or in vivo, preferably in vivo. Contains sequences selected from SEQ ID NOs: 59, 60, 61 or variants or fragments thereof that catalyze the conversion.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA carboxyltransferase activity classified as EC2.11.3.1. In one embodiment, the polypeptide having methylmalonyl-CoA carboxyltransferase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA carboxyltransferase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having methylmalonyl-CoA carboxyltransferase activity has methylmalonyl-CoA carboxyltransferase activity, from methylmalonyl-CoA to propionyl-CoA in vitro or in vivo, preferably in vivo. Includes the sequence of SEQ ID NO: 62 or a variant or fragment thereof that catalyzes the conversion.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA epimerase activity, which is classified as EC5.199.1. In one embodiment, the polypeptide having methylmalonyl-CoA epimerase activity is either endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA epimerase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having methylmalonyl-CoA epimerase activity has methylmalonyl-CoA epimerase activity, from (R) -methylmalonyl-CoA to (S) in vitro or in vivo, preferably in vivo. -Contains the sequence of SEQ ID NO: 63 or variants or fragments thereof that catalyze the conversion to methylmalonyl-CoA.

In one embodiment, the recombinant microbial cell according to the first embodiment has an endogenous polynucleotide sequence encoding a polypeptide having propionyl-CoA :: succinyl-CoA transferase activity (eg, also known as the endogenous scpC gene (ygfH)). The expression of such endogenous polynucleotides in recombinant microbial cells is diminished, including)). In some embodiments, expression of the endogenous polynucleotide is attenuated by deletion of all or part of the sequence of the endogenous polynucleotide in recombinant microbial cells.

In one embodiment, the recombinant microbial cell according to the first embodiment comprises an endogenous polynucleotide sequence (eg, an endogenous dadE gene) encoding a polypeptide having acyl-CoA dehydrogenase activity. The expression of such endogenous polynucleotide sequences in is attenuated or may not be attenuated.

In another embodiment, the recombinant microbial cells according to the first embodiment contain a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity, and the recombinant microbial cells are odd when cultured in the presence of a carbon source. A fatty acid derivative composition containing a chain fatty acid derivative is produced.

In various embodiments, the fatty acid derivative enzyme activity includes thioesterase activity, ester synthase activity, fatty aldehyde biosynthesis activity, fatty alcohol biosynthesis activity, ketone biosynthesis activity and / or hydrocarbon biosynthesis activity. In some embodiments, recombinant microbial cells are polynucleotides encoding two or more polypeptides, each comprising a polynucleotide having fatty acid derivative enzyme activity. In a further specific embodiment, the recombinant microbial cells are (1) a polypeptide having thioesterase activity, (2) a polypeptide having decarboxylase activity, (3) a polypeptide having carboxylic acid reductase activity, (4). Polypeptides with alcohol dehydrogenase activity (EC1.1.1.1), (5) Polypeptides with aldehyde decarbonylase activity (EC 4.19.99.5), (6) Acyl-CoA-reductase Active polypeptide (EC1.2.1.1.50), (7) Polypeptide with acyl-ACP reductase activity, (8) Polypeptide with ester synthase activity (EC3.1.1.67), ( 9) Fatty acid derivative selected from a polypeptide having OleA activity or (10) a polypeptide having OleCD or OleBCD activity One or more polypeptides having enzymatic activity are expressed or overexpressed and recombinant microorganisms The cell comprises an odd chain fatty acid, an odd chain fatty ester, an odd chain wax ester, an odd chain fatty aldehyde, an odd chain fatty alcohol, an even chain alcan, an even chain alken, an even chain internal olefin, an even chain terminal olefin or an even chain ketone. Produce a composition.

In one embodiment, the fatty acid derivative enzyme activity comprises thioesterase activity and the culture containing recombinant microbial cells produces a fatty acid composition containing an odd chain fatty acid when cultured in the presence of a carbon source. In some embodiments, the polypeptide is EC3.1.1.5, EC3.1.2. -Or has thioesterase activity classified as EC 3.1.2.14. In some embodiments, the polypeptide having thioesterase activity is encoded by the tesA, tesB, fatA or fatB gene. In some embodiments, the polypeptide having thioesterase activity is endogenous to the parent microbial cell or exogenous to the parent microbial cell. In another embodiment, expression of a polynucleotide encoding a polypeptide having thioesterase activity is modulated in recombinant microbial cells. In some cases, polynucleotide expression is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having thioesterase activity has thioesterase activity and catalyzes the hydrolysis of the odd chain acyl-ACP to an odd chain fatty acid in vitro or in vivo, preferably in vivo. Sequences selected from SEQ ID NOs: 64, 65, 66, 67, 68, 69, 70, 71 and 72 or variants or fragments thereof that catalyze the alcoholic decomposition of the odd chain acyl-ACP into an odd chain fatty ester. include. In some embodiments, recombinant microbial cells according to a first aspect comprising a polynucleotide encoding a polypeptide having thioesterase activity are in culture medium containing the carbon source when cultured in the presence of a carbon source. At least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L or at least 2000 mg / L when cultured under conditions effective for expressing the polynucleotide in. Produces L odd chain fatty acids. In some embodiments, recombinant microbial cells according to a first aspect comprising a polynucleotide encoding a polypeptide having thioesterase activity produce a fatty acid composition comprising an odd chain fatty acid and an even chain fatty acid. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90 of the fatty acids in the composition. % Is an odd chain fatty acid.

The present invention comprises a cell culture comprising recombinant microbial cells according to the first aspect.

In a second aspect, the present invention is a method for producing an odd-chain fatty acid derivative (or a fatty acid derivative composition containing an odd-chain fatty acid derivative) in recombinant microbial cells, which increases the production of propionyl-CoA in the cells. Intracellular expression of recombinant polypeptides with effective enzymatic activity and under conditions effective for expressing recombinant polypeptides in the presence of carbon sources and producing odd chain fatty acid derivatives. Includes methods including culturing and.

In one embodiment, the method for producing a fatty acid derivative composition containing an odd-chain fatty acid derivative is to obtain recombinant microbial cells according to the first aspect and to obtain (a), (b) in a culture medium containing a carbon source. ) And (c) are expressed, and the cells are cultured under conditions effective for producing a fatty acid derivative composition containing an odd-chain fatty acid derivative, and the composition is appropriately recovered from the culture medium. including.

In some embodiments, the fatty acid derivative composition produced by the method according to the second embodiment comprises an odd-chain fatty acid derivative and an even-chain fatty acid derivative, at least 5% by weight, at least 6% by weight, of the fatty acid derivative in the composition. %, At least 8% by weight, at least 10% by weight, at least 20% by weight, at least 30% by weight, at least 40% by weight, at least 50% by weight, at least 60% by weight, at least 70% by weight, at least 80% by weight or at least 90% by weight. % Is an odd chain fatty acid derivative. In some embodiments, the fatty acid derivative composition comprises at least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg of the odd chain fatty acid derivative. Included in an amount (eg, titer) of / L, at least 5000 mg / L, at least 10000 mg / L or at least 20000 mg / L.

In various embodiments of the second embodiment, the fatty acid derivative enzyme activity includes thioesterase activity, ester synthase activity, fatty aldehyde biosynthesis activity, fatty alcohol biosynthesis activity, ketone biosynthesis activity and / or hydrocarbon biosynthesis. Includes activity. In some embodiments, recombinant microbial cells are polynucleotides encoding two or more polypeptides, each comprising a polynucleotide having fatty acid derivative enzyme activity. In a further specific embodiment, the recombinant microbial cells are (1) a polypeptide having thioesterase activity, (2) a polypeptide having decarboxylase activity, (3) a polypeptide having carboxylic acid reductase activity, (4). Polypeptide having alcohol dehydrogenase activity (EC1.1.1.1), (5) Polypeptide having aldehyde decarbonylase activity (EC4.19.99.5), (6) Acyl-CoA-reductase activity (EC 1.2.1.50), (7) a polypeptide having an acyl-ACP reductase activity, (8) a polypeptide having an ester synthase activity (EC 3.11.67), (9). ) Fatty acid derivative selected from a polypeptide having OleA activity or (10) a polypeptide having OleCD or OleBCD activity. Recombinant microbial cells expressing or overexpressing one or more polypeptides having enzymatic activity. Is one or more odd chain fatty acids, odd chain fatty esters, odd chain wax esters, odd chain fatty aldehydes, odd chain fatty alcohols, even chain alcans, even chain alkens, even chain internal olefins, even chain terminal olefins and even A composition containing a chain ketone is produced.

The present invention comprises a fatty acid derivative composition comprising an odd chain fatty acid derivative produced by the method according to the second aspect.

In the third aspect, the present invention is a method for producing a recombinant microbial cell that produces an odd-chain fatty acid derivative having a higher titer or a higher proportion than that of the parent microbial cell, and encodes a polypeptide having fatty acid derivative enzyme activity. Propionyl-CoA can be produced or produced in a larger amount than the amount of propionyl-CoA produced by the parent microbial cells when the parent microbial cells containing the polynucleotides are obtained and cultured under the same conditions. Effective for producing propionyl-CoA and fatty acid derivatives in recombinant microbial cells, including manipulating the parent microbial cells to obtain recombinant microbial cells. A method for producing an odd-chain fatty acid derivative having a higher titer or a higher proportion than the titer or ratio of an odd-chain fatty acid derivative produced by a parent microbial cell cultured under the same conditions. include.

In a fourth aspect, the invention is a method of increasing the titer or proportion of an odd chain fatty acid derivative produced by a microbial cell, which is the same as obtaining a parent microbial cell capable of producing a fatty acid derivative. Manipulate parent microbial cells to produce recombinant microbial cells that produce or are capable of producing more propionyl-CoA than the amount of propionyl-CoA produced by the parent microbial cells when cultured under conditions. Including that, when the recombinant microbial cells were cultured in the presence of a carbon source under conditions effective for producing propionyl-CoA and fatty acid derivatives in the recombinant microbial cells, the parents were cultured under the same conditions. It comprises a method of producing a higher titer or a higher proportion of an odd chain fatty acid derivative relative to a titer or proportion of the odd chain fatty acid derivative produced by microbial cells.

In some embodiments according to the third or fourth embodiment, the step of manipulating the parent microbial cell is (a) aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity. One or more polypeptides having (b) (R) -citlamalonyl synthase activity, isopropylamine acid isomerase activity and beta-isopropylmalonyl dehydrogenase activity, and ( c) A poly encoding a polypeptide selected from one or more polypeptides having methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase activity, methylmalonyl-CoA carboxyltransferase activity and methylmalonyl-CoA epimerase activity. Including manipulating the cell to express the nucleotide, at least one polypeptide according to (a), (b) or (c) is exogenous to the parent microbial cell, or (a), (b). ) Or (c), the expression of at least one polynucleotide is modulated in recombinant microbial cells as compared to the expression of the polynucleotide in parental microbial cells. In some embodiments, expression of at least one polynucleotide is modulated by overexpression of the polynucleotide, such as by manipulative linkage of the polynucleotide to an exogenous promoter. In some embodiments, the engineered cells express one or more polypeptides according to (a) and one or more polypeptides according to (b).

In some embodiments according to the third or fourth embodiment, the parent microbial cell comprises a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate. In some embodiments, the recombinant microbial cell expresses an exogenous polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, or an endogenous polynucleotide. Is manipulated to overexpress. In some embodiments, recombinant microbial cells are engineered to express exogenous polynucleotides encoding polypeptides with β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate. Expression of endogenous polynucleotides encoding polypeptides with β-ketoacyl-ACP synthase activity is diminished. In some embodiments, the polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase has a modified, mutant or variant form of the endogenous polynucleotide and is unmodified endogenous. It has been selected for its enhanced affinity or activity for propionyl-CoA as a substrate for polynucleotides. Numerous methods for producing modified mutants or mutant polynucleotides are well known in the art and examples are described herein below.

[Invention 1001]
(A) An increased amount of propionyl-CoA relative to the amount of propionyl-CoA produced in a parent microbial cell that lacks or has a reduced amount of effective enzymatic activity to produce propionyl-CoA. A polynucleotide encoding a polypeptide having said enzymatic activity effective for producing CoA in recombinant microbial cells, wherein the polypeptide is exogenous to recombinant microbial cells or expression of said polynucleotide. The polynucleotide, which is modulated in recombinant microbial cells, as compared to the expression of the polynucleotide in parental microbial cells,
(B) A polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, and (c) a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity,
Recombinant microbial cells containing
Fatty acid derivative composition comprising an odd chain fatty acid derivative when the recombinant microbial cells are cultured in the presence of a carbon source under conditions effective for expressing the polynucleotide according to (a), (b) and (c). Generate things,
Recombinant microbial cells in which at least 10% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives.
[Invention 1002]
The recombinant microbial cell of the present invention 1001 in which at least 20% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives.
[Invention 1003]
The recombinant microbial cell of the present invention 1001 that produces at least 100 mg / L of an odd chain fatty acid derivative.
[Invention 1004]
The recombinant microbial cell of the present invention 1001 in which the expression of at least one polynucleotide according to (a) is modulated by the overexpression of the polynucleotide in the recombinant microbial cell.
[Invention 1005]
The polynucleotide according to (a)
(I) One or more polynucleotides encoding a polypeptide having aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(Ii) (R) -One or more polynucleotides encoding a polypeptide having citramalate synthase activity, isopropylamolic acid isomerase activity and beta-isopropylmalonyl dehydrogenase activity; and (iii) methylmalonyl- One or more polynucleotides encoding a polypeptide having CoA mutase activity, methylmalonyl-CoA decarboxylase activity and methylmalonyl-CoA carboxyltransferase activity,
The recombinant microbial cell of the present invention 1001 selected from the group consisting of.
[Invention 1006]
The recombinant microbial cell of the present invention 1005 comprising one or more polynucleotides according to (i) and one or more polynucleotides according to (ii).
[Invention 1007]
Polypeptides with β-ketoacyl-ACP synthase activity that utilize propionyl-CoA as a substrate have β-ketoacyl-ACP synthase activity that is exogenous to recombinant microbial cells and endogenous to recombinant microbial cells. Recombinant microbial cells of the invention 1001 in which the expression of the polypeptide is attenuated.
[Invention 1008]
Recombinant of the present invention 1001 in which the fatty acid derivative enzyme activity comprises thioesterase activity, recombinant microbial cells produce a fatty acid composition comprising an odd chain fatty acid, and at least 10% of the fatty acids in the composition are odd chain fatty acids. Microbial cells.
[Invention 1009]
The fatty acid derivative enzyme activity comprises an ester synthase activity, recombinant microbial cells produce an adipose ester composition comprising an odd chain adipose ester, and at least 10% of the adipose ester in the composition is an odd chain adipose ester. Recombinant microbial cells of invention 1001.
[Invention 1010]
Fatty acid derivative enzyme activity comprises lipoaldehyde biosynthesis activity, recombinant microbial cells produce fatty aldehyde compositions comprising odd chain fatty aldehydes, and at least 10% of the fatty aldehydes in the composition are odd chain fatty aldehydes. The recombinant microbial cell of the present invention 1001.
[Invention 1011]
Fatty acid derivative enzyme activity comprises fatty alcohol biosynthesis activity, recombinant microbial cells produce fatty alcohol compositions containing odd chain fatty alcohols, and at least 10% of the fatty alcohols in the composition are odd chain fatty alcohols. The recombinant microbial cell of the present invention 1001.
[Invention 1012]
The fatty acid derivative enzyme activity comprises a hydrocarbon biosynthesis activity, recombinant microbial cells produce a hydrocarbon composition comprising even-chain hydrocarbons, and at least 10% of the hydrocarbons in the composition are even-chain hydrocarbons. The recombinant microbial cell of the present invention 1001.
[Invention 1013]
A cell culture containing the recombinant microbial cells of the present invention 1001.
[Invention 1014]
A method for producing a fatty acid derivative composition containing an odd-chain fatty acid derivative.
Obtaining the recombinant microbial cells of the present invention 1001
Recombined under conditions effective for expressing the polynucleotides according to (a), (b) and (c) in a culture medium containing a carbon source and producing a fatty acid derivative composition containing an odd chain fatty acid derivative. By culturing microbial cells, at least 10% of the fatty acid derivatives in the composition are odd chain fatty acid derivatives, and optionally, recovering the odd chain fatty acid derivative composition from the culture medium.
How to include.
[Invention 1015]
Recombinant microbial cells,
(1) Polypeptide having thioesterase activity;
(2) Polypeptide having decarboxylase activity;
(3) Polypeptide having carboxylic acid reductase activity;
(4) Polypeptide having alcohol dehydrogenase activity (EC 1.1.1.1);
(5) Polypeptide having aldehyde decarbonylase activity (EC 4.1.99.5);
(6) A polypeptide having acyl-CoA-reductase activity (EC 1.2.1.50);
(7) Polypeptide having acyl-ACP reductase activity;
(8) Polypeptide having ester synthase activity (EC 3.1.1.67);
(9) Polypeptides with OleA activity; and (10) Polypeptides with OleCD or OleBCD activity,
A fatty acid derivative selected from the group consisting of expressing one or more polynucleotides encoding a polypeptide having enzymatic activity.
Recombinant microbial cells are one of odd chain fatty acids, odd chain adipose esters, odd chain fatty aldehydes, odd chain fatty alcohols, even chain alkenes, even chain alkenes, even chain terminal olefins, even chain internal olefins or even chain ketones. The method of the present invention 1014, which produces a composition comprising a plurality.
[Invention 1016]
A method for producing recombinant microbial cells that produce higher titers or higher proportions of odd-chain fatty acid derivatives than those produced by parental microbial cells.
Obtaining parental microbial cells containing a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity and a polypeptide encoding a fatty acid derivative enzyme activity utilizing propionyl-CoA as a substrate, and the same. Manipulate parent microbial cells to produce recombinant microbial cells that produce or are capable of producing more propionyl-CoA than the amount of propionyl-CoA produced by the parent microbial cells when cultured under conditions. That, including
When recombinant microbial cells are cultured in the presence of a carbon source under conditions effective for expressing the polynucleotide, the titer or percentage of odd-chain fatty acid derivatives produced by the parent microbial cells cultured under the same conditions. A method of producing a higher titer or a higher proportion of odd-chain fatty acid derivatives.
[Invention 1017]
The process of manipulating parental microbial cells
(A) Polypeptide having aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(B) Polypeptides with (R) -citramalate synthase activity, isopropylamonic acid isomerase activity and beta-isopropylmalonyl dehydrogenase activity; and (c) methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase. Polypeptides having either active or methylmalonyl-CoA carboxyltransferase activity and optionally methylmalonyl-CoA epimerase activity,
Containing the manipulation of parent microbial cells to express a polynucleotide encoding a polypeptide selected from the group consisting of
At least one polynucleotide according to (a), (b) or (c) is exogenous to the parent microbial cell, or at least one polynucleotide according to (a), (b) or (c) The method of the invention 1016, wherein the expression of is modulated in recombinant microbial cells as compared to the expression of polynucleotides in parental microbial cells.
[Invention 1018]
Recombinant microbial cells have been engineered to express foreign polynucleotides encoding polypeptides with β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, β-ketoacyl-ACP synthase. The method of the invention 1016, wherein the expression of an endogenous polynucleotide encoding an active polypeptide is attenuated.
[Invention 1019]
A method of increasing the titer or proportion of odd-chain fatty acid derivatives produced by microbial cells.
Propionyl-CoA can be produced or produced in greater amounts than the amount of propionyl-CoA produced by the parent microbial cells when the parent microbial cells that produce the fatty acid derivatives are obtained and cultured under the same conditions. Including manipulating parental microbial cells to obtain recombinant microbial cells, including
When recombinant microbial cells are cultured in the presence of a carbon source under conditions effective for producing propionyl-CoA and fatty acid derivatives in recombinant microbial cells, they are produced by the parent microbial cells cultured under the same conditions. A method for producing an odd-chain fatty acid derivative having a higher titer or a higher proportion than the titer or proportion of the odd-chain fatty acid derivative.
[Invention 1020]
The fatty acid derivative composition produced by the method of the present invention 1014.
These and other objects and properties of the invention will become more fully apparent upon reading the following detailed description in conjunction with the accompanying drawings.

FIGS. 1A and 1B compare examples of intermediates and products of the fatty acid biosynthetic pathway when fed different acyl-CoA "primer" molecules. FIG. 1A shows an example of a reaction pathway utilizing the 2-carbon primer acetyl-CoA, in which an even chain length β-ketoacyl-ACP intermediate acetoacetyl-ACP is produced and even chain (ec)-. The acyl-ACP intermediate and the even chain fatty acid derivatives produced from it are derived. FIG. 1B shows a reaction pathway utilizing the 3-carbon primer propionyl-CoA, which produces an odd chain length β-ketoacyl-ACP intermediate 3-oxovaleryll-ACP, which produces an odd chain (oc) -acyl. -ACP intermediates and odd-chain fatty acid derivatives produced from them are derived. FIG. 2 shows the production of propionyl-CoA via the intermediate α-ketobutyric acid by the threonine biosynthesis pathway (pathway (A)) and the citramalic acid biosynthesis pathway (pathway (B)) as described herein. An example of the route for increase is shown. FIG. 3 shows an example of a pathway for increased production of propionyl-CoA via the methylmalonyl-CoA biosynthesis pathway (pathway (C)) as described herein.

The particular compositions and methods described herein are, of course, subject to change, and the invention is not limited thereto. It should also be understood that the terms used herein are for purposes of describing particular embodiments only and do not limit the scope of the invention.

Accession Numbers: Throughout this description, sequence accession numbers are derived from a database provided by NCBI (National Bioinformatics Information Center) maintained by the National Institutes of Health in the United States (in this specification, "NCBI Accession Numbers" or "GenBank". Obtained from the UniProt Knowledge Database (UniProtKB) and Swiss-Prot Database (identified herein as "UniProtKB Contract Number") provided by the Swiss Bioinformatics Institute). Unless otherwise explicitly indicated, the sequence identified by the NCBI / GenBank accession number is version number 1 (ie, the version number of the sequence is "accession number 1"). The NCBI and UniProtKB accession numbers provided herein were up to date as of August 2, 2011.

Enzyme Classification (EC) Numbers: EC numbers have been established by the International Union of Biochemistry and Molecular Biology (IUBMB) Naming Committee, the description of which is available on the IUBMB Enzyme Naming Website on the Worldwide Web. The EC number classifies the enzyme according to the reaction it catalyzes. The EC numbers referenced herein are obtained from the KEGG ligand database, partly maintained by Kyoto Encyclopedia of Genes and Genomics, which is endorsed by the University of Tokyo. Unless otherwise specified, EC numbers are as provided in the KEGG database as of August 2, 2011.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as would normally be understood by an engineer in the art to which the invention belongs. Any material and method similar to or equivalent to that described herein can be used in the practice or testing of the invention, but preferred compositions and methods are described herein.

Definitions In the specification, the term "fatty acid" refers to a carboxylic acid having the formula R- (C = O) -OH, in which R is between about 4 and about 36 carbon atoms in length. More generally, it represents a carbon chain that may be between about 4 and about 22 carbon atoms in length. Fatty acids may be saturated or unsaturated. In the case of unsaturated, R may have one or more unsaturated points, i.e. R may be mono-unsaturated or poly-unsaturated. R may be a straight line (also referred to herein as a "liner chain") or a branched chain. The term "fatty acid" may be used herein to refer to a "fatty acid derivative" that may include one or more different fatty acid derivatives or mixtures of fatty acid derivatives.

As used herein, "odd chain fatty acid" (abbreviated as "oc-FA") refers to a fatty acid molecule having a linear carbon chain containing an odd number of carbon atoms, including carbonyl carbon. Non-limiting examples of oc-FA include saturated oc-FA tridecanoic acid (C13: 0), pentadecanoic acid (C15: 0) and heptadecanoic acid (C17: 0) and unsaturated (ie monounsaturated) oc. -FA contains heptadecanoic acid (C17: 1).

As used herein, the term "β-ketoacyl-ACP" refers to beta-ketoacyl-ACP synthase activity (eg, as represented by the portion of the pathway (D) shown in FIGS. 1A and 1B). Refers to the condensation product of an acyl-CoA primer molecule and malonyl-ACP catalyzed by an enzyme having EC23.1.180). The acyl-CoA primer molecule may have an acyl group containing an even number of carbon atoms such as acetyl-CoA shown in FIG. 1A, in which case the resulting β-ketoacyl-ACP intermediate is acetocetyl-. In ACP, this is an even chain (ec-) β-ketoacyl-ACP. The acyl-CoA primer molecule may have an acyl group containing an odd number of carbon atoms such as propionyl-CoA as shown in FIG. 1B, in which case the resulting β-ketoacyl-ACP intermediate may be 3-oxovaleryl-ACP, which is an odd chain (oc-) β-ketoacyl-ACP. The β-ketoacyl-ACP intermediate enters the fatty acid synthase (FAS) cycle represented in part (E) of FIGS. 1A and 1B and undergoes a cycle of extension reactions (ie, keto reduction, dehydration and enoyl reduction) and acyl. Two carbon units are added to the chain, followed by further extension cycles, each cycle involving condensation with another malonyl-ACP molecule, keto reduction, dehydration and enoyl reduction, thus acyl-ACP. In the acyl chain of, two carbon units are extended per extension cycle.

"Acyl-ACP" generally refers to the product of one or more FAS-catalyzed extensions of the β-ketoacyl-ACP intermediate. Acyl-ACP is an acylthioester formed between the carbonyl carbon of an alkyl chain and the sulfhydryl group of the 4'-phosphopanthethionyl moiety of an acyl carrier protein (ACP), usually in the case of linear carbon chains. It has the formula CH3- (CH2) n-C (= O) -s-ACP, in which n is an even number (eg, "even chain acyl-ACP" or "ec-acyl-ACP", eg, acetyl. -Generated when CoA is a primer molecule, see FIG. 1A) or odd (eg, "odd chain acyl-ACP" or "oc-acyl-ACP", eg, produced when propionyl-CoA is a primer molecule. , See FIG. 1B).

Unless otherwise stated, a "fatty acid derivative" (abbreviated as "FA derivative") is intended to include any product produced, at least in part, by the fatty acid biosynthetic pathway of recombinant microbial cells. Fatty acid derivatives also include any product made at least in part by fatty acid pathway intermediates such as acyl-ACP intermediates. The fatty acid biosynthesis pathway described herein can include fatty acid derivative enzymes that can be engineered to produce fatty acid derivatives, and in some cases, for example, carbon chains containing the desired number of carbon atoms. Further express the enzyme to produce a fatty acid derivative having the desired carbon chain properties, such as a composition of a fatty acid derivative having a fatty acid derivative or a composition of a fatty acid derivative having a desired proportion of a derivative containing an odd number of carbon chains. Can be made to. Fatty acid derivatives include, but are not limited to, fatty acids, fatty aldehydes, fatty alcohols, fatty esters (such as waxes), hydrocarbons (such as alkenes and alkenes (including terminal olefins and internal olefins)) and ketones.

The term "odd chain fatty acid derivative" (abbreviated as "oc-FA derivative") refers to the product of the reaction of oc-acyl-ACP with one or more fatty acid derivative enzymes, as defined above. Unless the fatty acid derivative is itself an oc-FA derivative or a product of decarbonylation or decarboxylation of an oc-acyl-ACP, i.e., the resulting oc-FA derivative has an even number of carbon atoms. For example, the fatty acid derivative is produced by decarboxylation of oc-alkene or ec-alkene produced by decarbonylation of oc-fatty acid, ec-terminal olefin produced by decarboxylation of oc-fatty acid, and oc-acyl-ACP. The fatty acid derivative product thus obtained has a linear carbon chain containing an odd number of carbon atoms, except when it is an ec-ketone or an ec-internal olefin. Such even chain length products of oc-FA derivatives or oc-acyl-ACP precursor molecules have linear chains containing even carbon atoms but still fall within the definition of "oc-FA derivative". Please be understood as being considered.

An "intrinsic" polypeptide refers to a polypeptide encoded by the genome of a parental microbial cell (also referred to as a "host cell") on which a recombinant cell has been engineered (or "obtained").

An "foreign" polypeptide refers to a polypeptide that is not encoded by the genome of the parent microbial cell. A mutant (ie, mutant) polypeptide is an example of an exogenous polypeptide.

In embodiments of the invention in which the polynucleotide sequence encodes an endogenous polypeptide, the endogenous polypeptide is optionally overexpressed. As used herein, "overexpression" refers to a polynucleotide or polypeptide in a cell at a higher concentration than normally produced in the corresponding parent cell (eg, wild-type cell) under the same conditions. It means to generate or cause generation. When a polynucleotide or polypeptide is present at higher concentrations in recombinant microbial cells as compared to concentrations in homologous non-recombinant microbial cells (eg, parent microbial cells) under the same conditions, the polynucleotide or polypeptide. Can be "overexpressed" in recombinant microbial cells. Overexpression can be achieved by any suitable means known in the art.

In some embodiments, overexpression of endogenous polypeptides in recombinant microbial cells can be achieved by the use of exogenous regulatory elements. The term "foreign regulatory element" generally refers to a regulatory element (eg, an expression control sequence or compound) that originates from outside the host cell. However, in certain embodiments, is the term "foreign regulatory element" (eg, "foreign promoter") replicated in its function to regulate the expression of endogenous polypeptides in recombinant cells? Or it can refer to a regulatory element obtained from a deprived host cell. For example, the host cell is E. In the case of coli cells, the polypeptide is an endogenous polypeptide and the expression of the endogenous polypeptide in the recombinant cell is another E.I. It can be controlled by a promoter obtained from the coli gene. In some embodiments, the exogenous regulatory element that causes an increase in the level of expression and / or activity of the endogenous polypeptide is a compound such as a small molecule.

In some embodiments, an exogenous regulatory element that controls the expression of a polynucleotide encoding an endogenous polypeptide (eg, an endogenous polynucleotide) manipulates the endogenous polynucleotide into the genome of a host cell by recombinant integration. It is an expression control sequence that is ligated as possible. In certain embodiments, the expression control sequence is integrated into the host cell chromosome by homologous recombination using methods known in the art (eg, Datanko et al., Proc. Natl. Acad. Sci. U. S.A., 97 (12):
6640-6645 (2000)).

Expression control sequences are known in the art and include, for example, promoters, enhancers, polyadenylation signals, transcription terminators, ribosome entry sites (IRES), etc. that result in the expression of polynucleotide sequences in host cells. The expression control sequence specifically interacts with the cellular proteins involved in transcription (Maniatis et al., Science 236: 1237-1245 (1987)). Examples of expression control sequences include, for example, Goddel, Gene Expression Technology: Methods in Enzymelogic, Vol. 185, Academic Press, San Diego, Calif. (1990).

In the method of the invention, the expression control sequence is operably linked to the polynucleotide sequence. "Manipulatively linked" means a polynucleotide sequence and expression control in a manner that allows gene expression when the appropriate molecule (eg, a transcriptionally activated protein) binds to the expression control sequence (s). Means that sequences (s) are connected. The operably linked promoter is located upstream of the polynucleotide sequence selected in terms of transcriptional and translational orientation. The operably linked enhancer can be located upstream, inside or downstream of the polynucleotide of choice. Additional nucleic acid sequences, such as selection markers, purified moieties, nucleic acid sequences encoding target proteins, etc., can be operably linked to the polynucleotide sequence such that the additional nucleic acid sequence is expressed with the polynucleotide sequence.

In some embodiments, the polynucleotide sequence is given to recombinant cells by a recombinant vector comprising a promoter operably linked to the polynucleotide sequence. In certain embodiments, the promoter is an organelle-specific, tissue-specific, inducible, constitutive or cell-specific promoter that is developmentally regulated.

As used herein, the term "vector" refers to another ligated nucleic acid, a nucleic acid molecule capable of transporting a polynucleotide sequence. One useful vector is episomes (ie, nucleic acids capable of extrachromosomal replication). A useful vector is one that allows self-replication and / or expression of the ligated nucleic acid. A vector capable of targeting the expression of an operably linked gene is referred to herein as an "expression vector". In general, expression vectors useful in recombinant DNA technology are often in the form of "plasmids", which usually refer to circular double-stranded DNA loops that do not bind to chromosomes in vector form. The terms "plasmid" and "vector" are used interchangeably herein because plasmid is the most commonly used form of vector. However, such other forms of expression vectors that perform equivalent functions and will become known in the art in the future are also included.

In some embodiments, the recombinant vector is (a) an expression control sequence operably linked to a polynucleotide sequence, (b) a selection marker operably linked to a polynucleotide sequence, and (c) a polynucleotide sequence. Operatively linked marker sequences, (d) purified moieties operably linked to polynucleotide sequences, (e) secretory sequences operably linked to polynucleotide sequences, and (f) operably linked to polynucleotide sequences. Contains at least one sequence selected from the group consisting of the target sequences.

The expression vector described herein comprises a form of polynucleotide sequence described herein appropriate for expression of the polynucleotide sequence in a host cell. Those of skill in the art will appreciate that the design of an expression vector can depend on factors such as the choice of host cell to transform, the level of expression of the desired polypeptide, and the like. The expression vector described herein can be introduced into a host cell to produce a polypeptide comprising a fusion polypeptide encoded by the polynucleotide sequence described herein.

Prokaryotic cells, such as E. coli. Expression of the gene encoding the polypeptide in coli is often carried out with a vector containing a constitutive or inducible promoter that targets the expression of either the fused or non-fused polypeptide. The fusion vector usually adds some amino acids to the amino or carboxy terminus of the recombinant polypeptide to the polypeptide encoded within the vector. Such fusion vectors usually serve one or more of the following three objectives: (1) increased expression of the recombinant polypeptide, (2) increased solubility of the recombinant polypeptide and (3) affinity. Assisting in the purification of recombinant polypeptides by acting as a ligand in purification. Often, fusion expression vectors introduce proteolytic cleavage sites into the fusion moiety and the junction of the recombinant polypeptide. This allows the recombinant polypeptide to be separated from the fusion moiety after purification of the fusion polypeptide. Examples of such enzymes and homologous recognition sequences include factor Xa, thrombin and enterokinase. Examples of fusion expression vectors include pGEX (Pharmacia Biotech, Inc., Piscataway, NJ; Smith et al., Gene, 67: 31-40 (1988)), pMAL (New England Biolabs), and pMAL (New England Biolabs). Pharmacia Biotech, Inc., Piscataway, NJ) are included, each of which is fused to a target recombinant polypeptide with glutathione S-transferase (GST), Martose E-binding protein or protein A.

The vector can be introduced into prokaryotic or eukaryotic cells by conventional transformation or gene transfer techniques. As used herein, the terms "transformation" and "gene transfer" include exogenous nucleic acids such as calcium phosphate or calcium chloride co-precipitation, gene transfer with DEAE dextran, lipofection or electroporation. Refers to various techniques confirmed in the art for introducing DNA) into host cells. Suitable methods for transforming or transfecting host cells are described, for example, in Sambrook et al. Can be found in (above).

For stable transformation of bacterial cells, it is known to extract only a small fraction of the cell and replicate the expression vector, depending on the expression vector and transformation technique used. To identify and select these transformants, a gene encoding a selectable marker (eg, resistance to antibiotics) can be introduced into the host cell along with the gene of interest. Selectable markers include, but are not limited to, markers that confer resistance to drugs such as ampicillin, kanamycin, clamphenicol or tetracycline. The nucleic acid encoding the selectable marker can be introduced into the host cell with the same vector as the vector encoding the polypeptide described herein, or can be introduced with another vector. Host cells that are stably transformed with the introduced nucleic acid to give rise to recombinant cells can be identified by proliferation in the presence of a suitable drug of choice.

Similarly, for stable gene transfer in mammalian cells, it is known that only a small fraction of the cell can integrate foreign DNA into its genome, depending on the expression vector and gene transfer technique used. To identify and select these integrations, a gene encoding a selectable marker (eg, resistance to antibiotics) can be introduced into the host cell along with the gene of interest. Preferred selectable markers include markers that confer resistance to drugs such as G418, hygromycin and methotrexate. The nucleic acid encoding the selectable marker can be introduced into the host cell with the same vector as the vector encoding the polypeptide described herein, or can be introduced with another vector. Host cells that are stably transgeniced with the introduced nucleic acid to give rise to recombinant cells can be identified by proliferation in the presence of a suitable drug of choice.

As used herein, "gene knockout" refers to the procedure of modifying or inactivating a gene encoding a target protein in order to reduce or eliminate the function of the intact protein. Gene inactivation can be mutagenesis by UV irradiation or treatment with N-methyl-N'-nitro-N-nitrosoguanidine, site-specific mutagenesis, homologous recombination, insertion deletion mutations or "Red-driven". It can be carried out by a general method such as "integration" (Dasenko et al., Proc. Natl. Acad. Sci. USA, 97: 6640-45, 2000). For example, in one embodiment, the construct is introduced into the parent cell so that the homologous recombination event can be selected in the resulting recombinant cell. One of ordinary skill in the art can easily design a knockout construct containing both positive and negative selection genes in order to efficiently select transgenic (ie, recombinant) cells that have undergone a homologous recombination event in the construct. You can do it. Changes in parental cells can be obtained, for example, by single or double crossover recombination by substituting wild-type (ie, endogenous) DNA sequences with DNA sequences containing the changes. For convenient selection of transformants (ie, recombinant cells), this change is, for example, a DNA sequence encoding an antibiotic resistance marker or a gene that complements the potential auxotrophy of the host cell. You may. Mutations include, but are not limited to, deletion insertion mutations. Examples of such changes in recombinant cells include gene disruption, ie, gene disruption, in which products normally produced from a gene are not functionally produced. This can be done by a complete deletion, a deletion or insertion of a selectable marker, an insertion of a selectable marker, a frameshift mutation, an inframe deletion or a point mutation that causes a premature termination. In some cases, the entire mRNA of the gene is absent. In other situations, the amount of mRNA produced will vary.

The expression "increased expression level of an endogenous polypeptide" means causing overexpression of the polynucleotide sequence encoding the endogenous polypeptide, or causing overexpression of the endogenous polypeptide sequence. The degree of overexpression is about 1.5 times or more, about 2 times or more, about 3 times or more, about 5 times or more, about 10 times or more, about 20 times or more, about 50 times or more, about 100 times or more, or theirs. It may be in any range.

The expression "increasing the activity level of an endogenous polypeptide" means enhancing the biochemical or biological function (eg, enzymatic activity) of the endogenous polypeptide. The degree of activity enhancement is about 10% or more, about 20% or more, about 50% or more, about 75% or more, about 100% or more, about 200% or more, about 500% or more, about 1000% or more, or any of them. It may be a range.

The expression "expression of said polynucleotide sequence has been modified relative to wild-type polynucleotide sequence", as used herein, increases the level of expression and / or activity of the endogenous polynucleotide sequence or Means a decrease. In some embodiments, the exogenous regulatory element that controls the expression of the endogenous polynucleotide is an expression control sequence that is operably linked to the genome of the host cell by recombinant integration. In some embodiments, the expression control sequence is integrated into the host cell chromosome by homologous recombination using methods known in the art.

As used herein, the phrase "under conditions effective for expressing the polynucleotide sequence (s)" is optional, allowing recombinant cells to produce the desired fatty acid derivative. Means the condition of. Suitable conditions include, for example, fermentation conditions. Fermentation conditions can include many parameters such as temperature range, aeration level and medium composition. Each of these conditions, individually and in combination, allows the growth of host cells. Examples of culture media include broth or gel. Generally, the medium contains a carbon source through which the recombinant cells can directly metabolize. Fermentation means the use of a carbon source by a production host such as the recombinant microbial cells of the invention. Fermentation may be aerobic, anaerobic or a variant thereof (such as microaerobic). As will be appreciated by those skilled in the art, recombinant microbial cells source carbon from oc-acyl-ACP or desired oc-FA derivatives (eg, oc-fatty acids, oc-fat esters, oc-fat aldehydes, oc-fat alcohols). , Ec-alkanes, ec-alkenes or ec-ketones) will vary in part based on specific microorganisms. In some embodiments, this process occurs in an aerobic environment. In some embodiments, this process occurs in an anaerobic environment. In some embodiments, this process occurs in a microaerobic environment.

As used herein, the term "carbon source" refers to a substrate or compound suitable for use as a source of carbon for the proliferation of prokaryotic cells or simple eukaryotic cells. Carbon sources are, but are not limited to, polymers, carbohydrates (eg, saccharides such as monosaccharides, disaccharides, oligosaccharides and polysaccharides), acids, alcohols, aldehydes, ketones, amino acids, peptides and gases (eg, CO and CO). It may be in various forms including ₂ ). Examples of carbon sources include, but are not limited to, monosaccharides such as glucose, fructose, mannose, galactose, xylose and arabinose, disaccharides such as sucrose, maltose, cellobiose and turanose, oligosaccharides such as fructo-oligosaccharides and galactoligosaccharides. Polysaccharides such as starch, cellulose, pectin and xylane, cellulose substances and variants such as hemicellulose, methylcellulose and sodium carboxymethylcellulose, alcohols such as saturated or unsaturated fatty acids, succinic acid, lactic acid and acetic acid, ethanol, methanol and glycerol or them. Contains a mixture of. The carbon source may be a product of photosynthesis such as glucose. In certain preferred embodiments, the carbon source is obtained from biomass. In another preferred embodiment, the carbon source comprises sucrose. In another preferred embodiment, the carbon source comprises glucose.

As used herein, the term "biomass" refers to any biological material from which a carbon source is available. In some embodiments, the biomass is processed into a carbon source suitable for biological conversion. In other embodiments, the biomass does not need to be further treated with a carbon source. Carbon sources can be converted to biofuels. Examples of biomass sources are plant matter or vegetation such as corn, sugar cane or American millet. Another example of a biomass source is metabolic waste such as animals (eg cow dung fertilizer). Further examples of biomass sources include algae and other marine plants. Biomass also includes, but is not limited to, fermented waste, encilage, straw, wood, sewage, waste, cellulosic urban waste and industrial, agricultural, forestry and household waste including leftovers. The term "biomass" also refers to carbon sources such as carbohydrates (eg, monosaccharides, disaccharides or polysaccharides).

Recombinant microbial cells, eg, about 4, 8, 12, 24, 36, 48, 72, are used to determine if the conditions are sufficient to allow product production or polypeptide expression. It may be cultured for an hour or longer. Samples can be taken during and / or after culture and analyzed to determine if the conditions allow for generation or expression. For example, the presence of the desired product of recombinant microbial cells in a sample or medium in which recombinant microbial cells have grown can be tested. When testing the presence of a desired product such as an odd chain fatty acid derivative (eg, oc-fatty acid, oc-fat ester, oc-lipoaldehyde, oc-fatty alcohol or ec-hydrogen), but not limited to gas. Chromatography (GC), Mass Analysis (MS), Thin Layer Chromatography (TLC), High Speed Liquid Chromatography (HPLC), Liquid Chromatography (LC), GC with Hydrogen Flame Ionization Detector (GC-FID), GC- Assays such as MS and LC-MS can be used. When testing the expression of the polypeptide, techniques such as, but not limited to, Western blotting and dot blotting may be used.

As used herein, the term "microorganism" means prokaryotic and eukaryotic species in the domains of paleontobacteria, bacteria and eukaryotes, the latter including yeast and filamentous fungi, protozoa, algae and Includes higher protozoa. "Microbe" and "microbial cell" (ie, microbial cell) are used synonymously with "microorganism" to refer to cells or small organisms that can only be seen using a microscope. ..

In some embodiments, the host cell (eg, parent cell) is a microbial cell. In some embodiments, the host cells are Escherichia, Bacillus, Lactobacillus, Pantoea, Zymomonas, Rhodococcus, Pseudomonas spella, Pseudomonas spella, Pseudomonas, Pseudomonas, Pseudomonas, Pseudomonas, Pseudomonas. (Trichoderma), Neurospora, Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Pichia, Mucor, Mucor Fanerochaete, Pleurotus, Trichoderma, Chrysosporium, Saccharomyces, Saccharomyces, Streptomyces, Streptomyces Streptomyces), Synechococcus, Chlorella or Prototheca, a microbial cell selected from the genus.

In other embodiments, the host cells are Bacillus lentus cells, Bacillus brevis cells, Bacillus stearothermophilus cells, Bacillus likeniphophis cells, Bacillus cells. Bacillus alkalophilus cells, Bacillus coagulans cells, Bacillus cilculans cells, Bacillus cillus cells, Bacillus bulillis cells, Bacillus bulillis cells (Bacillus
Clausi) cells, Bacillus megaterium cells, Bacillus subtilis cells or Bacillus amyloliquefaciens cells.

In other embodiments, the host cells are Trichoderma aspergillus cells, Trichoderma viride cells, Trichoderma reesei cells, Trichoderma lysei cells, Trichoderma longibrachyamri, Trichoderma longibrachyam Aspergillus aspergillus cells, Aspergillus fumigates cells, Aspergillus foetidus cells, Aspergillus aspergillus cells, Aspergillus aspergillus cells, Aspergillus aspergillus cells, Aspergillus aspergillus cells ) Cells, Humicola insolens cells, Humicola lanuginose cells, Rhodococcus opacus cells, Rizomcor miehei (Rhizo) cells, Rhizom.

In yet another embodiment, the host cell is a Streptomyces lividans cell or a Streptomyces murinus cell.

In yet another embodiment, the host cell is an Actinomyces cell.

In some embodiments, the host cell is a Saccharomyces cerevisiae cell.

In yet another embodiment, the host cell is a CHO cell, COS cell, VERO cell, BHK cell, HeLa cell, Cvl cell, MDCK cell, 293 cell, 3T3 cell or PC12 cell.

In some embodiments, the host cell is a eukaryotic plant, algae, orchid algae, green sulfur bacterium, green non-sulfur bacterium, purple sulfur bacterium, purple non-sulfur bacterium, polar extreme bacterium, yeast, fungus, and their manipulation. It is a cell of a living organism or a synthetic organism. In some embodiments, the host cell is photodependent or carbon-immobilized. In some embodiments, the host cell has autotrophic activity. In some embodiments, the host cell has photoautotrophic activity, such as in the presence of light. In some embodiments, the host cell is heterotrophic or mixturetrophic in the absence of light.

In certain embodiments, the host cells are Avabidopsis thaliana, Panicum virgatum, Missanthus giganteus, Zymomonas mobilisco, Zymomonas mobilis braunii), Chlamydomonas Reinharudi (Chlamydomonas reinhardtii), Donariena salina (Dunaliela salina), Synechococcus species PCC7002, Synechococcus species PCC7942, Synechocystis (Synechocystis) species PCC6803, thermo Synechococcus elongatus (Thermosynechococcus elongates) BP-1, cloned from · Tepidamu (Chlorobium tepidum), chloro off Lexus aurantiacus Kas (Chlorojlexus auranticus), Kuromachiumu-Binosamu (Chromatiumm vinosum), Rodosupiriramu-Raburamu (Rhodospirillum rubrum), Rhodobacter Kapusurata (Rhodobacter capsulatus), Rhodopseudomonas pulse tris (Rhodopseudomonas palusris ), Clostridium Ryungudarii (Clostridium ljungdahlii), Clostridium thermocellum (Clostridiuthermocellum), Penicillium chrysogenum (Penicillium chrysogenum), Pichia pastoris (Pichia pastoris), Saccharomyces cerevisiae, Schizosaccharomyces pombe (Schizosaccharomyces pombe), Pseudomonas full It is a cell of olesense (Pseudomonas jluorecesns), Pantoea citrea or Zymomonas mobilis. In certain embodiments, the host cells are Chlorella protothecoides, Chlorella protothecoides, Chlorella pyrenodosa, Chlorella cholenoidosa, Chlorella kererellis, Chlorella protothecoides, Chlorella protothecoides, Chlorella protothecoides, Chlorella protothecoides, Chlorella protothecoides, Chlorella protothecoides. Chlorella vulgaris), Chlorella saccharophila (Chlorella saccharophila), Chlorella Sorokiniana (Chlorella sorokiniana), Chlorella ellipsometry Idia (Chlorella ellipsoidea), Prototheca Sutagunora (Prototheca stagnora), Prototheca Porotorisenshizu (Prototheca portoricensis), Prototheca moriformis (Prototheca moriformis), Prototheca wickerhamii or Prototheca zophii cells.

In some embodiments, the host cell is a bacterial cell. In some embodiments, the host cell is a Gram-positive bacterial cell. In some embodiments, the host cell is a Gram-negative bacterial cell.

In some embodiments, the host cell is E. coli. It is a coli cell. In some embodiments, E. The coli cells are B strain, C strain, K strain or W strain E. It is a coli cell.

In certain embodiments of the invention, host cells are engineered to express (or overexpress) transport proteins. Transport proteins can carry polypeptides and organic compounds (eg, fatty acids or derivatives thereof) out of the host cell.

As used herein, the term "metabolically engineered" or "metabolic manipulation" refers to oc-β- in recombinant cells, such as recombinant microbial cells as described herein. Rational pathway design and biosynthetic genes to produce the desired metabolites such as ketoacyl-ACP, oc-acyl-ACP or oc-fatty acid derivatives, and polynucleotides corresponding to genes associated with operons and such polys. Includes assembly of nucleotide control elements. "Metabolic manipulation" further refers to genetic manipulation including reduction, disruption or knockout of competing metabolic pathways that compete with intermediates leading to the desired pathway and regulation of transcription, translation, protein stability and protein function using appropriate culture conditions. And can include optimization of metabolic flow by optimization. A "biosynthetic gene" may be endogenous (natural) to the host cell (ie, a gene that has not been modified from the host cell), or by being exogenous to the host cell, or suddenly in a recombinant cell. It may be exogenous (heterologous) to the host cell by being modified by mutagenesis, recombination and / or association with an exogenous (heterologous) expression control sequence. A biosynthetic gene encodes a "biosynthetic polypeptide" or "biosynthetic enzyme".

The term "biosynthetic pathway" is also also referred to as a "metabolic pathway" and refers to a series of biochemical reactions catalyzed by biosynthetic enzymes that convert one species into another. As used herein, the term "fatty acid biosynthesis pathway" (or more simply, "fatty acid pathway") refers to fatty acid derivatives (eg, fatty acids, fatty esters, fatty aldehydes, fatty alcohols, alcans, alkens). , Ketone, etc.) refers to a series of biochemical reactions that produce. The fatty acid pathway can be engineered to produce fatty acid derivatives, as described herein, and in some embodiments, additional enzymes to produce fatty acid derivatives with the desired carbon chain properties. Includes fatty acid pathway biosynthetic enzymes (ie, "fatty acid pathway enzymes") that can be expressed with. For example, the "odd chain fatty acid biosynthesis pathway" described herein (ie, the "oc-FA pathway") contains sufficient enzymes to produce oc-fatty acid derivatives.

The term "recombinant microbial cell" refers to the introduction of a genetic material into selected "parent microbial cells" (ie, host cells) thereby altering or altering the cellular physiological and biochemical functions of the parent microbial cells. Refers to a microbial cell (ie, a microorganism) that has been genetically modified (ie, manipulated) by. With the introduction of genetic material, recombinant microbial cells have new or improved properties compared to parent microbial cells, such as the ability to produce larger amounts of new or existing intracellular metabolites. To win. The recombinant microbial cells provided herein are, for example, a plurality of biosynthetic enzymes (eg, oc-) involved in the pathway for producing oc-acyl-ACP intermediates or oc-fatty acid derivatives from suitable carbon sources. It expresses fatty acid pathway enzymes such as FA pathway enzymes). The genetic material introduced into the parent microbial cell is a gene (s) or genes encoding one or more enzymes involved in the biosynthetic pathway (ie, biosynthetic enzymes) for the production of oc-fatty acid derivatives. It may contain a portion, or may instead or further contain additional elements for the regulation of expression and / or expression of genes encoding such biosynthetic enzymes, such as promoter sequences. Thus, the recombinant microbial cells described herein are genetically engineered to express or overexpress the biosynthetic enzymes involved in the oc-fatty acid (oc-FA) biosynthetic pathway described herein. ing.

It should be understood that the terms "recombinant microbial cell" and "recombinant microbial cell" refer not only to specific recombinant microbial cells / microorganisms, but also to progeny or potential progeny of such cells.

Recombinant microbial cells, in place of or in addition to containing the genetic material introduced into the parent microbial cell, have reduced genes or polynucleotides that alter the cell physiology and biochemical function of the parent microbial cell. , Destruction, deletion or "knockout" may be included. Recombinant microbial cells are new compared to parent microbial cells, even with gene or polynucleotide degradation, disruption, deletion or "knockout" (also known as gene or polynucleotide "attenuation"). Or reduced properties (eg, the ability to produce new or larger intracellular metabolites, the ability to improve the flow of metabolites by the desired pathway, and / or the production of unwanted by-products. Ability to make).

Manipulation of Recombinant Fatty Acid Cells to Produce Odd Chain Fatty Acid Derivatives Many microbial cells usually produce linear fatty acids in which the linear aliphatic chain contains predominantly even carbon atoms, producing odd carbon atoms. The amount of fatty acid having a linear aliphatic chain contained is generally relatively small. E. In some cases, the amount of linear odd-chain fatty acids (oc-FA) and other linear odd-chain fatty acid derivatives (oc-FA derivatives) produced by such microbial cells such as coli is relatively low. This may be due to low levels of propionyl-CoA present in such cells. Such cells primarily utilize acetyl-CoA as a primer molecule for fatty acid biosynthesis to provide the majority of fatty acids, and other fatty acid derivatives produced by such cells are linear even chain fatty acids (ec). -FA) and other linear even-chain fatty acid derivatives (ec-FA derivatives).

The present invention is an oc-FA in which the engineered microorganism is produced by the parent microorganism by manipulating the microorganism to produce an increased amount of propionyl-CoA compared to the propionyl-CoA produced by the parent microorganism. A higher proportion of oc compared to the proportion of the oc-FA derivative in the fatty acid derivative composition which produces a larger amount (titer) of the oc-FA derivative compared to the amount of the derivative and / or is produced by the parent microorganism. -Based in part on the discovery of producing fatty acid derivative compositions with FA derivatives.

The ultimate goal is to realize a method for producing microbial derivatives, including oc-FA derivatives, that are environmentally reliable and cost effective, starting from industrial scale carbon sources (eg, carbohydrates or biomass). Therefore, by improving the yield of the oc-FA derivative molecule produced by the microorganism and / or optimizing the composition of the fatty acid derivative molecule produced by the microorganism (increasing the ratio of the odd chain product to the even chain product, etc.) ) Is desired. Therefore, in order to increase the metabolic flow through the pathways leading to the production of odd-chain fatty acids, we investigated strategies for overproducing intermediates of various pathways. The route from starting substances such as sugars to propionyl-CoA, through odd-chain acyl-ACP (oc-acyl-ACP) intermediates, and towards oc-FA derivative products is a pathway aimed at industrially useful microorganisms. Can be operated.

In one aspect, the invention is involved in and / or oc. -Contains recombinant microbial cells containing one or more polynucleotides encoding polypeptides having enzymatic activity involved in the biosynthesis of acyl-ACP intermediates (eg, enzymes). In some embodiments, the recombinant microbial cell further comprises one or more polynucleotides encoding a polypeptide having fatty acid derivative enzyme activity, respectively, and the recombinant microbial cell is poly in the presence of a carbon source. When cultured under conditions sufficient to express the nucleotides, it produces odd-chain fatty acid derivatives. The present invention also comprises a method of making a composition comprising an odd chain length fatty acid derivative comprising culturing the recombinant microbial cells of the present invention. The invention also includes methods of increasing the amount of propionyl-CoA produced by microbial cells, methods of increasing the amount or proportion of odd chain fatty acid derivatives produced by microbial cells, and other properties apparent by further study. ..

Recombinant microbial cells may be prokaryotic cells such as filamentous fungi, algae, yeast or bacteria (eg, E. coli or Bacillus species).

In general, odd chain fatty acid derivatives [odd chain fatty acids, odd chain fatty esters (including odd chain fatty acid methyl ester (oc-FAME), odd chain fatty acid ethyl ester (oc-FAEE) and odd chain wax esters), odd chain Even-chain hydrocarbons such as even-chain alkanes, even-chain alkens, even-chain terminal olefins, even-chain internal olefins and even-chain ketones due to decarbonylation or decarboxylation of fatty aldehydes, odd-chain fatty alcohols and odd-chain precursors] Can be produced in the recombinant microbial cells of the present invention via the odd-chain fatty acid biosynthesis pathway (“oc-FA pathway”) shown in FIG. 1B.

To produce odd-chain fatty acid derivatives, recombinant microbial cells utilize propionyl-CoA as a "primer" to initiate the adipose acyl chain extension process. As shown in FIG. 1B, the adipose acyl extension process first begins with the first odd chain β-ketoacyl-ACP intermediate (eg, 3-oxovaleryl-ACP) as shown in step (D) of FIG. 1B. Requires condensation of malonyl-ACP molecule with odd chain length primer molecule propionyl-CoA catalyzed by an enzyme with β-ketoacyl ACP synthase activity (eg, β-ketoacyl ACP synthase III enzyme). do. The odd-chain β-ketoacyl-ACP intermediate undergoes keto-reduction, dehydration and enoyl-reduction on β-carbon by a fatty acid synthase (FAS) complex to form the first odd-chain acyl-ACP intermediate. As shown in step 1B (E), condensation with malonyl-ACP, keto reduction, dehydration to form an acyl-ACP intermediate with an increased odd carbon chain length (“oc-acyl-ACP”). And undergoes an additional cycle of enoyl reduction, adding two carbon units per cycle. The oc-acyl-ACP intermediate reacts with one or more fatty acid derivative enzymes to produce an odd chain fatty acid derivative (oc-FA derivative) product, as shown in step (F) of FIG. 1B. This is in contrast to the process in cells that produce relatively low levels of propionyl-CoA, such as wild-type E. coli cells. Such cells predominantly produce linear fatty acids with an even number of carbon atoms, with low or trace amounts of linear fatty acids with an odd number of carbon atoms. As shown in FIG. 1A, the even chain length primer molecule acetyl-CoA first, as shown in step (D) of FIG. 1A, is an even chain β-ketoacyl-ACP intermediate (eg, acetoacetyl-ACP). Condenses with a malonyl-ACP molecule to form an acyl-ACP intermediate with an increased even carbon chain length (“ec-acyl-ACP”), this time as shown in step (E) of FIG. 1A. Similarly, it undergoes a FAS-catalyzed cycle of keto reduction, dehydration, eonyl reduction and condensation with additional malonyl-ACP molecules, as well as adding two carbon units per cycle. The ec-acyl-ACP intermediate reacts with one or more fatty acid derivative enzymes to yield even chain fatty acid derivatives, as shown in step (F) of FIG. 1A.

The propionyl-CoA "primer" molecule can be supplied to the oc-FA biosynthetic pathway of the recombinant microbial cells of the invention by several methods. Methods of increasing the production of propionyl-CoA in microbial cells include, but are not limited to:

Propionyl-CoA can be produced by the natural biosynthetic mechanism of the parent microbial cell (eg, by an enzyme endogenous to the parent microbial cell). If an increase in the amount of propionyl-CoA produced in the parent microbial cell is desired, then one or more enzymes endogenous to the parent microbial cell that contributes to the production of propionyl-CoA are in excess in the recombinant microbial cell. Can be expressed.

Propionyl-CoA overexpresses endogenous enzymes that divert the metabolic flow through intermediate α-ketobutyrate and / or manipulates cells to express exogenous enzymes, as shown in FIG. Can be generated by. Examples of non-limiting enzymes for use in manipulating such pathways are given in Tables 1 and 2 below.

Propionyl-CoA overexpresses endogenous enzymes that divert the metabolic flow from succinyl-CoA through the intermediate methylmalonyl-CoA and / or expresses exogenous enzymes, as shown in FIG. It can be produced by manipulating cells. Table 3 below lists examples of non-limiting enzymes for use in manipulating such pathways.

In an example approach, propionyl-CoA overexpresses an endogenous enzyme that diverts the metabolic flow from malonyl-CoA through the intermediate malonic acid semialdehyde and 3-hydroxypropionic acid, and / or expresses an exogenous enzyme. It can be produced by manipulating the cells to cause them to. Examples of non-limiting enzymes for use in manipulating such pathways are given, for example, in US Patent Application Publication No. US201110201068A1.

In another approach, propionyl-CoA overexpresses endogenous enzymes that divert the metabolic flow from D-lactate through the intermediates lactoyl-CoA and acryloyl-CoA, and / or expresses exogenous enzymes. It can be produced by manipulating cells. Examples of non-limiting enzymes for use in manipulating such pathways are given, for example, in US Patent Application Publication No. US201110201068A1.

As mentioned above, initiation of the odd chain extension process requires condensation of propionyl-CoA with the malonyl-ACP molecule to form the oc-β-ketoacyl-ACP intermediate. In this step, as shown in part (D) of FIG. 1B, β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, preferably β-ketoacyl-ACP synthase III, is performed in recombinant microbial cells. It is catalyzed by an active enzyme (eg, EC23.1.180). The enzyme may be endogenous to the recombinant microbial cell or exogenous to the recombinant microbial cell.

In one embodiment, a polynucleotide encoding a polypeptide that is endogenous to a parent microbial cell with β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate is expressed or in excess in recombinant microbial cells. Express. In another embodiment, a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, which is exogenous to the parent microbial cell, is expressed in recombinant microbial cells. do.

The oc-β-ketoacyl-ACP intermediate produced in step (D) of the oc-FA pathway (FIG. 1B) is a beta catalyzed by a fatty acid synthase (FAS) complex, such as, for example, a type II FAS complex. It can undergo elongation by a continuous cycle of keto reduction on carbon, dehydration and enoyl reduction, further condensation with malonyl-ACP molecules, thereby the oc-acyl-ACP intermediate represented by step (E) of FIG. 1B. Two carbon units are added to the long odd carbon chain of the body. In one embodiment, the endogenous FAS complex that is natural for recombinant microbial cells catalyzes the cycle of condensation / keto reduction / dehydration / enoyl reduction with malonyl-ACP to produce an oc-acyl-ACP intermediate. ..

Odd-chain fatty acid derivatives (oc-fatty acids, oc-fat esters, oc-fatty aldehydes, oc-fatty alcohols, ec-ketones and ec-hydrocarbons) are in the middle of oc-acyl-ACP, as described in detail below. Can be produced from the body. Thus, in some embodiments, the recombinant microbial cell further comprises one or more polynucleotide sequences encoding peptides each having fatty acid derivative enzyme activity, such as thioesterase (eg, TesA), decarboxylase, carboxylic acid. Acid reductase (CAR, eg, CarA, CarB or FadD9), alcohol dehydrogenase / aldehyde reductase, aldehyde decarbonylase (ADC), fatty alcohol forming acyl-CoA reductase (FAR), acyl ACP reductase (AAR), ester synthesis When recombinant microbial cells containing the enzyme, acyl-CoA reductase (ACR1), OleA, OleCD or OleBCD are cultured under conditions effective for expressing polynucleotides in the presence of a carbon source, the microbial cells are oc. -Fatty acid, oc-fatty acid ester (oc-fatty acid methyl ester, oc-fatty acid ethyl ester, oc-wax ester, etc.) oc-fatty acid aldehyde, oc-fatty acid alcohol, ec-ketone or ec-hydrogen (ec-alkane, ec) -Produces compositions comprising (alkene, ec-terminal olefins or ec-internal olefins, etc.). The present invention also includes a method for producing an oc-fatty acid derivative, which comprises culturing the recombinant microbial cells of the present invention.

Manipulation of Microbial Cells to Produce Increased Amounts of Propionyl-CoA In one aspect, the invention includes methods of increasing the amount of odd chain fatty acid derivatives produced by microbial cells, including increased amounts of propionyl. -Contains manipulating parental microbial cells to generate CoA. Manipulation of the parent microbial cell to produce an increased amount of propionyl-CoA includes, for example, (a) a polypeptide having aspart kinase activity, homoserine dehydrogenase, homoserine kinase activity, threonine synthase activity and threonine deaminase activity. , (B) (R) -Citramalic acid synthase activity, isopropylapple acid isomerase activity and beta-isopropylapple acid dehydrogenase activity, or (c) methylmalonyl-CoA mutase activity and methyl. Achieved by manipulating cells to express one or more polypeptides having malonyl-CoA decarboxylase activity and methylmalonylcarboxyltransferase activity as well as polynucleotides encoding polypeptides having methylmalonyl epimerase activity as appropriate. And at least one polypeptide is exogenous to recombinant microbial cells, or the expression of at least one polynucleotide is modulated in recombinant microbial cells as compared to the expression of the polynucleotide in the parent microbial cell. Rated, recombinant microbial cells of propionyl-CoA produced by the parent microbial cells cultured under the same conditions when cultured under conditions effective for expressing the polynucleotide in the presence of a carbon source. Produces a larger amount of propionyl-CoA relative to the amount.

In some embodiments, the at least one polypeptide encoded by the polynucleotide according to (a) is an exogenous polypeptide (eg, a polypeptide originating from an organism other than the parent microbial cell or natural to the parent microbial cell. Variants of polypeptides). In some cases, at least one polypeptide encoded by the polynucleotide according to (a) is an endogenous polypeptide (ie, a polypeptide that is natural for the parent microbial cell) and the endogenous polypeptide is in recombinant microbial cells. Overexpressed.

In some embodiments, the at least one polypeptide encoded by the polynucleotide according to (b) is an exogenous polypeptide. Optionally, the at least one polypeptide encoded by the polynucleotide according to (b) is an endogenous polypeptide, which is overexpressed in recombinant microbial cells.

In some embodiments, the recombinant microbial cell comprises one or more polynucleotides according to (a) and one or more polynucleotides according to (b). In some cases, at least one polypeptide encoded by the polynucleotide according to (a) or (b) is an exogenous polypeptide. Optionally, at least one polypeptide encoded by the polynucleotide according to (a) or (b) is an endogenous polypeptide, which is overexpressed in recombinant microbial cells.

In some embodiments, the at least one polypeptide encoded by the polynucleotide according to (c) is an exogenous polypeptide. Optionally, the at least one polypeptide encoded by the polynucleotide according to (c) is an endogenous polypeptide, which is overexpressed in recombinant microbial cells.

Manipulated microbial cells are the parent microbial cells by manipulating the parent microbial cells to obtain recombinant microbial cells with increased metabolic flow through propionyl-CoA compared to the parent (eg, non-manipulated) microbial cells. Produces a larger amount (titer) of oc-FA derivative compared to the amount of oc-FA derivative produced by, and / or the proportion of oc-FA derivative in the fatty acid derivative composition produced by the parent microbial cell. To produce a fatty acid derivative composition having a higher proportion of oc-FA derivatives as compared to.

Accordingly, in another aspect, the invention is a method of increasing the amount or proportion of odd-chain fatty acid derivatives produced by microbial cells of propionyl-CoA produced by parent microbial cells cultured under the same conditions. Combining parental microbial cells to produce recombinant microbial cells capable of producing larger amounts of propionyl-CoA or higher amounts relative to the amount of recombinant microbial cells and parental microbial cells. When each is cultured in the presence of a carbon source under the same conditions that are effective for increasing the level of propionyl-CoA in the recombinant microbial cells compared to the parent microbial cells, the culture of the recombinant microbial cells is the parent microorganism. Includes methods for producing higher or higher proportions of odd chain fatty acid derivatives relative to the amount or proportion of odd chain fatty acid derivatives produced by the cells. In some embodiments, the recombinant microbial cell comprises a polynucleotide encoding a polypeptide by one or more of the pathways (a), (b) and (c) as described in more detail below, at least. One encoded polypeptide is exogenous to recombinant microbial cells, or expression of at least one polynucleotide is modulated in recombinant microbial cells as compared to expression of polynucleotides in parental microbial cells. ing. In some embodiments, the recombinant microbial cell comprises at least one polypeptide encoding a polypeptide having fatty acid derivative enzyme activity. In some embodiments, recombinant microbial cells comprise a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate.

Examples of metabolic pathways useful for increasing propionyl-CoA production in recombinant microbial cells are described below. Examples of these pathways for increasing propionyl-CoA production in recombinant cells do not limit the scope of the invention, but increase propionyl-CoA production in cells and / or the propionyl-CoA intermediate. It should be appreciated that any suitable metabolic pathway that increases metabolic flow in passing cells is suitable for use in the recombinant microbial cells, compositions and methods of the invention. Metabolic pathways that increase propionyl-CoA production and / or metabolic flow through the propionyl-CoA intermediate are therefore suitable for use in the recombinant microbial cells, compositions and methods of the invention.

Production of Propionyl-CoA via α-Ketobutyric Acid Intermediate Manipulation of various amino acid biosynthetic pathways has been shown to increase the production of these various amino acids in microbial cells (Guillou et S., et al. , Appl. Environ. Microbiol. 65: 3100-3107 (1999); Lee HK, et al., Mol. Syst. Biol.
3: 149 (2007)). The amino acid biosynthesis pathway is E. It has been used in the production of short-chain branched alcohols in coli (Atsumi S. and Liao J.C., Appl. Environ. Microbiol. 74 (24): 7802-7808 (2008); Cann AF and Liao. J.C., Apple Microbiol Biotechnol. 81 (1): 89-98 (2008); Zhang K., et al., Proc. Natl. Acad. Sci. USA. 105 (52): 20653-20658 (2008). ).

The path of flow of certain amino acid biosynthetic metabolites is also known as the intermediate α-ketobutyric acid (alpha-ketobutyric acid, 2-ketobutyric acid, 2-ketobutanoate, 2-oxobutyric acid and 2-oxobutanoate). By directing to the production of propionyl-CoA, an increase in propionyl-CoA production is caused. Thus, in one embodiment, the invention is derived from a carbon source (eg, carbohydrates such as sugar) when the recombinant microbial cells are cultured in the presence of a carbon source under conditions sufficient to express the polynucleotide. Includes recombinant microbial cells containing polynucleotides encoding one or more enzymes involved in the conversion to α-ketobutyric acid (ie, "oc-FA pathway enzymes"). The α-ketobutyric acid molecule is an intermediate in the microbial production of propionyl-CoA that serves as a primer in the production of linear odd-chain fatty acid derivatives by the oc-FA pathway (FIG. 1B).

The pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of α-ketobutyric acid to produce propionyl-CoA in bacteria (Danchin, A. et al.
et al. , Mol. Gen. Genet. 193: 473-478 (1984); Biswanger, H. et al. , J. Biol. Chem. 256: 815-822 (1981)). The pyruvate dehydrogenase complex is a multienzyme complex containing three activities: pyruvate decarboxylase (E1), dihydrolipoyl transacetylase (E2) and dihydrolipoyl dehydrogenase (E3). .. There are other suitable keto acid dehydrogenase complexes that use similar catalytic modalities that utilize α-keto acid substrates other than pyruvate. The TCA cycle α-ketoglutaric acid dehydrogenase complex is an example. In one embodiment, the pyruvate dehydrogenase complex endogenous to the host cell (ie, the pyruvate dehydrogenase complex natural to the parent cell) catalyzes the conversion of α-ketobutyric acid to propionyl-CoA. Used for. In other embodiments, genes encoding one or more PDC complex polypeptides having pyruvate decarboxylase, dihydrolipoyl transacetylase and / or dihydrolipoyl dehydrogenase activity are present in recombinant microbial cells. Overexpressed. Other enzymes or enzyme complexes that catalyze the conversion of α-ketobutyric acid to propionyl-CoA are expressed or overexpressed in recombinant microbial cells to further increase the metabolic flow from α-ketobutyric acid to propionyl-CoA. can do.

Conversion of α-ketobutyric acid to propionyl-CoA can also be achieved by conversion of α-ketobutyric acid to propionic acid and activation of propionic acid to propionyl-CoA. The conversion of α-ketobutyric acid to propionic acid is encoded by the poxB gene. It can be catalyzed by pyruvate oxidase (EC. 1.2.3.3) such as colipyruvate oxidase (Grabau and Cronan, Nucleic Acids Res. 14 (13): 5449-5460 (1986)). Natural E. The coli PoxB enzyme reacts with α-ketobutyric acid and pyruvate and is selective for pyruvate, whereas Chang and Cronan (Biochem J. 352: 717-724 (2000)) is relative to α-ketobutyric acid. A PoxB mutant enzyme that retains full activity and has reduced activity against pyruvate has been described. Activation of propionic acid to propionyl-CoA can be catalyzed by acyl-CoA synthases such as acetyl-CoA synthase (Doi et al., J. Chem).
Soc. 23: 1696 (1986)). Yeast acetyl-CoA synthase has been shown to catalyze the activation of propionic acid to propionyl-CoA (Patel).
and Walt, J.M. Biol. Chem. 262: 7132 (1987)). Propionic acid can also be activated to propionyl-CoA by the action of acetate kinase (ackA) and phosphotransacetylase (pta).

One or more enzymes endogenous to the parent microbial cell may compete with the enzyme of the oc-FA biosynthetic pathway engineered in the recombinant microbial cell for the substrate or an intermediate (eg, α). -Ketobutyric acid) may be degraded or otherwise diverted from the oc-FA biosynthetic pathway, and the gene encoding such an unwanted endogenous enzyme is an odd chain fatty acid derivative from recombinant microbial cells. Can be attenuated to increase the production of. For example, E. In coli, endogenous acetohydroxy acid synthases such as AHAS I (eg, encoded by the ilvBN gene), AHAS II (eg, encoded by the ilvGM gene) and AHAS III (eg, encoded by the ilvIH gene). The (AHAS) complex can catalyze the conversion of α-ketobutyric acid to α-acet-α-hydroxybutyric acid, thus altering the course of metabolic flow from propionyl-CoA and reducing oc-FA production. be. Therefore, by abstaining or otherwise reducing the expression of one or more endogenous AHAS genes, biosynthesis in recombinant microbial cells is more directed towards propionyl-CoA and ultimately more odd chain fatty acids. It can be directed to generation. Other endogenous enzymes that may compete with oc-FA biosynthetic pathway enzymes include acetohydroxyate isomero, which catalyzes the conversion of α-acet-α-hydroxybutyric acid to 2,3-dihydroxy-3-methylvaleric acid. Enzymes with reductase activity (eg, encoded by the ilvC gene) and dihydroxyic acid dehydratase activity that catalyzes the conversion of 2,3-dihydroxy-3-methylvaleric acid to 2-keto-3-methylvaleric acid. Enzymes provided (eg, encoded by the ilvD gene) are included to further biosynthesize in recombinant microbial cells by abstaining or otherwise reducing the expression of one or more of these genes. It can be directed towards propionyl-CoA and ultimately towards the production of more odd chain fatty acids.

Either or both of the following pathway examples are engineered in recombinant microbial cells to increase metabolic flow through common α-ketobutyric acid intermediates and cause increased intracellular propionyl-CoA production. can do. Examples of these routes are shown in FIG. 2 and are described in more detail below.

Pathway A (threonine intermediate)
The first pathway leading to the common α-ketobutyric acid intermediate represented by pathway (A) in FIG. 2 is the production of intermediate threonine by threonine biosynthetic enzyme, followed by an enzyme with threonine dehydratase activity. Deamination of threonine to α-ketobutyric acid catalyzed by is involved.

In pathway (A), the increased metabolic flow to threonine is also referred to as aspartate kinase activity (eg, EC2.7.2.4; aspartkinase activity) that catalyzes the conversion of aspartic acid to aspartylphosphate. , Catalyzing the conversion of aspartyl phosphate to aspartic acid semialdehyde, aspartic acid-semialdehyde dehydrogenase activity (eg, EC1.2.1.11), catalyzing the conversion of aspartic acid semialdehyde to homoserine. Homoserine dehydrogenase activity (eg, EC1.1.1.3), homoserine kinase activity that catalyzes the conversion of homoserine to O-phospho-L-homoserin (eg, EC2.7.1.39) and O- Expressing a polynucleotide encoding an enzyme involved in threonine biosynthesis, including an enzyme having threonine synthase activity (eg, EC 4.2.3.1) that catalyzes the conversion of phospho-L-homoserine to threonine. Can be achieved by. Not all of the activities listed above need to be engineered in recombinant microbial cells to increase metabolic flow through the threonine intermediate, and in some cases activities already present in the parent microbial cell (eg, parent microbial cell). (Polypeptides with activity produced by natural genes in) will be sufficient to catalyze the steps listed above. In one embodiment, the recombinant microbial cell is a polypeptide having aspartic acid kinase activity, a polynucleotide encoding a polypeptide that catalyzes the conversion of aspartic acid to aspartylphosphate, aspartate semialdehyde dehydrogenation. A polypeptide having enzymatic activity, a polynucleotide encoding a polypeptide that catalyzes the conversion of aspartyl phosphate to aspartate semialdehyde, a polypeptide having homoserine dehydrogenase activity, asparagate semialdehyde. Threonine, a polypeptide that encodes a polypeptide that catalyzes the conversion of homoserine to homoserine, a polypeptide that has homoserine kinase activity and that encodes a polypeptide that catalyzes the conversion of homoserine to O-phospho-L-homoserin. Recombinant expression of one or more polynucleotides selected from polynucleotides encoding polypeptides that have synthase activity and catalyze the conversion of O-phospho-L-homoserine to threonine. Manipulated for this, recombinant microbial cells have increased metabolic flow through the pathway intermediate threonine compared to parent microbial cells. In some cases, the polypeptide encoded by the recombinantly expressed polynucleotide is present in the recombinant microbial cell at a higher concentration than in the parent microbial cell when cultured under the same conditions, ie. , This polypeptide is "overexpressed" in recombinant cells. For example, recombinantly expressed polynucleotides can be operably linked to promoters that express polynucleotides in recombinant microbial cells at higher concentrations than normally expressed in parental microbial cells when cultured under the same conditions. .. In one embodiment, E. coli encoding bifunctional ThrA with aspartic kinase and homoserine dehydrogenase activity. The colithrA gene is used. In another embodiment, a mutant E. coli encoding a mutant enzyme having aspartic kinase and homoserine dehydrogenase activity with reduced feedback inhibition to the parent ThrA enzyme. The colithrA gene is used (referred to as ThrA ^* ; Ogawa-Miyata, Y., et al., Biosci. Biotechnol. Biochem. 65: 1149-1154 (2001); Lee J.-H., et al. Bacteriol. 185: 5442-5451 (2003)).

Threonine is produced by an enzyme having threonine deaminase activity (eg, EC43.1.19; also known as threonine ammoniatriase activity, previously classified as EC4.2.1.16, threonine dehydratase). It can be deaminated to α-ketobutyric acid. In one embodiment, the threonine deaminase activity already present (ie, endogenous) in the parent microbial cell is sufficient to catalyze the conversion of threonine to α-ketobutyric acid. In another embodiment, recombinant microbial cells are engineered to recombinantly express a polypeptide having threonine deaminase activity that catalyzes the conversion of threonine to α-ketobutyric acid. In some embodiments, the polypeptide having threonine deaminase activity is overexpressed in recombinant microbial cells.

Table 1 lists enzymes for use in the manipulation of pathway (A) and non-limiting examples of polynucleotides encoding such enzymes.

For example, for the polypeptides classified by the above EC numbers, any of the relevant databases available on the Worldwide Web [KEGG Database (University of Tokyo), PROTEIN or GENE Database (Entrez Database; NCBI), UNIPROTKB or ENZYME. Polypeptides can be further identified by searching the database (ExPASy; Swiss Institute for Bioinformatics) and the BRENDA database (The Comprehensive Enzyme Information System; Technical Universality of Branschweig). For example, the Aspartkinase polypeptide can be further identified by searching for polypeptides classified as EC 2.7.2.4, and the homoserine dehydrogenase polypeptide is further EC 1.1.1.13. The homoserine kinase polypeptide can be further identified by searching for the polypeptide classified in EC 2.71.39, and the homoserine kinase polypeptide can be identified by searching for the polypeptide classified in EC 2.71.39. Enzymatic polypeptides can be further identified by searching for polypeptides classified as EC 4.2.3.1, and threonine deaminase polypeptides are further classified as EC 4.3.1.19 polypeptides. Can be identified by searching for.

In some embodiments, the polynucleotide encoding the parent fatty acid pathway polypeptide (eg, the polypeptide described in Table 1 or identified by EC number or by homology to an example of the polypeptide) is the enzyme described above. Produces variant polypeptides with improved activity (eg, aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity, threonine deaminase activity) and improved properties compared to the properties of the parent polypeptide. Modified using methods well known in the art, this property can be, for example, increased catalytic activity or improved stability under conditions for culturing recombinant microbial cells, with cell metabolites, or in culture media. It is more adapted to manipulating microbial cells and / or pathways such as reduced inhibition by components (eg, reduced feedback inhibition).

Route B (Citramalic Acid Intermediate)
As shown in the pathway (B) of FIG. 2, the second pathway leading to a general α-ketobutyric acid intermediate is an enzyme-mediated intermediate citramaric acid (2-) having citramalic acid synthase activity. It involves the production of (also known as methylapple acid) and the conversion of citramalic acid to α-ketobutyric acid by the action of isopropylapple acid isomerase and enzymes with alcohol dehydrogenase activity.

The citramalate synthase activity (eg, EC2.3.1.182) that catalyzes the reaction of acetyl-CoA with pyruvate to form (R) -citramalate is described in M. coli. Yannaski (SEQ ID NO: 40) or L. It can be supplied by expression of the simA gene of a bacterium such as Methanococci jannaschi or Leptospira interrogans, which encodes a Cima polypeptide such as CimA of interrogans (SEQ ID NO: 42). DM et al., J. Bacterial. 181 (1): 331-3 (1999); Xu, H., et al., J. Bacterial. 186: 5400-5409 (2004)). Alternatively, for example, Atsumi S. et al. and Liao J. C. (Appl. Environ. Microbial. 74 (24): 7802-7808 (2008)), such as the CimaA variant, preferably the CimA3.7 variant encoded by the simA3.7 gene (SEQ ID NO: 41). Modified simA nucleic acid sequences encoding Cima variants with improved catalytic activity or stability in recombinant microbial cells and / or reduced feedback inhibition can be used. Alternatively, the Leptospira interrogans Cima variant (SEQ ID NO: 43) can be used. Isopropylmalic acid isomerase activity (EC 4.21.33, also referred to as isopropylmalic acid dehydratase) that catalyzes the conversion of (R) -citraconic acid to citraconic acid and then to beta-methyl-D-propyl acid. Is, for example, E. Kori or B. It can be brought about by the expression of a heterodimer protein encoded by the subtilis leuCD gene. Alcohol dehydrogenase activity (EC1.1.1.85, beta-isopropylmalate dehydrogenase) that catalyzes the conversion of beta-methyl-D-malate to 2-ketobutyric acid (ie α-ketobutyric acid) is , For example, E.I. Kori or B. It can be brought about by expression of the subtilis leuB gene or the yeast leu2 gene. Table 2 lists non-limiting examples of fatty acid pathway enzymes and polynucleotides encoding such enzymes for use in the manipulation of the oc-FA pathway pathway (B).

For example, for the polypeptides classified by the above EC numbers, any of the relevant databases available on the Worldwide Web [KEGG Database (University of Tokyo), PROTEIN or GENE Database (Entrez Database; NCBI), UNIPROTKB or ENZYME. Polypeptides can be further identified by searching the database (ExPASy; Swiss Institute for Bioinformatics) and the BRENDA database (The Comprehensive Enzyme Information System; Technical Universality of Branschweig). For example, the (R) -citramalic acid synthase polypeptide can be further identified by searching for polypeptides classified as EC2.3.1.182, and the isopropylapple acid isomerase polypeptide is further described in EC4. It can be identified by searching for polypeptides classified as 2.1.33, and beta-isopropylaroic acid dehydrogenase polypeptides are further searched for polypeptides classified as EC1.1.1.85. Can be identified by

In some embodiments, the polynucleotide encoding the parent fatty acid pathway polypeptide (eg, the polypeptide described in Table 2 or identified by EC number or by homology to an example of the polypeptide) is the enzyme described above. Variant polypeptide with improved activity (eg, (R) -citramalate synthase activity, isopropylapple acid isomerase activity, beta-isopropylapple acid dehydrogenase activity) and improved properties compared to the properties of the parent polypeptide. Modified using a method well known in the art to produce, this property is compared to that of the parent polypeptide, eg, increased or stable catalytic activity under conditions in which recombinant microbial cells are cultured. It is more adapted to manipulating microbial cells and / or pathways such as improved sex, reduced inhibition by cell metabolites or by culture medium components (eg, reduced feedback inhibition).

Propionyl-CoA production pathway C via methylmalonyl-CoA (methylmalonyl-CoA intermediate)
The following pathway examples can be engineered in recombinant microbial cells to increase metabolic flow through the methylmalonyl-CoA intermediate and cause increased intracellular propionyl-CoA production. An example of this route is shown in FIG. 3 and will be described in more detail below.

Directing the metabolic flow to methylmalonyl-CoA can cause increased propionyl-CoA production. Thus, in one embodiment, the invention is derived from a carbon source (eg, carbohydrates such as sugar) when the recombinant microbial cells are cultured in the presence of a carbon source under conditions sufficient to express the polynucleotide. Includes recombinant microbial cells containing polynucleotides encoding those involved in the conversion to succinyl-CoA and methylmalonyl-CoA. Succinyl-CoA and methylmalonyl-CoA are intermediates in microbial production of propionyl-CoA that serve as primers in the production of linear odd-chain fatty acid derivatives by the oc-FA pathway (FIG. 1B).

The pathway leading to propionyl-CoA as shown in FIG. 3 (also referred to herein as “pathway (C)”) is from succinyl-CoA to methylmalonyl-CoA via an enzyme having methylmalonyl-CoA mutase activity. Conversion to and / or the conversion of methylmalonyl-CoA to propionyl-CoA by the action of an enzyme with methylmalonyl-CoA decarboxylase activity and / or the action of an enzyme with methylmalonyl-CoA carboxyltransferase activity is involved. In some cases, depending on the polyisomer of methylmalonyl-CoA utilized by the particular methylmalonyl-CoA decarboxylase or methylmalonyl-CoA carboxyltransferase used, the enzyme having methylmalonyl-CoA epimerase activity is (R). )-And (S) -methylmalonyl-CoA may be utilized for mutual conversion.

Succinyl-CoA can be provided to this pathway by the cellular TCA cycle. In some cases, the flow from fumaric acid to succinic acid can be increased, for example, by overexpression of endogenous frd (fumaric acid reductase) or other genes involved in the production of succinic acid or succinyl-CoA. .. The conversion of succinyl-CoA to methylmalonyl-CoA can be catalyzed by an enzyme with methylmalonyl-CoA mutase activity (eg, EC5.4999.2). Such activity can be supplied to recombinant microbial cells by expression of the exogenous scpA (also known as sbm) gene or by overexpression of the endogenous scpA gene. An example of the sbm gene is E. coli encoding an Sbm polypeptide (accession number NP_417392, SEQ ID NO: 51) having methylmalonyl-CoA mutase activity. Contains the gene for coli (Haller, T. et al., Biochemistry 39: 4622-4629 (2000)). Alternatively, for example, a Propionibacterium freudenreich subspecies comprising an α-subunit or "large subunit" (MutB, accession number YP_003687736) and a beta-subunit or "small subunit" (MutA, accession number CAA33089). Methylmalonyl-CoA mutase from Propionibacterium fluendenreichii subunits. shermani can be used. Non-limiting examples of polypeptides that catalyze the conversion of succinyl-CoA to methylmalonyl-CoA are listed in Table 3 below.

In one embodiment, the conversion of methylmalonyl-CoA to propionyl-CoA catalyzes the decarboxylation of methylmalonyl-CoA to propionyl-CoA with methylmalonyl-CoA decarboxylase activity (eg, EC4.1.1. It can be catalyzed by a polypeptide having 41). Such activity can be supplied to recombinant microbial cells by expression of the exogenous scpB (also known as ygfG) gene or by overexpression of the endogenous scpB gene. Examples of methylmalonyl-CoA decarboxylase polypeptides include, for example, E. coli. Methylmalonyl-CoA decarboxylase polypeptide encoded by the coli scpB gene (Haller et al., Supra) or methylmalonyl-CoA decoded by Salmonella enterocica or Yersinia enterocolitica. Includes carboxylase polypeptides. In another embodiment, the conversion of methylmalonyl-CoA to propionyl-CoA is, for example, P.I. It can be catalyzed by a polypeptide having methylmalonyl-CoA carboxyltransferase activity (eg, EC2.1.3.1), such as the methylmalonyl-CoA carboxyltransferase of Freudenreich subspecies Sharmani (mmdA, NBCI Accession No. Q8GBW6.3). .. Depending on the stereoisomer of methylmalonyl-CoA utilized by methylmalonyl-CoA decarboxylase or by methylmalonyl-CoA carboxyltransferase, for example, Bacillus subtilis (yqjC; Haller et al., Biochemistry 39: 4622-4629). (2000)) or a polypeptide having methylmalonyl-CoA epimerase activity (eg, EC5.199.1), such as the methylmalonyl-CoA epimerase of the propionibacterium Freudenreich subspecies Shamani (NCBI accession number YP_003688018). A conversion between (R) -methylmalonyl-CoA and (S) -methylmalonyl-CoA that can be catalyzed by is desired.

Whether one or more enzymes endogenous to the parent microbial cell may compete with the enzyme of the engineered oc-FA biosynthetic pathway in the recombinant microbial cell for substrate or degrade intermediates Otherwise, it may divert its path from the oc-FA biosynthetic pathway, and genes encoding such unwanted endogenous enzymes are attenuated to increase the production of odd-chain fatty acid derivatives by recombinant microbial cells. Can be made to. For example, E. In Kori, E. An endogenous propionyl-CoA: succinyl-CoA transferase (NCBI Accession No. NP_417395) encoded by the coli scpC (also known as ygfH) gene catalyzes the conversion of propionyl-CoA to succinyl-CoA. It can divert the course of metabolic flow from propionyl-CoA and reduce oc-FA production. Therefore, lacking or otherwise reducing the expression of the scpC (ygfH) gene directs biosynthesis in recombinant microbial cells to more propionyl-CoA and ultimately to the production of odd-chain fatty acids. Can be done.

Fatty acid pathway enzymes for use in the manipulation of the oc-FA pathway pathway (C) and such enzymes that catalyze the conversion of succinyl-CoA to methylmalonyl-CoA and the conversion of methylmalonyl-CoA to propionyl-CoA. Table 3 lists non-limiting examples of polynucleotides encoding.

For example, for the polypeptides classified by the above EC numbers, any of the relevant databases available on the Worldwide Web [KEGG Database (University of Tokyo), PROTEIN or GENE Database (Entrez Database; NCBI), UNIPROTKB or ENZYME. Polypeptides can be further identified by searching the database (ExPASy; Swiss Institute for Bioinformatics) and the BRENDA database (The Comprehensive Enzyme Information System; Technical Universality of Branschweig). For example, the methylmalonyl-CoA mutase polypeptide can be further identified by searching for polypeptides classified as EC5.499.2, and the methylmalonyl-CoA decarboxylase polypeptide is further EC4.1. It can be identified by searching for polypeptides classified as .1.41, and methylmalonyl-CoA carboxyltransferase polypeptides can be further identified by searching for polypeptides classified as EC2.11.3.1. It can be identified, and the methylmalonyl-CoA epimerase polypeptide can be further identified by searching for the polypeptide classified in EC 5.19.99.1.

In some embodiments, the polynucleotide encoding the parent fatty acid pathway polypeptide (eg, the polypeptide described in Table 3 or identified by EC number or by homology to an example of the polypeptide) is the above enzyme. Has improved activity (eg, methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase activity, methylmalonyl-CoA epimerase activity, methylmalonyl-CoA carboxyltransferase activity) and improved properties compared to those of the parent polypeptide. Modified using methods well known in the art to produce mutant polypeptides, this property is described, for example, by increasing catalytic activity or improving stability under conditions in which recombinant microbial cells are cultured, cell metabolism. It is more adapted to the microbial cells and / or pathways to be manipulated, such as reduced inhibition by substances or by culture medium components (eg, reduced feedback inhibition).

Manipulation of Microbial Cells to Generate Increased Amounts of oc-FA Derivatives Propionyl-CoA to oc-β-ketoacyl-ACP
As mentioned above, propionyl-CoA serves as a primer for subsequent FAS catalyst extension steps in the production of oc-FA derivatives. Initiation of this process requires condensation of propionyl-CoA with the malonyl-ACP molecule to form the oc-β-ketoacyl-ACP intermediate 3-oxovaleryl-ACP (FIG. 1B). As shown in step (D) of FIG. 1B, this starting step is an enzyme having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate in recombinant microbial cells [for example, type III β. -Ketoacyl-ACP synthase (eg, EC23.1.180)] catalyzed.

The substrate specificity of the β-ketoacyl-ACP synthase of a particular microorganism often reflects the fatty acid composition of that microorganism (Han, L., et al., J. Protein. 180: 4481-4486 (1998). ); Qui, X., et al., Protein Sci. 14: 2087-2094 (2005)). For example, E. The coli FabH enzyme utilizes propionyl-CoA and acetyl-CoA, but has a very high selectivity for acetyl-CoA, reflecting the high proportion of linear even-chain fatty acids produced (Choi). , K.H., et al., J. Bacteriology 182: 365-370 (2000); Qui, et al.,
Above), on the other hand, the Streptococcus pneumoniae enzyme produces a variety of linear and branched chain fatty acids, with short direct carbon lengths between two and four. Chain acyl-CoA primers and various branched chain acyl-CoA primers are used (Khandekar SS, et al., J. Biol. Chem. 276: 30024-30030 (2001)). A polynucleotide sequence encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate generally comprises β-ketoacyl-ACP synthase with a wide range of acyl-CoA substrate specificities. It can be obtained from the contained microbial cells. Sources of β-ketoacyl-ACP synthase with broad substrate specificity include, for example, Bacillus (eg, B. subtilis), Listeria (eg, L. et al.). Monocytogenes], Streptomyces [eg, S. monocytogenes]. Bacteria that produce various fatty acid structures, including branched-chain fatty acids such as S. coelicol and propionibacterium (eg, P. Freudenreich subspecies Shamani) can be included. Particularly preferred β-ketoacyl-ACP synthases include those that are more selective for propionyl-CoA vs. acetyl-CoA than those indicated by endogenous FabH. For example, E. When manipulating coli cells, preferred β-ketoacyl-ACP synthases are, but are not limited to, B.I. Subtilis FabH1 (Choi)
et al. 2000, supra), Streptomyces staphylococcus FabH (Han, L., et al., J. Bacteriol. 180: 4481-4486 (1998)), Streptococcus staphylococcus FabH (Khand. , Et al., J. Biol. Chem. 276: 30024-30030 (2001) and Staphylococcus aureus FabH (Qui, X. et al., Protein Sci. 14: 2087-2094). ) Can be included.

One or more endogenous enzymes may compete with the engine of the engineered oc-FA biosynthetic pathway in recombinant microbial cells for substrate, or degrade oc-FA pathway intermediates. Otherwise, it can divert the metabolic flow from oc-FA production, and genes encoding such unwanted endogenous enzymes are attenuated to increase the production of oc-FA derivatives by recombinant microbial cells. be able to. For example, E. The β-ketoacyl-ACP synthase encoded by the endogenous fabH of coli utilizes propionyl-CoA as a substrate, but is more selective for 2-carbon acetyl-CoA molecules than for 3-carbon propionyl-CoA molecules ( Choi et al. 2000, above). Therefore, E. Cells expressing the coli fabH gene selectively utilize acetyl-CoA as a primer for fatty acid synthesis to mainly produce even-chain fatty acid molecules in vivo. To express an exogenous gene encoding a β-ketoacyl-ACP synthase that is selective with propionyl-CoA rather than as indicated by endogenous FabH, with the expression of the endogenous fabH gene absent or otherwise reduced. (For example, when manipulating E. coli, the endogenous E. coli FabH has higher selectivity for propionyl-CoA than B. subtilis FabH1 or acetyl-CoA than that indicated by E. coli FabH. Substituting with an alternative exogenous FabH), the metabolic flow in recombinant microbial cells can be directed towards the production of more oc-β-ketoacyl-ACP intermediates and ultimately more oc-FA derivatives.

Table 4 lists non-limiting examples of fatty acid pathway enzymes and polynucleotides encoding such enzymes for use in the manipulation of step D of the oc-FA pathway.

The β-ketoacyl-ACP synthase polypeptide is, for example, a related database [KEGG Database (University of Tokyo), which is available on the worldwide web for all polypeptides classified into EC23.1.180. PROTEIN or GENE database (Enzyme database; NCBI), UNIPROTKB or ENZYME database (ExPASy; Swiss Bioinformatics Institute) and BRENDA database (The Complete Enzyme Information System) Can be done.

The β-ketoacyl-ACP synthase polypeptide also searches sequence pattern databases such as the Prosite database (Expasy Proteomics Server, Swiss Bioinformatics Laboratory) for polypeptides containing one or more of the sequence motifs listed below. This can be further identified. This is easily achieved, for example, by using the ScanProsite tool available on the World Wide Web of Expasy Proteomics Servers.

In one embodiment, the β-ketoacyl-ACP synthase polypeptide comprises one or more sequence motifs selected from:
DT- [N, S] D- [A, E] -WIx (2)-[M, R] -TGIx- [N, E] -R- [R, H] (SEQ ID NO: 14)
[S, A] -xDx (2) -A- [A, V] -C- [A, S] -GFx (3)-[M, L] -x (2) -A (SEQ ID NO: 15)
DRxT- [A, I]-[I, V] -xF- [A, G] -DGA- [A, G]-[G, A]-[A, V] (SEQ ID NO: 16)
HQANxRI- [M, L] (SEQ ID NO: 17)
GNT- [G, S] -AAS- [V, I] -Px (2)-[I, L] -x (6) -G (SEQ ID NO: 18)
[I, V] -xLx (2) -FGGG- [L, F]-[T, S] -WG (SEQ ID NO: 19)
Each amino acid residue in parentheses indicates an alternative amino acid residue at a particular position, each x indicates an arbitrary amino acid residue, and each n in "x (n)" is x in a contiguous series of amino acid residues. Shows the number of residues.

In some embodiments, the polynucleotide encoding the parent fatty acid pathway polypeptide (eg, the polypeptide described in Table 4 or identified by EC number or motif or homology to the example of the polypeptide) is β-. Ketoacyl-ACP synthase activity has been modified using methods well known in the art to produce variant polypeptides with improved properties compared to the properties of the parent polypeptide, which properties are eg, for example. , Increased catalytic activity and / or increased specificity for propionyl-CoA (eg, compared to acetyl-CoA), improved catalytic activity or stability under conditions in which recombinant microbial cells are cultured, cells. It is more adapted to the microbial and / or pathways to be manipulated, such as reduced inhibition by metabolites or by culture medium components (eg, reduced feedback inhibition).

The present invention is a recombinant microbial cell containing a polynucleotide encoding a polypeptide, wherein the polypeptide is SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13, 146, 147, 148 and 149 at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96. %, At least 97%, at least 98%, or at least 99% of recombinant microbial cells with β-ketoacyl-ACP synthase activity that comprises a polypeptide sequence that utilizes propionyl-CoA as a substrate. including. In some cases, the polypeptide sequence comprises one or more sequence motifs selected from SEQ ID NOs: 14-19. The invention also includes an isolated polypeptide comprising said polypeptide sequence and an isolated polynucleotide encoding the polypeptide. In one embodiment, the polypeptide comprises a substitution at position W310 or equivalent. In one embodiment, the polypeptide comprises a W310G substitution. In one embodiment, the polypeptide is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% with respect to SEQ ID NO: 7. , Includes sequences with at least 97%, at least 98% or at least 99% identity and comprises substitution W310G. In some embodiments, the polypeptide exhibits higher specificity for propionyl-CoA than for acetyl-CoA.

As used herein, "a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate" is a β-ketoacyl at a level detectable when the substrate propionyl-CoA is supplied. -Any polypeptide having ACP synthase activity is included.

The enzyme activity and specificity of β-ketoacyl-ACP synthase for substrates such as propionyl-CoA can be measured using known methods. For example, Choi et
al. (J. Bacteriology 182 (2): 365-370 (2000)) is a suitable filter disk assay for measuring β-ketoacyl-ACP synthase (“FabH”) activity against an acetyl-CoA substrate. ) Is described in detail, and this assay can be modified to assay propionyl-CoA as a substrate. The assay was performed with ACP 25 μM in a final volume of 40 μL, β-mercaptoethanol 1 mM, malonyl-CoA 65 μM, [ ^1-14 C] acetyl-CoA 45 μM (specific activity about 45.8 Ci / mol), E. coli. It contains coli FadD (0.2 μg) and 0.1 M sodium phosphate buffer (pH 7.0). To assay β-ketoacyl-ACP synthase activity, [ ^1-14 C] acetyl-CoA can be replaced with ¹⁴ C-labeled propionyl-CoA. The reaction is initiated by adding FabH and the mixture is incubated at 37 ° C. for 12 minutes. Next, a fixed amount of 35 mL is taken out and deposited on a Whatman 3MM filter disk. The ice-cold trichloroacetic acid is then replaced 3 times to wash the disc (20 mL / disc for 20 minutes each). Next, in each of the continuous washes, the concentration of trichloroacetic acid is reduced from 10% to 5% and further to 1%. Dry the filter and count in 3 mL of scintillation cocktail.

Alternatively, FabH activity can be measured using a radioactively labeled malonyl-CoA substrate and gel electrophoresis to separate and quantify the product (Choi et al. 2000, supra). The assay mixture was ACP 25 μM in a final volume of 40 μL, β-mercaptoethanol 1 mM, [ ^2-14 C] malonyl-CoA 70 μM (specific activity about 9 Ci / mol), CoA substrate (eg, acetyl-CoA or propionyl-CoA). It contains 45 μL, FadD (0.2 μg), NADPH 100 μM, FabG (0.2 μg) and 0.1 M sodium phosphate buffer (pH 7.0). The reaction can be initiated by adding FAbH. The mixture is incubated at 37 ° C. for 12 minutes, then placed in an ice slurry, then gel loading buffer is added and the mixture is a conformation sensitive 13% polyacrylamide gel containing 0.5 M to 2.0 M urea. Load. Electrophoresis can be performed at 32 mA / gel at 25 ° C. The gel is then dried and the band is quantified by exposing the gel to a PhosphoImager screen. Specific activity can be calculated from the gradient of the plot of product formation vs. FabH protein concentration during the assay.

oc-β-ketoacyl-ACP to oc-acyl-ACP
As shown in step (E) of FIG. 1B, the oc-β-ketoacyl-ACP intermediate 3-oxovaleryl-ACP produced in step (D) is a fatty acid synthase such as, for example, a type II fatty acid synthase complex. It can undergo elongation by a continuous cycle of condensation / keto reduction / dehydration / enoyl reduction with malonyl-ACP catalyzed by the (FAS) complex, resulting in a long fatty acid chain of oc-acyl-ACP. Two carbon units are added. In one embodiment, the FAS enzyme complex endogenous to microbial cells (eg, type II FAS complex, etc.) is fused / keto-reduced / dehydrated with malonyl-ACP to produce an oc-acyl-ACP intermediate. / Used to catalyze the cycle of enoyl reduction.

oc-Acyl-ACP to oc-FA Derivatives Odd chain fatty acid derivatives can be produced by the recombinant microbial cells of the present invention. As shown in step (F) of FIG. 1B, the oc-acyl-ACP intermediate is oc in a reaction catalyzed by one or more enzymes (ie, fatty acid derivative enzymes), each of which has fatty acid derivatization activity. -Converted to FA derivative. The fatty acid derivative enzyme can, for example, convert the oc-acyl-ACP to the first oc-FA derivative, or the first oc-FA derivative to the second oc-FA derivative. In some cases, the first oc-FA derivative is converted to a second oc-FA derivative by an enzyme with different fatty acid derivatization activity. In some cases, the second oc-FA derivative may be further converted to a third oc-FA derivative by another fatty acid derivative enzyme.

Thus, in some embodiments, the recombinant microbial cell further comprises one or more polynucleotides, each polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity, and the recombinant microbial cell is carbon. When cultured in the presence of a source under conditions effective for expressing the polynucleotide, it produces an oc-FA derivative.

In various embodiments, fatty acid derivatizing activities include thioesterase activity in which recombinant microbial cells produce oc-fatty acids, ester synthase activity in which recombinant microbial cells produce oc-fat esters, and recombinant microbial cells. Fat aldehyde biosynthetic activity to produce oc-fatty aldehyde, fatty alcohol biosynthetic activity to produce oc-fatty alcohol by recombinant microbial cells, ketone biosynthetic activity to produce ec-ketone by recombinant microbial cells or recombinant microorganisms Includes hydrocarbon biosynthetic activity in which cells produce ec-fatty acids. In some embodiments, recombinant microbial cells are polynucleotides encoding two or more polypeptides, each comprising a polynucleotide having fatty acid derivative enzyme activity.

In a further specific embodiment, the recombinant microbial cells express or overexpress one or more polypeptides having the fatty acid derivative enzyme activity as described above, and the recombinant microbial cells are oc-fatty acid, oc-fatty acid ester. , Oct-Wax Ester, oc-Fat Aldehyde, oc-Fat Aldehyde, ec-Ketone, ec-Alcan, ec-Alcan, ec-Internal Olefin or ec-Terminal Olefin to produce an oc-FA composition.

The following are further examples of fatty acid derivative enzymes and oc-FA derivatives produced by reactions catalyzed by such enzymes according to various embodiments of the invention.

oc-fatty acid In one embodiment, the recombinant microbial cell comprises a polynucleotide encoding thioesterase, and the oc-acyl-ACP intermediate produced by the recombinant microbial cell is thioesterase (eg, 3.1). Hydrolyzed by .1.5, EC 3.1.2.-, eg, EC 3.1.2.14), resulting in the production of oc-fatty acids. In some embodiments, a composition comprising a fatty acid, including an oc-fatty acid (also referred to herein as a "fatty acid composition"), is a condition effective for expressing the polynucleotide in the presence of a carbon source. It is produced by culturing recombinant cells in. In some embodiments, the fatty acid composition comprises an oc-fatty acid and an ec-fatty acid. In some embodiments, the composition is recovered from the cell culture.

In some embodiments, the recombinant microbial cell comprises a polynucleotide encoding a polypeptide having thioesterase activity and one or more additional polynucleotides encoding a polypeptide having other fatty acid derivative enzyme activity. In such cases, the oc-fatty acid produced by the action of thioesterase may be produced by one or more enzymes having various fatty acid derivative enzyme activities, for example, oc-fat ester, oc-fat aldehyde, oc-fat. It is converted to another oc-fatty acid derivative such as alcohol or ec-hydrogen.

In one embodiment, the oc-acyl-ACP intermediate reacts with thioesterase to form oc-fatty acids. The oc-fatty acid can be recovered from cell culture or further converted to another oc-FA derivative such as oc-fat ester, oc-fatty aldehyde, oc-fatty alcohol or ec-terminal olefin. can.

The chain length of fatty acids or fatty acid derivatives made from them can be selected by modifying the expression of certain thioesterases. Thioesterase affects the chain length of the fatty acids produced as well as the chain length of the derivatives made from them. Thus, recombinant microbial cells express, overexpress, attenuate or express one or more selected thioesters in order to increase the production of the preferred fatty acid or fatty acid derivatized substrate. It can be operated so as not to. For example, C ₁₀ fatty acids express thioesterases that select the production of C ₁₀ fatty acids and attenuate thioesterases that select the production of fatty acids other than C ₁₀ fatty acids (eg, thioesterases that prefer the production of C ₁₄ fatty acids). Can be generated by doing. This results in a relatively uniform population of fatty acids with a carbon chain length of 10. In other cases, C ₁₄ fatty acids can be produced by attenuating the endogenous thioesterase that produces non-C ₁₄ fatty acids and expressing thioesterase using C ₁₄ -ACP. _In some cases, C12 fatty acids can be produced by expressing thioesterase using C12- _ACP and attenuating the thioesterase that produces non- _C12 fatty acids. Fatty acid overproduction can be verified by methods known in the art, such as the use of radioactive precursors after cytolysis, HPLC or GC-MS.

Further non-limiting examples of thioesterases for use in the oc-fatty acid pathway and polynucleotides encoding them are listed in PCT Publication No. WO 2010/075483, which is incorporated herein by reference to Table 5 and reference.

oc-Fat Ester In one embodiment, recombinant microbial cells produce oc-fat esters such as, for example, oc-fatty acid methyl ester or oc-fatty acid ethyl ester or oc-wax ester. In some embodiments, the oc-fatty acids produced by recombinant microbial cells are converted to oc-fat esters.

In some embodiments, the recombinant microbial cell encodes a polypeptide (ie, an enzyme) having ester synthase activity (also referred to herein as "ester synthase polypeptide" or "ester synthase"). Containing polynucleotides, oc-lipesters are produced by reactions catalyzed by ester synthase polypeptides expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising a fatty ester comprising an oc-lipester (also referred to herein as a "lipester composition") is effective for expressing the polynucleotide in the presence of a carbon source. It is produced by culturing recombinant cells under various conditions. In some embodiments, the fatty ester composition comprises oc-fat ester and ec-fat ester. In some embodiments, the composition is recovered from the cell culture.

The ester synthase polypeptide may be, for example, an ester synthase polypeptide classified as EC23.1.75, or, but not limited to, a wax-ester synthase, acyl-CoA: alcohol transacylase, acyltransferase or Fat Acyl-CoA: Includes any other polypeptide that catalyzes the conversion of acyl-thioesters to fatty esters, including aliphatic alcohol acyltransferases. For example, the polynucleotides are wax / tagat, Simmondsia chinensis, Acinetobacter species ADP1 strain, Alcanivorax borcumensis, Pseudomonas adusa genosa onse. (Fundibacter jadensis), arabidopsis tariana or Alcanivorax europhos bifunctional ester synthase / acyl-CoA: diacylglycerol acyltransferase may be encoded. In certain embodiments, the ester synthase polypeptide is the Acinetobacter species diacylglycerol O-acyltransferase (wax-dgaT; UniProtKB Q8GGG1, GenBank AAO17391) or Simondosia kinensis wax synthase (UniProtKB Q9XGY6, GenBank1) AD. In certain embodiments, the polynucleotide encoding the esterifying enzyme polypeptide is overexpressed in recombinant microbial cells. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

In another embodiment, the recombinant microbial cell produces an oc-lip ester such as, for example, oc-fatty acid methyl ester or oc-fatty acid ethyl ester, and the recombinant microbial cell is AtfA1 (alkaniborax volcmensis SK2). Acyltransferases obtained from, UniProtKB Q0VKV8, GenBank YP_694462) or AtfA2 (another acyltransferase obtained from Arkaniborax Volkmensis SK2, UniProtKB Q0VNJ6, GenBank YP_693524), etc. Ester synthase / acyltransferase expresses a polynucleotide encoding a polypeptide. In certain embodiments, the polynucleotide encoding the esterifying enzyme polypeptide is overexpressed in recombinant microbial cells. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

In another embodiment, the recombinant microbial cell produces an oc-fatty acid ester such as, for example, oc-fatty acid methyl ester or oc-fatty acid ethyl ester, and the recombinant microbial cell is ES9 (marino encoded by the ws2 gene). Wax ester synthase, UniProt KB A3RE51, GenBank ABO21021 obtained from Marinobacter hydrocarbonoclasticus DSM8798 or ES376 (Marinobacter hydrocarbonoclasticus encoded by the ws1 gene) obtained from bacter hydrocarbonoclasticus M It expresses a fatty acid encoding an ester synthase polypeptide such as another wax ester synthase, UniProtKB A3RE50, GenBank ABO21020). In certain embodiments, the polynucleotide encoding the esterifying enzyme polypeptide is overexpressed in recombinant microbial cells. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

Further non-limiting examples of esterifying enzyme polypeptides suitable for use in these embodiments and polynucleotides encoding them are PCT Publication Nos. WO2007 / 136762 and WO2008 / incorporated herein by reference. The one described in 119082 is included.

oc-lipoaldehyde In one embodiment, recombinant microbial cells produce oc-lipoaldehyde. In some embodiments, the oc-fatty acids produced by recombinant microbial cells are converted to oc-fatty aldehydes. In some embodiments, the oc-fatty aldehydes produced by recombinant microbial cells are then converted to oc-fatty alcohols or ec-hydrocarbons.

In some embodiments, recombinant microbial cells are polypeptides having lipoaldehyde biosynthetic activity (also referred to herein as "fatty aldehyde biosynthetic polypeptides" or "fatty aldehyde biosynthetic enzymes") (ie, enzymes). ), The oc-lipoaldehyde is produced by a reaction catalyzed by a fatty aldehyde biosynthetic polypeptide expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising an oc-fatty aldehyde, also referred to herein as a "fatty aldehyde composition", is effective for expressing the polynucleotide in the presence of a carbon source. It is produced by culturing recombinant cells under various conditions. In some embodiments, the fatty aldehyde composition comprises oc-fatty aldehyde and ec-fatty aldehyde. In some embodiments, the composition is recovered from the cell culture.

In some embodiments, the oc-lipoaldehyde encodes a polypeptide having carboxylic acid reductase (CAR) activity (eg, encoded by the car gene) and other lipoaldehyde biosynthetic activity in recombinant microbial cells. It is produced by expressing or overexpressing a polynucleotide. Examples of carboxylic acid reductase (CAR) polypeptides useful by this embodiment and polynucleotides encoding them are, but are not limited to, FadD9 (EC6.2.1.-, UniProtKB Q50631, GenBank NP_217106), CarA ( Includes GenBank ABK75684), CarB (GenBank YP889972) and related polypeptides described in PCT Publication No. WO2010 / 042664 incorporated herein by reference. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

In some embodiments, the oc-lipoaldehyde encodes a fatty aldehyde biosynthetic polypeptide in recombinant microbial cells, such as, for example, a polypeptide having acyl-ACP reductase (AAR) activity encoded by the aar gene. It is produced by expressing or overexpressing a polynucleotide. Examples of acyl-ACP reductase polypeptides useful by this embodiment are, but are not limited to, the acyl-ACP reductase of Cinecococcus elongatas PCC7942 (GenBank YP_40061) and PCT Publication No. WO2010 / 042664 incorporated herein by reference. Includes the relevant polypeptides described in.

In some embodiments, the oc-fatty aldehyde is a fat in recombinant microbial cells, such as a polypeptide having, for example, acyl-CoA reductase activity encoded by the acr1 gene (eg, EC1.1.2.x). It is produced by expressing or overexpressing a polynucleotide encoding an aldehyde biosynthetic polypeptide. Examples of acyl-CoA reductase polypeptides useful by this embodiment are described in ACR1 of Acinetobacter species ADP1 strain (GenBank YP_047869) and PCT Publication No. WO2010 / 042664 incorporated herein by reference. Includes related polypeptides. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase and an acyl-CoA synthase.

oc-fatty alcohol In one embodiment, recombinant microbial cells produce oc-fatty alcohol. In some embodiments, the oc-fatty aldehyde produced by recombinant microbial cells is converted to oc-fatty alcohol. In another embodiment, the oc-fatty acid produced by recombinant microbial cells is converted to oc-fatty alcohol.

In some embodiments, recombinant microbial cells are polypeptides (ie, enzymes) with fatty alcohol biosynthetic activity (also referred to herein as "fatty alcohol biosynthetic polypeptides" or "fatty alcohol biosynthetic enzymes"). The oc-fatty alcohol is produced by a reaction catalyzed by a fatty alcohol biosynthetic enzyme that is expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising an oc-fatty alcohol, also referred to herein as a "fatty alcohol composition", is effective for expressing the polynucleotide in the presence of a carbon source. It is produced by culturing recombinant cells under various conditions. In some embodiments, the fatty alcohol composition comprises oc-fatty alcohol and ec-fatty alcohol. In some embodiments, the composition is recovered from the cell culture.

In some embodiments, the oc-fatty alcohol is a polypeptide having alcohol dehydrogenase (aldehyde reductase) activity, eg, fatty alcohol biosynthetic activity such as EC 1.1.1.1, in recombinant microbial cells. It is produced by expressing or overexpressing the encoding polynucleotide. Examples of alcohol dehydrogenase polypeptides useful by this embodiment are, but are not limited to, E. coli. Includes the colialcohol dehydrogenase YqhD (GenBank AP_003562) and related polypeptides described in PCT Publication Nos. WO2007 / 136762 and WO2008 / 119082, which are incorporated herein by reference. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a fatty aldehyde biosynthetic polypeptide. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

In some embodiments, the oc-fatty alcohol has a fatty alcohol-forming acyl-ACP reductase (FAR) activity in recombinant microbial cells, eg, EC1.1.1. It is produced by expressing or overexpressing a polynucleotide encoding a fatty alcohol biosynthetic polypeptide, such as a polypeptide having x. Examples of FAR polypeptides useful by this embodiment include, but are not limited to, the polypeptides described in PCT Publication No. WO2010 / 062480, which is incorporated herein by reference. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase and an acyl-CoA synthase.

ec-hydrocarbons In one embodiment, recombinant microbial cells produce ec-hydrocarbons such as ec-alkanes or ec-alkenes (eg, ec-terminal olefins or ec-internal olefins) or ec-ketones. In some embodiments, the oc-acyl-ACP intermediate is converted by decarboxylation and one carbon atom is removed to form an ec-internal olefin or ec-ketone. In some embodiments, the oc-lipoaldehyde produced by recombinant microbial cells is converted by decarbonylation and one carbon atom is removed to form an ec-hydrocarbon. In some embodiments, the oc-fatty acids produced by recombinant microbial cells are converted by decarboxylation and one carbon atom is removed to form an ec-terminal olefin.

In some embodiments, recombinant microbial cells are polypeptides (ie, enzymes) with hydrocarbon biosynthetic activity (also referred to herein as "hydrocarbon biosynthetic polypeptides" or "hydrocarbon biosynthetic enzymes"). Ec-hydrocarbons are produced by reactions catalyzed by hydrocarbon biosynthetic enzymes that are expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising a hydrocarbon comprising an ec-hydrocarbon (also referred to herein as a "hydrocarbon composition") is effective for expressing the polynucleotide in the presence of a carbon source. It is produced by culturing recombinant cells under various conditions. In some embodiments, the hydrocarbon composition comprises an ec-hydrocarbon and an oc-hydrocarbon. In some embodiments, the hydrocarbon composition is recovered from the cell culture.

In some embodiments, the ec-hydrocarbon comprises a polypeptide having a hydrocarbon biosynthetic activity, such as an aldehyde decarboninase (ADC) activity (eg, EC4.19.99.5), in recombinant microbial cells. Aldehyde hydrocarbons encoding a polynucleotide encoding, for example, Prochlorococcus marinus MIT9313 (GenBank NP_89559) or Nostoc punktiforme (GenBank accession number YP_001865325). Or it is produced by overexpression. Further examples of aldehyde decarbonylases and related polypeptides useful by this embodiment are described in PCT Publication Nos. WO2008 / 119082 and WO2009 / 140695, which are incorporated herein by reference, without limitation. Contains polypeptides. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a fatty aldehyde biosynthetic polypeptide. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding an acyl-ACP reductase.

In some embodiments, the ec-terminal olefin is a polypeptide having decarboxylase activity in recombinant microbial cells, eg, as described in PCT Publication No. WO2009 / 085278, which is incorporated herein by reference. It is produced by expressing or overexpressing a polynucleotide encoding a hydrocarbon biosynthetic polypeptide such as. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

In some embodiments, the ec-internal olefin is a poly having OleCD or OleBCD activity in recombinant microbial cells, eg, as described in PCT Publication No. WO 2008/147781, which is incorporated herein by reference. It is produced by expressing or overexpressing a polynucleotide encoding a hydrocarbon biosynthetic polypeptide such as a peptide.

In some embodiments, the ec-ketone is, for example, in recombinant microbial cells, such as a polypeptide having OleA activity as described in PCT Publication No. WO 2008/147781, which is incorporated herein by reference. It is produced by expressing or overexpressing a polynucleotide encoding a hydrocarbon biosynthetic polypeptide.

Saturation Levels of oc-FA Derivatives Saturation of oc-acyl-ACP (which can then be converted to various oc-FA derivatives as described above) is controlled by adjusting the saturation of fatty acid intermediates. can do. For example, genes in the sfa, gns and fab families can be expressed (eg, attenuated) at expressed, overexpressed or reduced levels to control the amount of oc-acyl-ACP saturation.

oc-FA pathway polypeptides and polynucleotides The present disclosure identifies useful polynucleotides in the recombinant microbial cells, methods and compositions of the invention, but does not require absolute sequence identity to such polynucleotides. Please be aware that. For example, changes can be made in a particular polynucleotide sequence to screen for the activity of the encoded polypeptide. Such changes usually include conservative and silent mutations (eg, codon optimization). Modified or mutated (ie, mutant) polynucleotides and encoded variant polypeptides, using methods known in the art, such as, but not limited to, increased catalytic activity, increased stability or It is possible to screen for desired function, such as improved function compared to the parent polypeptide, including reduced inhibition (eg, reduced feedback inhibition).

The present disclosure identifies enzyme activities involved in various steps (ie, reactions) of the oc-FA biosynthetic pathway described herein according to Enzyme Classification (EC) numbers and is classified into such EC numbers. An example of a polypeptide (ie, an enzyme) and an example of a polynucleotide encoding such a polypeptide are provided. Examples of such polypeptides and polynucleotides identified herein by accession number and / or sequence identification number (SEQ ID NO) are oc in parental microbial cells to obtain the recombinant microbial cells described herein. -Useful for manipulating FA routes. However, it should be understood that the polypeptides and polynucleotides described herein are examples, not limitations. The sequences of the homologues of the polypeptide examples described herein are provided, for example, by the Swiss Bioinformatics Institute, an Entrez database provided by the National Center for Biotechnology Information (NCBI), both available on the Worldwide Web. There are databases available to those skilled in the art such as the ExPathy database, the BRENDA database provided by the Technical University of Branschweig, and the KEGG database provided by the Bioinformatics Centers of Kyoto University and the University of Tokyo.

It should be further understood that various microbial cells can be modified to contain the oc-FA pathway described herein to yield recombinant microbial cells suitable for the production of odd chain fatty acid derivatives. It should also be appreciated that various cells can provide a source of genetic material comprising a sequence of polynucleotides encoding a polypeptide suitable for use in the recombinant microbial cells provided herein.

The present disclosure provides numerous examples of polypeptides (ie, enzymes) that have the appropriate activity for use in the oc-FA biosynthetic pathways described herein. Such polypeptides are collectively referred to herein as "oc-FA pathway polypeptides" (or "oc-FA pathway enzymes"). Non-limiting examples of oc-FA pathway polypeptides suitable for use in recombinant microbial cells of the invention are described in the tables and description and examples herein.

In some embodiments, the invention comprises recombinant microbial cells comprising a polynucleotide sequence encoding an oc-FA pathway polypeptide (also referred to herein as the "oc-FA pathway polynucleotide" sequence). included.

Additional oc-FA pathway polypeptides suitable for use in the manipulation of the oc-FA pathway in recombinant microbial cells of the invention and polynucleotides encoding them can be obtained by several methods. For example, the EC number classifies the enzyme according to the catalyzed reaction. Enzymes that catalyze reactions in the biosynthetic pathways described herein are, for example, KEGG databases (Kyoto Encyclopedia of Genes and Genomics; Kyoto University and Tokyo University), UNIPROTKB databases or ENZYME databases, all of which are available on the Worldwide Web. (ExPASy Proteomics Server; Swiss Bioinformatics Laboratory), PROTEIN database or GENE database (Enzyme database; National Biotechnology Information Center (NCBI)) or BRENDA database (The Comprehensive Enzyme Information System System; It can be identified by searching for the EC number corresponding to. In one embodiment, an oc-FA pathway polynucleotide encoding an oc-FA pathway polypeptide having enzymatic activity classified by EC number (such as the EC number listed herein or in one of the tables) or oc-FA pathway polynucleotide thereof. Those active fragments or variants are used in the operation of the corresponding steps of the oc-FA pathway in recombinant microbial cells.

In some embodiments, the oc-FA pathway polynucleotide sequence encodes a polypeptide that is endogenous to the parent cell of the recombinant cell to be engineered. Some such endogenous polypeptides are overexpressed in recombinant microbial cells. As used herein, "endogenous polypeptide" refers to a polypeptide encoded by the genome of a parental (eg, wild-type) cell that has been engineered to produce recombinant microbial cells.

For example, an oc-FA pathway polypeptide, such as an endogenous oc-FA pathway polypeptide, can be overexpressed by any suitable means. As used herein, "overexpression" means expressing a polynucleotide or polypeptide in a cell at a higher concentration than normally expressed in the corresponding parental (eg, wild-type) cell under the same conditions. It means that it causes expression. For example, when a polypeptide is present at higher concentrations in recombinant cells when cultured under the same conditions, compared to concentrations in non-recombinant host cells of the same species (eg, parent cells), the peptide is recombinant cells. It is "overexpressed" within.

In some embodiments, the oc-FA pathway polynucleotide sequence encodes an exogenous or heterologous polypeptide. In other words, the polypeptide encoded by the polynucleotide is exogenous to the parent microbial cell. As used herein, a "foreign" (or "heterologous") polypeptide is encoded by the genome of a parental (eg, wild-type) microbial cell that has been engineered to produce recombinant microbial cells. Refers to a polypeptide that has not. Such polypeptides can also be referred to as "unnatural" polypeptides.

In certain embodiments, the oc-FA pathway polypeptide comprises an amino acid sequence other than one of the amino acid sequences of the polypeptide examples provided herein, eg, the oc-FA pathway polypeptide is an example of a polypeptide. Can include sequences that are homologues, fragments or variants of the sequence of.

As used herein, the terms "homology", "homology" and "homology" are at least 50%, preferably at least 50% of the corresponding polynucleotide or polypeptide sequence. At least 60%, more preferably at least 70% (eg, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least Refers to a polynucleotide or polypeptide containing a sequence that is 96%, at least 97%, at least 98%, or at least 99%) homologous. Those skilled in the art will be familiar with how to measure the homology of two or more sequences. Briefly, the calculation of "homology" of two types of sequences can be carried out as follows. Sequences can be aligned for optimal comparison (eg, gaps can be introduced into one or both of the first and second amino acid or polynucleotide sequences for optimal alignment and are non-homologous for comparison. Arrays can be ignored). In a preferred embodiment, the length of the first sequence to be aligned for comparison is at least about 30%, preferably about 40%, more preferably at least about 50%, even more preferably of the length of the second sequence. Is at least about 60%, and even more preferably at least about 70%, at least about 80%, at least about 90%, or about 100%. The amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions in the first and second sequences are then compared. When the position of the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position of the second sequence, the molecule is identical at that position (amino acids as used herein). Or the "identity" of a nucleic acid is equivalent to the "homosphere" of an amino acid or nucleic acid). The percent identity between the two sequences is the same position shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. It is a function of numbers.

BLAST (Altschul et al., J. Mol. Biol., 215 (3): 403-410 (1990)) is used to compare sequences and measure percent homology (ie, percent identity) between two sequences. It can be realized by using mathematical algorithms such as. The percent homology between the two amino acid sequences also uses the Needleman and Wunsch algorithms built into the GAP program within the GCG software package, using either the Blossum62 matrix or the PAM250 matrix, with a gap weight of 16 , 14, 12, 10, 8, 6 or 4 and length weights 1, 2, 3, 4, 5 or 6 can be used (Needleman and Wunsch, J. Mol. Biol., 48: 444). -453 (1970)). The percent homology of the two nucleotide sequences can also be determined using the GAP program within the GCG software package with NWSgapdna. Measurements can be made using the CMP matrix and gap weights 40, 50, 60, 70 or 80 and length weights 1, 2, 3, 4, 5 or 6. A person skilled in the art can first perform a homology calculation, thereby adapting the algorithm parameters. A preferred parameter set (and parameters that should be used if the physician is uncertain which parameter should be applied to determine if the molecule is within the claims) is the Blossum62 scoring matrix. Then, the gap penalty 12, the gap expansion penalty 4, and the frameshift gap penalty 5 are used. Further methods of sequence alignment are known in the field of biotechnology (eg, Rosenberg, BMC Bioinformatics, 6: 278 (2005); Altschul et al., FEBS J., 272 (20): 5101-5109 (2005). reference).

"Equivalent position" (eg, "equivalent amino acid position" or "equivalent nucleic acid position") is referred to herein as optimally aligned using the alignment algorithms described herein. It is defined as the position (eg, amino acid position or nucleic acid position) of the test polypeptide (or test polynucleotide) sequence that aligns with the corresponding position of the polypeptide (or reference polynucleotide) sequence. The position of the equivalent amino acid in the test polypeptide does not have to be the same numbered position number as the corresponding position in the reference polypeptide, and similarly, the position of the equivalent nucleic acid in the test polynucleotide corresponds to the corresponding position in the reference polynucleotide. It does not have to be the position number of the same number as the position.

In some embodiments, the oc-FA pathway polypeptide is a variant of a reference (eg, parent) polypeptide, such as a variant of the oc-FA pathway polypeptide example described herein. As used herein, a "mutant" (or "mutant") polypeptide is a polypeptide having an amino acid sequence that differs from the parent (eg, wild-type) polypeptide by at least one amino acid. Point to. The variant can contain one or more conservative amino acid substitutions as compared to the parent polypeptide sequence and / or can include one or more non-conservative substitutions. In some embodiments, the variant polypeptide is 1,2,3,4,5,6,7,8,9,10,15,20,30,40, compared to the parent polypeptide sequence. Has 50 or more amino acid substitutions, additions, insertions or deletions. In some embodiments, the sequence of the variant polypeptide is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least with the sequence of the parent polypeptide. 95%, at least 96%, at least 97%, at least 98% or at least 99% identical.

In some embodiments, the oc-FA pathway polypeptide is a fragment of a reference (eg, parent) polypeptide, such as a fragment of an example of the oc-FA pathway polypeptide described herein. The term "fragment" refers to the shorter portion of a full-length polypeptide or protein ranging in size from 4 amino acid residues to the entire amino acid sequence minus 1 amino acid residue. In certain embodiments of the invention, the fragment refers to the entire amino acid sequence of a polypeptide or protein domain (eg, substrate binding domain or catalytic domain).

In some embodiments, the homologue, variant or fragment comprises one or more sequence motifs as defined herein. In one embodiment, the homologue, variant or fragment of the β-ketoacyl-ACP synthase polypeptide comprises one or more sequence motifs selected from SEQ ID NOs: 14-19. The determination that a sequence contains a particular sequence motif can be readily accomplished, for example, using the ScanProsite tool available on the World Wide Web of Expasy Proteomics Servers.

The oc-FA polypeptide has conservative or non-essential amino acid substitutions for the parent polypeptide that have no substantial effect on the biological function or properties of the oc-FA polypeptide. Please understand that it is also good. Whether a particular substitution is acceptable (ie, does not adversely affect the desired biological function such as enzyme activity) is determined, for example, by Bowie.
et al. It can be determined as described in (Science, 247: 1306-1310 (1990)).

A "conservative amino acid substitution" is an amino acid substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. A family of amino acid residues with similar side chains is defined in the art. These families include basic side chains (eg, lysine, arginine, histidine), acidic side chains (eg, aspartic acid, glutamic acid), uncharged polar side chains (eg, glycine, asparagine, glutamine, serine, threonine). , Tyrosine, cysteine), non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta branched side chains (eg, threonine, valine, isoleucine) and aromatic side chains (eg, threonine, valine, isoleucine). For example, amino acids having tyrosine, phenylalanine, tryptophan, histidine) are included.

Variants may be naturally occurring or may be produced in vitro. In particular, variants can be generated using genetic engineering techniques such as site-specific mutagenesis, random chemical mutagenesis, exonuclease III deletion procedures or standard cloning techniques. Alternatively, such variants, fragments, analogs or derivatives can be produced using chemical synthesis or modification procedures.

Methods of making variants are well known in the art. These encode polypeptides with properties that enhance their value in industrial or laboratory applications, including, but not limited to, increased catalytic activity (turnover number), improved stability and reduced feedback inhibition. Includes procedures for modifying nucleic acid sequences obtained from natural isolates to produce nucleic acids. Such procedures generate and characterize a number of modified nucleic acid sequences that differ in one or more nucleotides with respect to the sequences obtained from the native isolate. Differences in these nucleotides usually cause amino acid changes with respect to the polypeptide encoded by the nucleic acid of the native isolate. For example, variants can be prepared by using random or site-specific mutagenesis.

Variants can also be produced by in vivo mutagenesis. In some embodiments, random mutations in nucleic acid sequences have mutations in one or more of the DNA repair pathways. Produced by transmission of sequences in bacterial strains such as coli strains. Such "mutagenetic" strains have a higher random mutation rate than wild-type strains. Propagation of DNA sequences in one of these strains ultimately produces random mutations in the DNA. Suitable mutant strains for use in mutagenesis in vivo are described, for example, in International Patent Application Publication No. WO 1991/016427.

Variants can also be generated using cassette mutagenesis. In cassette mutagenesis, a small region of a double-stranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the natural sequence. Oligonucleotides often contain fully and / or partially randomized natural sequences.

Recursive ensemble mutagenesis can also be used to generate variants. Recursive ensemble mutagenesis is an algorithm for protein manipulation (ie, protein mutagenesis) developed to generate a diverse population of mutants with different member amino acid sequences but phenotypic associations. be. This method uses a feedback mechanism to control a series of combinatorial alkase mutagenesis. Recursive ensemble mutagenesis is described, for example, in Arkin et al. , Proc. Natl. Acad. Sci. , U. S. A. , 89: 7811-7815 (1992).

In some embodiments, variants are created using exponential ensemble mutagenesis. Exponential ensemble mutagenesis is a method for generating combinatorial libraries with a high proportion of unique functional mutants, in parallel with identifying amino acids that lead to functional proteins at each altered position. The small group of residues is randomized. Exponential ensemble mutagenesis is described, for example, in Delegave et al. , Biotechnology. Res, 11: 1548-1552 (1993).

Preferred fragments or variants of the parent polypeptide (eg, fragments or variants of the parent oc-FA pathway polypeptide) are some of the biological functions or properties of the parent polypeptide (eg, enzyme activity, thermal stability). Or keep everything. In some embodiments, the fragment or variant retains at least 75% (eg, at least 80%, at least 90% or at least 95%) of the biological function or properties of the parent polypeptide. In other embodiments, the fragment or variant retains approximately 100% of the biological function or properties of the parent polypeptide.

In some embodiments, fragments or variants of the parent polypeptide show increased catalytic activity against the parent polypeptide under conditions in which recombinant microbial cells are cultured (eg, higher turnover numbers, changes). PH optimality, as reflected by reduced K _m for the desired substrate or increased k _cat / K _m for the desired substrate). For example, if the parent polypeptide is endogenous to the thermophilic cell (ie, obtained from the thermophilic cell), and if the recombinant microbial cells are generally cultured at a lower temperature than the thermophilic cell, the parent polypeptide It is possible that the mutant polypeptide will exhibit significantly reduced activity at lower temperatures, in which case the mutant polypeptide will have increased catalytic activity (eg, higher turnover rate) with respect to the parent polypeptide at such lower temperatures. ) Is preferably shown.

In other embodiments, fragments or variants of the parent polypeptide exhibit improved stability with respect to the stability of the parent polypeptide under conditions in which recombinant microbial cells are cultured. Such stability may include changes in temperature, ionic strength, pH or any other difference in growth or media conditions between the recombinant microbial cell and the cell from which the parent polypeptide was obtained. For example, if the parent polypeptide is obtained from cold-tolerant cells, and if recombinant microbial cells are generally cultured at a higher temperature than the cold-tolerant cells, the parent polypeptide is relatively unstable at higher temperatures. It is possible, in which case the variant polypeptide preferably exhibits improved stability with respect to the stability of the parent polypeptide at such high temperatures.

In other embodiments, fragments or variants of the parent polypeptide are subjected to cell metabolites or culture medium components against such inhibition exhibited by the parent polypeptide under conditions in which recombinant microbial cells are cultured. Indicates a decrease in inhibition of catalytic activity due to (eg, reduction in feedback inhibition).

In certain embodiments, the oc-FA pathway polypeptide is a homologue, fragment or variant of the parent polypeptide and the oc-FA pathway polypeptide is used to carry out the oc-FA pathway reaction in recombinant microbial cells. It is valid. Such oc-FA pathway polypeptides are suitable for use in the recombinant microbial cells of the invention.

The effectiveness of test polypeptides in the conduct of reactions of the oc-FA pathway (eg, the oc-FA pathway polypeptides described herein or their homologues, fragments or variants) is measured by several methods. be able to. For example, in order to measure the effectiveness of a test polypeptide in catalyzing a particular reaction of a biochemical pathway, first, all but the specific pathway reaction to be tested is required to catalyze the reaction of the biochemical pathway in question. Manipulate cells (if necessary) to obtain active parent cells (in some cases, parent cells may express an endogenous polypeptide (s) that catalyze a particular pathway reaction to be tested. However, in such cases, the endogenous activity is preferably low enough to easily detect an increase in product due to the activity of the test polypeptide). A polynucleotide encoding a test polypeptide operably linked to a suitable promoter (eg, in an expression vector) is then introduced into the parent cell to generate the test cell. Test cells and parent cells are cultured separately under the same conditions sufficient for expression of pathway polypeptides in parent and test cell cultures as well as test polypeptide expression in test cell cultures. Samples are taken from test cell cultures and parent cell cultures at various time points during and / or after culture. The sample analyzes the presence of a particular pathway intermediate or product. The presence of pathway intermediates or products is, but is not limited to, gas chromatography (GC), mass analysis (MS), thin layer chromatography (TLC), high performance liquid chromatography (HPLC), liquid chromatography (LC). , GC with hydrogen flame ionization detector (GC-FID), GC-MS and LC-MS can be measured by methods including. The presence of an oc-FA pathway intermediate or product in the test cell culture sample (s) and the absence (or amount) of the oc-FA pathway intermediate or product in the parent culture sample (s). Decreased) suggests that the test polypeptide is effective in performing the oc-FA pathway reaction and is suitable for use in the recombinant microbial cells of the invention.

Production of Odd Chain Fatty Acid Derivatives in Recombinant Microbial Cells In one aspect, the present invention is a method for preparing an odd chain fatty acid derivative composition, which expresses a recombinant polynucleotide sequence in a culture medium containing a carbon source. The present invention comprises a method comprising culturing the recombinant microbial cells of the present invention under effective conditions and appropriately isolating the generated odd-chain fatty acid derivative composition.

The "odd chain fatty acid derivative composition" (abbreviated as "oc-FA derivative composition") is, for example, an odd chain fatty acid, an odd chain fat ester (for example, an odd chain fat methyl ester, an odd chain fat ethyl ester, an odd chain wax). Odds as defined herein such as esters), odd-chain fatty aldehydes, odd-chain fatty alcohols, even-chain hydrocarbons (even-chain alkanes, even-chain alkens, even-chain terminal olefins, even-chain internal olefins, etc.) or even-chain ketones. It is a composition containing a chain fatty acid derivative. Similarly, the "odd chain fatty acid composition" is a composition containing an odd chain fatty acid, the "odd chain fatty alcohol composition" is a composition containing an odd chain fatty alcohol, and the "even chain alkan composition". Is a composition containing an even-chain alcan, and the like. It should also be understood that compositions containing odd chain fatty acid derivatives may also contain even chain fatty acid derivatives.

In one aspect, the invention is a method of making a composition comprising an odd chain fatty acid derivative, wherein (a) lacks or amount of effective enzymatic activity to produce an increased amount of propionyl-CoA. Poly encoding a polypeptide having said enzymatic activity effective to produce an increased amount of propionyl-CoA in recombinant microbial cells relative to the amount of propionyl-CoA produced in the parental microbial cell in which the amount is reduced. Being a nucleotide, at least one polypeptide is exogenous to recombinant microbial cells, or expression of at least one polynucleotide is modulated in recombinant microbial cells as compared to expression of polynucleotides in parental microbial cells. It encodes a conjugated polynucleotide, (b) a polypeptide encoding a β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, and (c) a polypeptide having a fatty acid derivative enzyme activity. Recombinant microbial cells containing one or more polynucleotides (eg, cultures containing recombinant microbial cells), wherein the recombinant microbial cells are in the presence of a carbon source (a), (b). ) And (c) to produce a fatty acid derivative composition containing an odd-chain fatty acid derivative and an even-chain fatty acid derivative when cultured under conditions effective for expressing the polynucleotide, and a culture medium containing a carbon source. Recombinant microbial cells in which the polynucleotides according to (a), (b) and (c) are expressed and recombinant microbial cells are produced under conditions effective for producing a fatty acid derivative composition which also comprises an odd chain fatty acid derivative and an even chain fatty acid derivative. Includes methods comprising culturing and the appropriate recovery of the composition from the culture medium.

In some embodiments, at least 5% by weight, at least 10% by weight, at least 20% by weight, at least 30% by weight, at least 40% by weight, at least 50% by weight, at least 60% by weight, at least 70 of the fatty acid derivative in the composition. By weight, at least 80% by weight or at least 90% by weight are odd chain fatty acid derivatives. In some embodiments, the fatty acid derivative composition is at least 10 mg / L, at least 15 mg / L, at least 20 mg / L, at least 25 mg / L, at least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 125 mg. / L, at least 150 mg / L, at least 175 mg / L, at least 200 mg / L, at least 225 mg / L, at least 250 mg / L, at least 275 mg / L, at least 300 mg / L, at least 325 mg / L, at least 350 mg / L, at least 375 mg / L, at least 400 mg / L, at least 425 mg / L, at least 450 mg / L, at least 475 mg / L, at least 500 mg / L, at least 525 mg / L, at least 550 mg / L, at least 575 mg / L, at least 600 mg / L, at least 625 mg / L, at least 650 mg / L, at least 675 mg / L, at least 700 mg / L, at least 725 mg / L, at least 750 mg / L, at least 775 mg / L, at least 800 mg / L, at least 825 mg / L, at least 850 mg / L, at least 875 mg / L, at least 900 mg / L, at least 925 mg / L, at least 950 mg / L, at least 975 mg / L, at least 1000 mg / L, at least 1050 mg / L, at least 1075 mg / L, at least 1100 mg / L, at least 1125 mg / L, at least 1150 mg / L, at least 1175 mg / L, at least 1200 mg / L, at least 1225 mg / L, at least 1250 mg / L, at least 1275 mg / L, at least 1300 mg / L, at least 1325 mg / L, at least 1350 mg / L, at least 1375 mg / L, at least 1400 mg / L, at least 1425 mg / L, at least 1450 mg / L, at least 1475 mg / L, at least 1500 mg / L, at least 1525 mg / L, at least 1550 mg / L, at least 1575 mg / L, at least 1600 mg / L, at least 1625 mg / L, at least 1650 mg / L, at least 1675 mg / L, at least 1700 mg / L, at least 1725 mg / L, at least 1750 mg / L, at least 1775 mg / L, less 1800 mg / L, at least 1825 mg / L, at least 1850 mg / L, at least 1875 mg / L, at least 1900 mg / L, at least 1925 mg / L, at least 1950 mg / L, at least 1975 mg / L, at least 2000 mg / L, at least 3000 mg / L, At least 4000 mg / L, at least 5000 mg / L, at least 6000 mg / L, at least 7000 mg / L, at least 8000 mg / L, at least 9000 mg / L, at least 10000 mg / L, at least 20000 mg / L (eg, titer), or Includes odd chain fatty acid derivatives in the range linked by any two of the above values.

In various embodiments, the fatty acid derivative enzyme activity includes thioesterase activity, ester synthase activity, fatty aldehyde biosynthesis activity, fatty alcohol biosynthesis activity, ketone biosynthesis activity and / or hydrocarbon biosynthesis activity. In some embodiments, recombinant microbial cells are polynucleotides encoding two or more polypeptides, each comprising a polynucleotide having fatty acid derivative enzyme activity.

In various embodiments, the recombinant microbial cells are odd chain fatty acids, odd chain fatty esters, odd chain wax esters, odd chain fatty aldehydes, odd chain fatty alcohols, even chain alcans, even chain alkens, even chain internal olefins, even chains. Produces compositions comprising chain-terminated olefins or even-chain ketones.

In various embodiments, the recombinant microbial cell is (i) a polynucleotide encoding a polypeptide having aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity, or ( ii) A polynucleotide encoding a polypeptide having (R) -citramalic acid synthase activity, isopropylapple acid isomerase activity and beta-isopropylapple acid dehydrogenase activity, or (iii) methylmalonyl-CoA mutase activity, methylmalonyl. Polypeptides with -CoA decarboxylase activity and / or methylmalonyl-CoA carboxyltransferase activity or (i) and (ii), or (i) and (iii) or (ii) and (iii) or (i), ( At least one polypeptide comprising a polynucleotide encoding a polypeptide having an enzymatic activity effective in producing an increased amount of propionyl-CoA in recombinant microbial cells, selected from ii) and (iii). It is exogenous to recombinant microbial cells, or the expression of at least one polynucleotide is modulated in the recombinant microbial cells as compared to the expression of the polynucleotide in the parent microbial cells.

The fatty acid derivative composition containing the odd-chain fatty acid derivative produced by the method of the present invention can be recovered or isolated from a recombinant microbial cell culture. As used herein, the term "isolated" with respect to products such as fatty acid derivatives refers to products isolated from cellular components, cell culture media or chemical or synthetic precursors. Fatty acid derivatives produced by the methods described herein can be relatively miscible in the fermentation broth as well as in the cytoplasm. Thus, fatty acid derivatives can be collected in either the intracellular or extracellular organic phase. Collecting products in the organic phase can reduce the effect of fatty acid derivatives on cell function and allow recombinant microbial cells to produce more products.

In some embodiments, the fatty acid derivative composition (including odd chain fatty acid derivatives) produced by the method of the invention is purified. As used herein, the terms "purified," "purified," or "purified" mean removing or isolating a molecule from its environment, for example by isolation or isolation. "Substantially purified" molecules contain at least about 60% (eg, at least about 70%, at least about 75%, at least about 85%, at least about 90%, at least about 95%) of their other related components. , At least about 97%, at least about 99%) not included. As used herein, these terms also refer to the removal of contaminants from the sample. For example, removal of contaminants can result in an increase in the proportion of fatty acid derivatives (eg, fatty acids or fatty alcohols or fatty esters or hydrocarbons) to other components in the sample. For example, when fatty esters or fatty alcohols are produced in recombinant microbial cells, the fatty esters or fatty alcohols can be purified by removal of recombinant microbial cell proteins. After purification, the proportion of fatty ester or fatty alcohol in the sample to other components increases.

As used herein, the terms "purified," "purified," and "purified" are relative terms that do not require complete purity. Thus, for example, when a fat derivative composition is produced in recombinant microbial cells, the purified fatty acid derivative composition will have other cellular components (eg, nucleic acids, polypeptides, lipids, carbohydrates or other hydrocarbons). It is a fatty acid derivative composition substantially separated from.

Fatty acid derivative compositions (including odd chain fatty acid derivatives) can be present in the extracellular environment or can be isolated from the extracellular environment of recombinant microbial cells. In certain embodiments, the fatty acid derivative is secreted from recombinant microbial cells. In other embodiments, the fatty acid derivative is transported to the extracellular environment. In yet another embodiment, the fatty acid derivative is passively transported to the extracellular environment. Fatty acid derivatives can be isolated from recombinant microbial cells using methods known in the art.

Fatty acid derivatives (including odd chain fatty acid derivatives produced by the methods of the invention) can be distinguished from petrochemical carbon-derived organic compounds based on double carbon isotope fingerprinting or ^14C dating. .. In addition, the particular source of carbon (eg, glucose vs. glycerol) of the biosource can be determined by the double carbon isotope fingerprint method (see, eg, US Pat. No. 7,169,588).

The ability to distinguish fatty acid derivatives produced by recombinant microbial cells from petroleum-based organic compounds is useful for tracking these materials for commercial purposes. For example, organic compounds or chemicals containing both bio-based and petroleum-based carbon isotope profiles can be distinguished from organic compounds and chemicals made solely from petroleum-based materials. .. Therefore, the materials prepared by the methods of the invention can be commercially traced based on a unique carbon isotope profile.

Fatty acid derivatives produced by recombinant microbial cells can be distinguished from petroleum-based organic compounds by comparing stable carbon isotope ratios ( ¹³ C / ¹² C) in their respective fuels. The ^{13 C / 12 C ratios in those given fatty acid derivatives produced by the methods of the invention are the result of the 13 C / 12 C ratios} in atmospheric carbon dioxide when carbon dioxide is immobilized. It also reflects the exact metabolic pathway. Regional fluctuations also occur. Petroleum, C3 plants (hardwoods) _{, C4} plants (Poaceae), and marine carbonates all show significant differences in ¹³ C / ¹² C and corresponding δ ¹³ C values. In addition, lipid substances in C ₃ and C ₄ plants are analyzed differently from substances obtained from the carbohydrate constituents of the same plant as a result of metabolic pathways.

The scale for measuring ¹³ C was originally defined with Pee Dee Belemnit (PDB) limestone set to zero, and the value is given by a thousandth deviation from this material. The "δ ¹³ C" value is expressed in per _mille , abbreviated as ^0/00 , and is calculated as follows:
δ ¹³ C ( ^0/00 ) = [( ¹³ C / ¹² _{C) sample- (} ¹³ C / ¹² C) _standard ] / ( ¹³ C / ¹² C) _standard × 1000

In some embodiments, the fatty acid derivative δ ¹³ C produced by the method of the invention is about -30 or greater, about -28 or greater, about -27 or greater, about -20 or higher, about -18 or higher, about-. 15 or more, about -13 or more, or about -10 or more. Alternatively, or further, the fatty acid derivative δ ¹³ C is about -4 or less, about -5 or less, about -8 or less, about -10 or less, about -13 or less, about -15 or less, about -18 or less or about-. It is 20 or less. Thus, fatty acid derivatives can have δ ¹³ C linked by any two of the above terminations. For example, the fatty acid derivative δ ¹³ C is about -30 to about -15, about -27 to about -19, about -25 to about -21, about -15 to about -5, about -13 to about -7 or It may be from about -13 to about -10. In some embodiments, the fatty acid derivative δ ¹³ C may be about -10, -11, -12 or -12.3. In other embodiments, the fatty acid derivative δ ¹³ C is about -15.4 or higher. In yet another embodiment, the fatty acid derivative δ ¹³ C is from about -15.4 to about -10.9, or δ ¹³ C is from about -13.92 to about -13.84.

Fatty acid derivatives produced by recombinant microbial cells can also be distinguished from petroleum-based organic compounds by comparing the amount of ¹⁴ C in each compound. Since the nuclear half-life of ¹⁴ C is 5730 years, petroleum-based fuels containing "old" carbon can be distinguished from fatty acids containing "new" carbon or their derivatives (eg, Currie, ". Source Promotion of Atmospheric Particles ”, characterization of
Environmental Particles, J. Mol. Bubble and H. P. van Leeuwen, Eds. , Vol. I of the IUPAC Environmental Analytical Chemistry Series, Lewis Publishers, Inc. , Pp. See 3-74 (1992)).

As used herein, the "modern carbon fraction" or "fm" is the National Institute of Standards and Technology (NIST) Standards (SRM) 4990B, known as oxalic acid standards HOxI and _HOxII , respectively. And have the same meaning as defined by 4990C. The basic definition relates to 0.95 times the ¹⁴ C / ¹² C isotope ratio of HOxI (see AD1950). This is about the same as the decay-corrected pre-industrial forest. In the modern living biosphere (vegetable material), f _M is about 1.1.

In some embodiments, the _fMM ^14C of the fatty acid derivative produced by the method of the invention is at least about 1, eg, at least about 1.003, at least about 1.01, at least about 1.04, at least about 1. 1.111, at least about 1.18, or at least about 1.124. Alternatively, or further, the fatty acid derivative f _M ¹⁴ C is about 1.130 or less, about 1.124 or less, about 1.18 or less, about 1.111 or less, about 1.04 or less. Thus, fatty acid derivatives can have _fMM ^14C linked by any two of the above terminations. For example, fatty acid derivatives are about 1.003 to about 1.124 f _M ¹⁴ C, about 1.04 to about 1.18 f _M ¹⁴ C, or about 1.111 to about 1.124 f _M ¹⁴ Can have C.

All references cited herein, including publications, patent applications and patents, have been shown to be incorporated individually and specifically by reference, and are described in their entirety here. Incorporated herein by reference to the same extent as they do.

The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the claims below) is not otherwise indicated herein. Or, unless it is clearly inconsistent with the context, it shall be intended for both single and plural. The terms "comprising," "having," "inclating," and "containing" are to be construed as open-ended terms unless otherwise stated (ie, "but not limited". , Including "). The description of a range of values herein is used solely as a simplification method to individually refer to each distinct value contained within the range, unless otherwise indicated herein. Is incorporated herein as if individually described herein. All of the methods described herein can be performed in any suitable order, unless otherwise indicated herein or which is clearly inconsistent with the context. The use of any example or exemplary wording used herein (“eg, (eg)”, “such as”, “eg, (for sample)”) is merely a reference to the present invention. It is for clarification and does not limit the scope of the present invention unless otherwise requested. Any wording herein should not be construed as indicating an unclaimed element that is essential to the practice of the invention.

Preferred embodiments of the invention are described herein, including the best known embodiments of the invention. Changes in those preferred embodiments will be apparent to those skilled in the art by reading the above description. The inventors expect that those skilled in the art will use such modifications as appropriate, and the inventors intend to implement the invention in a manner other than that described herein. There is. Accordingly, the invention includes all modifications and equivalents of the subject listed in the appended claims, as permitted by applicable law. Moreover, any combination of the aforementioned elements in all of those possible modifications is incorporated herein, unless otherwise indicated herein or is not clearly inconsistent with the context.

Medium composition Che-9 medium: Further NH ₄ Cl (further 1 g / L), bis-Tris buffer (0.2 M), Triton X-100 (0.1% v / v) and trace minerals (FeCl _3.6H ). _2O 27mg / L, _{ZnCl.4H 2O} 2mg / L, CaCl 2.6H _2O 2mg / L, Na ₂ MoO _{4.2H 2O} 2mg / L, CuSO 4.5H _{2O 1.9mg} / L, H ₃ BO ₃ 0.5 mg / L, concentrated HCl 100 mL / L) supplemented with M9.
2NBT: Che-9 supplemented with 20 g / L (2% w / v) of glucose.
4NBT: Che-9 supplemented with glucose 40 g / L (4% w / v).

Bacterial strains and plasmids E. Kori MG1655 ΔfadE (“D1” strain)
This example describes the construction of recombinant microbial cells in which the expression of fatty acid degrading enzymes is attenuated. E. coli encoding acyl coenzyme A dehydrogenase (GenBank Accession No. AAC73325) involved in fatty acid degradation. Kori's dadE gene (also known as yafH) is described in Datsuenko, K. et al. A. et al. Using the Red system described by (Proc. Natl. Acad. Sci. USA 97: 6640-6645 (2000)), the following modifications were made to E. It was deleted from the Kori strain MG1655.

The following two primers were used to create a deletion of fadeE.
Del-fadE-F 5'AAAAACAGCA ACAAATTGAG CTTTGTTGTAATTAT ATTGTAA ACATATT GATTCCGGGGATCCGTCGACT (SEQ ID NO: 82);

Del-fadE-F and Del-fadE-R primers were used to amplify the kanamycin resistant ( ^KmR ) cassette from plasmid pKD13 by PCR (Datsenko et al., Supra). The PCR product was then used to express Red recombinase (Datsenko et al., Supra) and contain the plasmid pKD46 already derivatized with arabinose for 3-4 hours. Kori MG1655 cells were transformed. After growing in SOC medium at 37 ° C. for 3 hours, cells were seeded on Luria agar plates containing 50 μg / mL kanamycin. Tolerant colonies were identified, incubated overnight at 37 ° C. and then isolated. E. Disruption of the fadE gene was confirmed in some of the colonies by PCR amplification using primers designed adjacent to the coli fadE gene, fadE-L2 and fadE-R1. fadE-L2 5'-CGGGCAGGTGCTATGACCAGGAC (SEQ ID NO: 84); and fadeE-R1 5'-CGCGGCGTTGACCGGCCGCGG (SEQ ID NO: 85)

After confirming the fadE deletion, a single colony was used to remove the Km ^R marker with the pCP20 plasmid (Datsenko et al., Supra). The fadeE gene was deleted and the Km ^R marker was removed to obtain MG1655 E.I. The Kori strain is E. It was referred to as Kori MG1655 ΔfadE or "D1" strain.

E. Kori MG1655 ΔfadE_ΔtonA (“DV2” strain)
This example describes the construction of recombinant microbial cells in which the expression of fatty acid degrading enzymes and the expression of outer membrane protein receptors are attenuated. E. encodes a ferrichrome outer membrane transporter (GenBank accession number NP_414692) that also acts as a bacteriophage receptor. The tonA (also known as fuhuA) gene of Kori MG1655 was described in Datsuenko et al. , The Red system was used according to the above, and the following modifications were made to remove the strain from the D1 strain (described above).

The primers used to create the tonA deletion were: Del-tonA-F 5'-ATCATTCCGTTTACGTATTACTCATTCACTTTTACATTACAGATATAC
CAATGATTCCGGGGATCCGTCGACC (SEQ ID NO: 86); and Del-tonA-R 5'-GCACGGAAATCCGTCGCCCAAAAAGAGAAAATTAGAAAGGAAG
GTTGCGG TTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 87)

Del-tonA-F and Del-tonAR primers were used to amplify the kanamycin resistant ( ^KmR ) cassette from plasmid pKD13 by PCR. The PCR product obtained by this method is an electrocompetent E. cerevisiae already containing pKD46 induced in arabinose for 3-4 hours. Kori MG1655 D1 cells (Datsenko
et al. , Above) was used to transform. After growing in SOC medium at 37 ° C. for 3 hours, cells were seeded on Luria agar plates containing 50 μg / mL kanamycin. Tolerant colonies were identified, incubated overnight at 37 ° C. and then isolated. E. Destruction of the tonA gene was confirmed in some of the colonies by PCR amplification using primers flanking the coli tonA gene: tonA-verF and tonA-verR.
tonA-verF 5'-CAACAGCAACCTGCTACAGCAA (SEQ ID NO: 88); and tonA-verR 5'-AAGCTGGAGCAAGCAAGCGT (SEQ ID NO: 89)

After confirming the tonA deletion, a single colony was used to remove the Km ^R marker with the pCP20 plasmid (Datsenko et al., Supra). MG1655 E. obtained by deleting the fadE and tonA genes. E. coli strain. It was referred to as Kori MG1655 ΔfadE ΔtonA or “DV2” strain.

E. Kori MG1655 ΔfadE_ΔtonA lacI: tesA (“DV2'tesA” strain)
This example describes the construction of recombinant microbial cells containing polynucleotides encoding polypeptides with fatty acid derivative enzyme activity. E. The tesA polynucleotide sequence encoding the coliacyl-CoA thioesterase I (EC 3.1.1.5, 3.1.2.-; eg, GenBank Accession No. AAC73596; SEQ ID NO: 64) is for removing the leader sequence. Thus, the 25 amino acids of the resulting'tesA gene product were cleaved and the original 26-position amino acid, alanine, was replaced with methionine, which became the first amino acid in the'TesA polypeptide sequence. (SEQ ID NO: 65; Cho et al., J. Biol. Chem., 270: 4216-4219 (1995)).

Incorporating cassettes containing the'tesA coding sequence operably linked to the _PTrc promoter and kanamycin resistance gene include primer lacI forward: GGCTGGCTGGCATAAATTCTC (SEQ ID NO: 90) and lacZ reverse: GCGTTAAGTTGTTCTGCTTCATTCAGGCATGTGTgACTGTcat.
Was PCR amplified from the plasmid pACYC-P _Trc -tesA (Example 1, hereafter), electroporated into the DV2 strain, and integrated into the chromosome using the Red recombinase expressed from the pKD46 plasmid (Datsenko et al). .,the above). Transformants were selected on LB plates supplemented with kanamycin. Accurate integration was assessed using diagnostic PCR.

pDG2 expression vector The pDG2 expression vector was the underlying plasmid for many of the constructs described below. The pCDFDuet-1 vector (Novagen / EMD Biosciences) has the CloDF13 replicon, lacI gene and streptomycin / spectinomycin resistance gene (aadA). To construct the pDG2 plasmid, the C-terminal portion of the plsX gene (Podkovyrov and Larson, Nucl. Acids Res.) Containing an internal promoter for the downstream fabH gene.
(1996) 24 (9): 1747-1752 (1996)) Primers 5'-TGAATTCCATGGCGCAACTCACTCTTTCTTTTAGTG-3'(SEQ ID NO: 92) and 5'-CAGTTACTCGAGTCTTCGTATACATGTCGCT CAGTCAC-3'(SEQ ID NO: 93).
Using E. Amplified from Kori MG1655 genomic DNA. These primers introduced NcoI and XhoI restriction sites as well as internal NdeI sites near the ends.

Both the plsX insert (containing the EcfabH promoter) and the pCDFDuet-1 vector were digested with the restriction enzymes NcoI and XhoI. The cleavage vector was treated with Antarctic phosphatase. Inserts were ligated to the vector and transformed competent E.I. Transformed into coli cells. Clones were screened by DNA sequencing. The pDG2 plasmid sequence is designated as SEQ ID NO: 73 in the present specification.

FabH expression plasmid B. The pDG6 plasmid expressing Subtilis FabH1 was constructed using the pDG2 plasmid. The fabH1 coding sequence includes primers 5'-CCTTGGGGACATGAAAGCTG-3'(SEQ ID NO: 94) and 5'-TTTAGTCACTTCGAGTGCACCTCACCTTTT-3'(SEQ ID NO: 95).
Was amplified from Bacillus subtilis strain 168. These primers introduced NdeI and XhoI restriction sites at the ends of the amplification product.

Both the fabH1 insert and the pDG2 vector were digested with restriction enzymes NdeI and XhoI. The cleavage vector was treated with Antarctic phosphatase. Inserts were ligated to the vector and transformed competent E.I. Transformed into coli cells. Clones were screened by DNA sequencing. The pDG6 plasmid sequence is designated as SEQ ID NO: 74 herein, and under the control of the EcfabH promoter, B.I. Expresses the Subtilis FabH1 polypeptide (SEQ ID NO: 2).

Other plasmids based on pDG2 were prepared using a strategy similar to the method used for the pDG6 plasmid. The plasmid pDG7 is described in B.I. Includes a Bacillus subtilis fabH2 coding sequence expressing the Subtilis FabH2 polypeptide (SEQ ID NO: 3). The plasmid pDG8 is described in S.I. Includes a Streptomyces coericolor fabH coding sequence expressing the Coericolor FabH polypeptide (SEQ ID NO: 4).

The pACYC-P _Trc -tesA and pACYC-P _Trc2 -tesA plasmid plasmids pACYC-P _Trc are primed with the lacI ^q , P _Trc promoter and pTrcHis2A (Invitrogen, Carlsbad, CAA) terminator regions (Invitrogen, Carlsbad, CAA) terminator regions AAGGACGTCTTAATTAATTACAGGAGAGCGTTCACCGACAA (SEQ ID NO: 97)
Was constructed by PCR amplification using.

The PCR product was then digested with AatII and NruI and inserted into the plasmid pACYC177 (Rose, RE, Nucleic Acids Res., 16: 356 (1988)) digested with AatII and ScaI. The nucleotide sequence of the pACYC-P _Trc vector is designated as SEQ ID NO: 75 in the present specification.

To generate the pACYC-P _Trc2 plasmid, a single point mutation was introduced into the P _Trc promoter of the pACYC-P _Trc plasmid to generate the mutant promoters PT _rc2 and pACYC-P _Trc2 plasmids. The wild-type P _Trc promoter sequence is designated as SEQ ID NO: 76 herein, and the P _Trc2 mutant promoter is designated as SEQ ID NO: 77 herein.

E. The nucleotide sequence encoding the coliacyl-CoA thioesterase I (TesA, EC3.1.1.5, 3.1.2.-; for example, GenBank Accession No. AAC73596; SEQ ID NO: 64) is used to remove the leader sequence. Thus, the 25 amino acids of the resulting'tesA gene product were cleaved and the original 26-position amino acid, alanine, was replaced with methionine, which became the first amino acid of the'TesA polypeptide. (SEQ ID NO: 65; Cho et al., J. Biol. Chem., 270: 4216-4219 (1995)). The DNA encoding the'TesA polypeptide was inserted into the NcoI and EcoRI sites of the pACYC-P _Trc vector and the pACYC-P _Trc2 vector to generate the pACYC-P _Trc -'tesA and pACYC-P _Trc2 -'tesA plasmids, respectively. The exact insertion of the'tesA sequence into the plasmid was confirmed by restriction digestion.

pOP80 plasmid The pOP80 plasmid is a cloning vector pCL1920 (GenBank AB236930; Lerner CG and Inouye M., Nucleic Acids Res. 18:4631) with restriction enzymes AflII and SfoI.
(1990)) was constructed by digestion. Three types of DNA fragments were produced by this digestion. The 3737bp fragment was gel purified using a gel purification kit (Qiagen, Inc., Valencia, CA). In parallel, DNA sequence fragments containing the _PTrc promoter and lacI region of the commercially available plasmid pTrcHis2 (Invitrogen, Carlsbad, CA) include primers LF302 (5'-atatgacgtcGGCATCCGCTTACAGACA-3', SEQ ID NO: 98) and LF303 (5'). -AutcttagTCAGGAGAGAGCGTCACCGACAA-3', SEQ ID NO: 99) was used for amplification by PCR to introduce recognition sites for ZraI and AflII enzymes, respectively. After amplification, the PCR product was purified using a PCR purification kit (Qiagen, Inc. Valencia, CA) and digested with ZraI and AflII as recommended by the supplier (New England BioLabs Inc., Ipswich, MA). .. After digestion, the PCR product was gel purified and ligated with the 3737bp DNA sequence fragment obtained from pCL1920 to generate the expression vector pOP80 containing the _PTrc promoter.

L. Monosite Genes fabH1 and fabH2 plasmids (pTB.079 and pTB.081)
The genomic DNA of Listeria monocytogenes Li23 (ATCC19114D-5) was used as a template for amplifying the fabH gene using the following primers. TREE044 (fabH_forward) GAGGAATAAAACCATGAACCCAGGAATTTTTAGGAGTAG (SEQ ID NO: 100); Primer 61 (fabH_reverse) CCCAAGCTTCGAATTCTTACTCTACCAACGAATGAATTAGG (SEQ ID NO: 101)

The PCR product was then cloned into the NcoI / EcoRI site of pDS80 (pCL1920-based vector with phage _lambda PL promoter, SEQ ID NO: 78) and transformed competent E.I. Transformed into coli cells. Individual colonies were harvested to verify the sequence of the cloned inserts. Wild type L. The nucleic acid sequence of monocytogenes fabH encodes the wild-type LmFabH1 protein (SEQ ID NO: 7), and the plasmid expressing this sequence is pTB. It was called 079.

Mutant L. The monocytogenes fabH gene was found to contain a change from T to G at position 928, and the change from tryptophan (W) to glycine (G) at amino acid position 310 in the expressed protein, ie the W310G variant. occured. The mutant L. that encodes the FabHW310G mutant. The monocytogenes fabH gene (SEQ ID NO: 8) is referred to as LmFabH2, and the plasmid expressing this sequence is pTB. It was called 081.

pOP80-based fabH expression plasmid Each gene was PCR amplified from the indicated templates and primers (Table 6). E. Except for PfbabH (SEQ ID NO: 150) using the Kollikodont optimized sequence, the natural sequence type of each gene was used. The genes PfbabH (opt), DpfabH1 and DpfabH2 were synthesized by DNA 2.0 (Menlo Park, CA). Cloning vectors were also PCR amplified with primers PTrc_vector_F and PTrc_vector_R (Table 7) using plasmid OP80 as a template. The different fabH genes were then cloned into the PCR-amplified OP80 vector backbone using Infusion cloning (Clontech, Mountain View CA). The standard protocol outlined by the manufacturer was followed. All constructs were validated by sequencing.

E. for the production of odd-chain fatty acids by pathway (A). Manipulation of coli The following examples help increase the metabolic flow through intermediate threonin and α-ketobutyric acid to propionyl-CoA by pathway (A) in FIG. 2 and odd chain acyls in these recombinant cells. Recombinant E. coli expressing a foreign gene encoding an enzyme that causes increased production of ACP and odd chain fatty acid derivatives and / or overexpressing an endogenous gene. The construction of the coli strain is described.

This example also demonstrates the effect of attenuation of endogenous gene expression and substitution of endogenous and exogenous genes on oc-FA production, in which β-ketoacyl-ACP synthase was used. Endogenous E. to encode. Expression of the coli fabH gene is attenuated by gene deletion, and β-ketoacyl-ACP synthase activity is exotic B. It was supplied by the expression of the subtilis fabH1 gene.

DV2 PL _thrA ^* BC
The chromosomal gene involved in threonine biosynthesis lies in the regulation of the potent chromosomally integrated _lambda PL promoter, with one of the genes mutated in recombinant E. coli. Constructed a Kori strain.

To introduce a mutation into the native Aspartkinase I (thrA) gene, E. coli. Two parts of the gene were amplified from Kori MG1655 DNA. The first moiety was amplified using the primers TREE026 and TREE028, while the second moiety was amplified using TREE029 and TREE030 (Table 6). The primers used to amplify the two components then contained the overlapping sequences used to "stitch" the individual compartments together. Two PCR products were combined with one PCR reaction and primers TREE026 and TREE030 to amplify the entire thrA gene. Primers TREE028 and TREE029 have been designed to create mutations at codon 345 of native thrA, resulting in the S345F variant of Aspart Kinase I (SEQ ID NO: 21). This mutation has been shown to eliminate threonine-induced enzyme feedback inhibition in the host strain (Ogawa-Miyata, Y., et al., Biosci. Biotechnol. Biochem. 65: 1149-1154 (2001); Lee. J.-H., et al., J. Bacteriol. 185: 5442-5451 (2003)). The modified form of this gene was called "thrA ^* ".

The PL promoter was amplified using the primers _{Km_trc_overF} and TREE027 (Table 8) and the plasmid pDS80 (vector based on _pCL1920 with the phage lambda PL promoter; SEQ ID NO: 78) as a template. This fragment was then ligated into a kanamycin resistant cassette adjacent to the FRT site and amplified from plasmid pKD13 using primers TREE025 and Km_trc_overR (Table 8). The resulting PCR product containing the _KmFRT cassette and the PL promoter was ligated into the thrA ^* PCR product. Primers TREE025 and TREE030 were used to amplify the entire _KmFRT -PL-thrA ^* mutagenesis cassette. These primers also contain a cassette containing about 50 bp homologous to the integration site at the 5'end and the entire thrA gene homologous to the 3'end and are part of an operon containing the thrA, thrB and thrC genes. Target to the natural thrA site of Kori. This mutagenesis cassette was used with the parent strain E. cerevisiae containing the helper plasmid pKD46 expressing Red recombinase. Electroporation to colli DV2 (Example 1) (Datsenko et al., Supra). Clone containing chromosomal integration was selected in the presence of kanamycin and validated by diagnostic PCR. The kanamycin marker was then removed by expression of the pCP20 plasmid (Dassenko et al., Supra). Proper integration and marker removal were verified by PCR and sequencing. The resulting strain in which the mutant thrA ^* gene and the endogenous thrB and thrC genes are overexpressed by the chromosomal integrated _lambda PL promoter is DV2.
It was called PL _thrA ^* BC.

DV2 P _L thrA ^* BC P _L tdcB
Natural E. The coli catabolic threonine deaminase (tdcB) gene (also known as threonine ammonia-lyase) is overexpressed by incorporating a further copy of the gene into the lacZ locus and placing it under the control of the potent chromosomal integration _lambda PL promoter. rice field.

Catabolic threonine deaminase catalyzes the degradation of threonine into α-ketobutyric acid, the first reaction of the threonine degradation / isoleucine production pathway. The catalyzed reaction is thought to be involved first in the elimination of water (hence, this enzyme was initially classified as a threonine dehydratase) and then in the isomerization and hydrolysis of the product by CN bond cleavage. .. Increased expression of this gene has been shown to dramatically increase isoleucine levels in heterologous organisms (Guillouet S. et al., Appl. Environ. Microbiol. 65: 3100-3107 (1999)). In addition, threonine deaminase is relatively resistant to the isoleucine feedback mechanism (Guillouet et al., Supra).

E. Cory MG1655 genomic DNA was amplified using primers TREE020 and TREE021 (Table 8) to obtain the native tdcB gene. At the same time, primers Kan / Chlor1 and Kan / Chlor4 (Table 8) were used to amplify FRT-kanamycin resistant cassettes for use in integration selection / screening as previously described. As a template, E. Using the Kori MG1655 genomic DNA, primers EG238 and TREE018 (Table 8) are used to amplify the region of 3'homologous to the lacZ integration site, while primers TREE022 and TREE023 (Table 8) are homologous to the lacZ site. Used to amplify the 5'region. Fragments containing the PL promoter were amplified by using the plasmids _pDS80 (phage _lambda PL promoter; pCL1920-based vector with SEQ ID NO: 78) as a template and the primers TREE017 and TREE018 (Table 8). .. Each of these fragments was designed to overlap in corresponding adjacent compartments and spliced together using SOEing PCR technology. The resulting PL _tdcB mutagenesis cassette (about 4.3 kb) contained about 700 bp homologous to the 5'end integration site and 750 bp homologous to the 3'end integration site. The PL _tdcB mutagenesis cassette contains the helper plasmid, pKD46, in the host strain E.I. coli DV2 PL thrA ^* BC (above) electroporated ( _Datsunko et al., Above). Clone containing chromosomal integration was selected in the presence of kanamycin and validated by PCR and sequencing analysis. The kanamycin marker was then removed using the pCP22 plasmid (Dassenko et al., Supra). The obtained strain was referred to as DV2 P _L thrA ^* BC P _L tdcB. This strain was referred to as E. It was transformed with the plasmid pACYC-p _trc2 -'tesA (Example 1) expressing a truncated form of colitesA.

This strain is also B. It was transformed with plasmid pDG6 (Example 1) expressing the Subtilis FabH1 enzyme. Fermentation experiments were performed and the titers of the FFA fractions produced as free fatty acids (FFA), odd chain fatty acids (oc-FA) and oc-FA were measured as shown in Examples 5 and Table 11. Alternatively, this strain can be described, for example, in B.I. PDG7 expressing Subtilis FabH2, pDG8 expressing Streptomyces coericolor FabH, and pTB expressing Listeria monocytogenes FabH. 079, pTB expressing the Listeria monocytogenes FabHW310G variant. It can be transformed with a plasmid expressing various FabH polypeptides such as 081 or the FabH plasmids described in Example 5 and Tables 12A-12C. Fermentation experiments are carried out to measure the titers of free fatty acids (FFA), odd chain fatty acids (oc-FA) and fractions of FFA produced as oc-FA.

DV2 PL-thrA ^* BC P _T5 - _BsfabH1
B. Recombinant E. with the subtilis fabH1 gene integrated into the chromosome and placed under transcriptional control of the potent constituent T5 promoter. Constructed a Kori strain.

First, a PCR product was generated for chromosomal integration of the loxPcat integration cassette containing the chloramphenicol resistance gene, the _T5 promoter (PT5) and the BsfabH1 coding sequence at the site of the fadeE deletion in DV2P _L thrA ^* BC. .. The individual components of the built-in cassette were first PCR amplified. The loxP-cat-loxP P _T5 component was amplified from plasmid p100.38 (SEQ ID NO: 79) using primers TREE133 and TREE135 (Table 9). The BsfabH1 gene was amplified from a plasmid carrying the BsfabH1 gene using primers TREE134 and TREE136. Primers TREE133 and TREE136 contain 50 bp of homologous sequences 5'and 3'for incorporation. The primers used to amplify the components then contain the overlapping sequences used to "join" the individual compartments together. The PCR products of loxP-cat-P _T5 and BsfabH1 were combined together in one PCR reaction by using the primers TREE133 and TREE136, and the final loxPcat-P _T5 -BsfabH1 built-in cassette. Was amplified.

The loxP-cat-P _T5 -BsfabH1 cassette was incorporated using a Red recombinase system (Datsenko, et al., Supra). The loxP-cat-P _T5 - _BsfabH1 PCR product was used to transform electrocompetent DV2 PL-thrA ^* BC cells already containing the plasmid pKD46, which had been induced with arabinose at 30 ° C. for 3-4 hours. After growing in SOC medium at 37 ° C. for 3 hours, cells were seeded on Luria agar plates containing 17 μg / mL of chloramphenicol and incubated overnight at 37 ° C. Appropriate integration of loxP-cat-PT5- _BsfabH1 in chloramphenicol resistant colonies was screened by PCR. Integration was confirmed using primers fadeE-L2 and fadeE-R2 (Table 9) adjacent to the chromosome integration site. Upon validation of integration, the chloramphenicol marker gene was removed by expressing Cre recombinase, which promotes rebinding between two loxP sites flanking the chloramphenicol resistance gene. The plasmid pJW168 carrying the cre recombinase gene was transformed into the DV2 PL-thrA ^* BC loxP-cat-P _T5 - _BsfabH1 strain, and the marker was Palmeros et al. Removed according to the method described by (Gene 247: 255-264 (2000)). The resulting DV2 PL-thrA ^* BC P _T5 - _BsFabH1 strain was validated by sequencing.

DV2 PL-thrA ^* BC P _T5 - _BsfabH1 ΔEcfabH
Recombinant E. coli in which the expression of the endogenous gene (in this case, the fabH gene of E. coli) is attenuated by the deletion of that gene. Constructed a Kori strain.

E. The Kori fabH gene was deleted from DV2 PL-thrA ^* BC P _T5 - _BsFabH1 using the Red recombinase system (Datsenko et al., Supra). Kanamycin resistant cassettes were amplified from plasmid pKD13 by PCR using the primers TREE137 and TREE138 (Table 9). The PCR product was then used to transform electrocompetent DV2 PL-thrA ^* BC P _T5 - _Bsfab H1 cells containing the plasmid pKD46. Removal of EcfabH and removal of the kanamycin marker was performed according to the method described by Wanna and Datsuenko, supra. EcfabH removal was confirmed using primers TREE139 and TREE140. Finally, the strain without a marker is DV2.
PL-thrA ^* BC P _T5 - _BsFabH1 ΔEcfabH.

DV2 PL-thrA ^* BC PL- _tdcB P _T5 - _BsfabH1 ΔEcfabH
Recombinant E. coli containing a chromosomally integrated gene that overexpresses the enzyme in the pathway (A) shown in FIG. 2 and the enzyme in step (D) of the oc-FA biosynthetic pathway shown in FIG. 1B. Constructed a Kori strain. DV2 PL-thrA ^* BC for PL- _tdcB mutagenesis cassette (prepared as described above ₎
Incorporation into the P _T5 -BsfabH1 ΔEcfabH strain produced the DV2 PL-thrA ^* BC PL- _tdcB P _{T5 BsfabH1} ΔEcfabF strain. In this strain, the incorporated E. CorythrA ^* BC gene and integrated E.I. All of the _colitdcB genes are under the control of the potent Lambda PL promoter, and the integrated B.I. The subtilis fabH1 gene is under the control of the potent T5 promoter and has an endogenous E.I. The coli fabH gene was deleted. Fermentation experiments were carried out and the results are shown in Table 11.

E. for the production of odd-chain fatty acids by pathway (B). Manipulation of coli The following examples help increase the metabolic flow through intermediate citramalic acid and α-ketobutyric acid to propionyl-CoA by pathway (B) in FIG. 2 and are odd chain acyls in these recombinant cells. -Recombinant E. that expresses a foreign gene encoding an enzyme that causes increased production of ACP and odd chain fatty acid derivatives and / or overexpresses an endogenous gene. The construction of the coli strain is described.

DV2 P _Trc -simA3.7 leuBCD
E. overexpressing the endogenous leuBCD gene and the exogenous simA3.7 gene. To prepare the coli strain, the endogenous chromosome E.I. PCR products were generated for the KmFRT cassette between the colileuA and leuB genes, the _PTrc promoter and the chromosomal integration of simA3.7. This integration disrupted the natural leuABCD operon, placing simA3.7 and leuBCD under the control of the potent IPTG-inducible promoter, _PTrc , within the operon.

The DNA encoding Cima 3.7 was synthesized by Geneart AG (Regensburg, Germany). The DNA was cloned into the SfiI site of the plasmid pMK-RQ (kanR) (Geneart AG, Regensburg, Germany). Adjacent to the coding sequence, the 5'KpnI restriction site was introduced directly upstream of the ATG start codon and the 3'SacI restriction site was introduced immediately downstream of the TAA stop codon, respectively. The simA3.7 cloning vector was validated by sequencing.

The individual components of the built-in cassette were PCR amplified as follows. The KmFRT component was amplified from plasmid pKD13 using primers TREE146 and Km_trc_overR (Table 10). The P _Trc promoter was amplified from pOP80 using primers Km_trc_overF and TREE033 (Example 1).

The simA3.7 coding sequence was amplified from the simA3.7 cloning vector described above using primers TREE032 and TREE035. To form a 3'homologous sequence for integration, E.I. Kori natural leuBC gene, E.I. Amplified using coli genomic DNA and primers TREE034 and TREE104. The forward primer TREE146 used to amplify the KmFRT cassette contained a homologous sequence of 5'50 bp for incorporation. Each of the primers used to amplify the components contained overlapping sequences used to "join" the individual compartments together. First, KmFRT and PTrc were joined together by combining both compartments in one PCR reaction and the KmFRT-P _Trc products were amplified using primers TREE146 and _TREE033 . Next, KmFRT-P _Trc was coupled with simA3.7 using primers TREE146 and TREE035 to produce KmFRT-PTrc- _simA3.7 . The final compartment, leuBC, was coupled to KmFRT-P _Trc -simA3.7 using primers TREE146 and TREE104 to produce the final built-in cassette: KmFRT-P _Trc -simA3.7 leuBC.

The KmFRT-P _Trc -simA3.7 leuBC cassette uses the Red recombinase system to E. coli. Incorporated into the coli genome (Datsenko, et al., Supra). Electrocompetent E. et al. Containing plasmid pKD46 already induced with arabinose at 30 ° C. for 3-4 hours using the KmFRT-P _Trc -simA3.7 leuBC PCR product. Kori MG1655DV2 cells were transformed. After growing in SOC medium at 37 ° C. for 3 hours, cells were seeded on Luria agar plates containing 50 μg / mL kanamycin and incubated overnight at 37 ° C. Appropriate integration of KmFRT-P _Trc -simA 3.7 in kanamycin resistant colonies was screened by PCR. Integration was confirmed using primers TREE151 and TREE106 adjacent to the chromosome integration site. Verifying integration, the kanamycin marker gene is described in Datsuenko et al. , Removed by the method described above. Successful integration of P _Trc -simA 3.7 and removal of the kanamycin marker gene in the final strain DV2 P _Trc simA 3.7 leuBCD were validated by sequencing.

This strain is referred to as E. Transformed with the plasmid pACYC-p _trc2 -tesA expressing a truncated form of colitesA, and in some cases B.I. Transformed with pDG6 expressing subtilis fabH1. Fermentation experiments were carried out and the titers of the fractions of FFA produced as free fatty acids (FFA), odd chain fatty acids (oc-FA) and oc-FA are listed in Table 11.

E. for the production of odd-chain fatty acids by the combination of pathways (A) and (B). Manipulation of stiffness The following examples help increase the metabolic flow through the common intermediate α-ketobutyric acid to propionyl-CoA by the combination of pathways (A) and (B) in FIG. 2, and recombination of these. Recombinant E. coli expressing a foreign gene encoding an enzyme that also causes increased production of oc-acyl-ACP and odd-chain fatty acids in cells and / or overexpressing an endogenous gene. The construction of the coli strain is described.

DV2 PL-thrA ^* BC P _Trc - _simA 3.7_leuBCD P _T5 -BsfabH1 ΔEcfabH (“G1” strain)
In order to initiate the combination of pathways (A) and (B) of FIG. 2, a PTrc- _{simA3.7_leuBCD} cassette (Example 5) was incorporated into the DV2 PL-thrA ^* BC P _T5 - _BsfabH1 ΔEcfabH strain (implemented). Example 4) DV2 PL-thrA ^* BC P _Trc - _simA 3.7_leuBCD P _T5 -BsfabH1 also referred to as strain G1
A ΔEcfabH strain was generated. This strain overexpresses a polypeptide having (R) -citramalate synthase activity, isopropylanthromic acid isomerase activity and beta-isopropylanic acid dehydrogenase activity by pathway (B) of the oc-FA pathway, and oc- Polypeptides having aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity and threonine synthase activity by the FA pathway (FIG. 2) pathway (A) were overexpressed.

DV2 P _L -thrA ^* BC P _L -tdcB P _Trc -simA 3.7_leuBCD P _T5 -BsfabH1 ΔEcfabH (stock "G2")
A PL- _tdcB cassette (Example 4) was used to generate a strain engineered to overexpress a polypeptide having activity corresponding to the combination of pathways (A) and (B) of the oc-FA pathway. Incorporating into G1 produced a DV2 PL-thrA ^* BC PL- _tdcB P _Trc - _simA 3.7_leuBCD P _T5 -BsfabH1 ΔEcfabH strain, also referred to as strain G2. In this strain, the incorporated E. CorythrA ^* BC gene and integrated E.I. The colitdcB gene, which encodes a polypeptide having aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity corresponding to pathway (A), is a potent _lambda PL promoter. It was placed under control and overexpressed. Exotic cimaA3.7 gene and natural E.I. The colileuBCD gene, which encodes a polypeptide having (R) -citramalate synthase activity, isopropylmalic acid isomerase activity and beta-isopropylmalate dehydrogenase activity, corresponding to pathway (B)) is also described in E. coli. It was integrated under the control of the strong IPTG-inducible promoter _PTrc on the coli chromosome and thus also overexpressed. An integrated B. chain encoding a branched beta ketoacyl-ACP synthase corresponding to a portion (D) (FIG. 1B) of the oc-FA pathway. The subtilis fabH1 gene was placed under the control of the potent T5 promoter. Intrinsic E. The coli fabH gene was deleted from this strain.

Evaluation of Odd-Chain Fatty Acid Production The following examples use propionyl-CoA by either the threonin-dependent pathway (route (A) in FIG. 2) or the citramalic acid pathway (route (B) in FIG. 2). E. cerevisiae expressed exogenous genes encoding enzymes that increase metabolic flow through common α-ketobutyric acid intermediates to produce and / or engineered to overexpress endogenous genes. The production of linear odd-chain fatty acids in the Kori strain is shown. Propionyl-CoA, which serves as a "primer" molecule for the production of odd-chain fatty acids, is then condensed with malonyl-ACP by the action of β-ketoacyl-ACP synthase III (FabH) to form odd-chain fatty acids and oc-FA derivatives. It forms an odd-chain β-ketoacyl-ACP intermediate that enters the fatty acid synthesis cycle for production. Therefore, this example also demonstrates the effect of the exogenous FabH enzyme on odd chain fatty acid production.

In the first set of experiments, strains were evaluated for free fatty acid (FFA) production by performing 96 deep well plate fermentations using the 4N-BT protocol. 300 μL of LB + antibiotic (s) were inoculated using scraping from a single colony or glycerol stock. LB seed cultures were grown at 37 ° C. for 6-8 hours with shaking at 250 rpm until turbid. 20 μL of LB culture was used to inoculate 400 μL of 2N-BT. These were grown overnight at 32 ° C. with shaking at 250 rpm. The next morning, 20 μL of 2N-BT culture was transferred to 400 μL of 4N-BT. The 4N-BT culture was grown at 32 ° C. for 6 hours with shaking at 250 rpm, at which point cells were induced with IPTG 1 mM. After induction, the culture was further grown for 16-18 hours, then extracted and analyzed for FFA production. 40 μL of HCl 1M followed by 400 μL of butyl acetate spiked with a C24 alkane internal standard of 500 mg / L was added to each well. Cells were extracted by vortexing at 2000 rpm for 15 minutes. Extracts were derivatized with equal volumes of N, O-bis (trimethylsilyl) trifluoroacetamide (BSTFA) and then analyzed by GC / MS.

The odd chain fatty acids produced in these experiments generally include C13: 0, C15: 0, C17: 0 and C17: 1 fatty acids and are the main oc-FA from which C15: 0 is produced.

By comparison of strains 1 and 2 in Table 11, microbial cells overexpress genes involved in threonine biosynthesis and degradation, increase metabolic flow through the pathway intermediate α-ketobutyric acid, and odd chains produced by the cells. It has been shown to significantly increase the proportion of long fatty acids. The parent DV2 strain produced linear fatty acids, and the production of odd-chain fatty acids was negligible, but the thrA ^* BC and tdcB genes (aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine). DV2 strains that overexpress (encoding a polypeptide having synthase activity and threonine deaminase activity) produce significantly higher and significantly higher proportions of odd chain length fatty acids, approximately 18% (weight) of the produced linear fatty acids. Was an odd chain length fatty acid.

Strains 2 and 3 show an effect on oc-FA production by containing an exogenous β-ketoacyl ACP synthase with high specificity for propionyl-CoA. Strain 2 is a natural (intrinsic) E. coli. It contained the coli fabH gene. B. By introducing a plasmid expressing the subtilis fabH1 gene, oc-FA production was significantly increased from about 18% (strain 2) to about 37% (strain 3) of the linear fatty acids produced.

The striking effect on oc-FA generation was the intrinsic E. The coli fabH gene was deleted, and B. It was observed when the subtilis fabH1 gene was integrated into the chromosome. In strain 4, the proportion of oc-FA increased to 72% of the linear fatty acids produced.

Strains 5 and 6 also increase the proportion of odd-chain fatty acids produced by another approach, in turn by increasing the metabolic flow through α-ketobutyric acid by pathways involved in citramalic acid biosynthesis and degradation. Show that. The DV2 strain was engineered to overexpress simA3.7 and the leuBCD gene (encoding a polypeptide having (R) -citramalate synthase activity, isopropylmalic acid isomerase activity and β-isopropylmalate dehydrogenase activity). By doing so, about 4% of the produced linear fatty acid has an odd chain length, and the plasmid expression B. Including Subtilis fabH1 increased to about 13%.

Strains 7 and 9 show the effect of the combination of threonine and citramalic acid pathways on oc-FA production. In strain G1 in which the thrA ^* BC, simA3.7 and leuBCD genes are overexpressed, the endogenous E.I. The coli fabH gene was deleted and B. The subtilis fabH1 gene was integrated into the chromosome, and about 26% of the linear fatty acids produced were odd-chain fatty acids. In strain G2 in which the thrA ^* BC, tdcB, simA3.7 and leuBCD genes are overexpressed, the endogenous E.I. The coli fabH gene was deleted and B. The subtilis fabH1 gene was integrated into the chromosome, and almost 90% of the linear fatty acids produced were odd-chain fatty acids. The strains G1 / Tn7-tesA and G / Tn7-tesA (strains 8 and 10 respectively) in which the tesA gene was integrated into the Tn7 attachment site of the chromosome were the strains G1 and G2 (strains 7 respectively) in which the tesA gene was expressed in a plasmid. And 9) showed almost the same amount and proportion of oc-FA.

In the second set of experiments, the role of propionyl-CoA production and the effect of FabH enzyme on oc-FA production were investigated. In this experiment, the exogenous fabH coding sequence was cloned into a pOP80 expression vector (Example 1) and expression was regulated by a potent _PTrc promoter. The fabH expression construct (or only the pOP80 vector in strains lacking exogenous fabH) was transformed with the'tesA plasmid pACYC-PTrc2-tesA into the following strains:
-DV2
-DV2 simA3.7_leuBCD (increased propionyl-CoA via the citramal acid pathway (B) in FIG. 2)
-DV2 thrA ^* BCtdcB (Increase in propionyl-CoA via the thr-dependent pathway (A) in FIG. 2)

300 μL of LB + antibiotic (s) were inoculated using scraping from a single colony or frozen glycerol stock. LB seed cultures were grown at 37 ° C. for 6-8 hours with shaking at 250 rpm until turbid. 20 μL of LB culture was used to inoculate 400 μL of 2N-BT medium. These were grown at 32 ° C. for at least 14 hours with shaking at 250 rpm overnight. The next morning, 20 μL of 2N-BT culture was transferred to 400 μL of 4N-BT. The 4N-BT culture was grown at 32 ° C. for 6 hours with shaking at 250 rpm, at which point cells were induced with IPTG 1 mM. After induction, the culture was further grown for 20-22 hours and then extracted and analyzed for free fatty acid (FFA) production. 40 μL of HCl 1M followed by 400 μL of butyl acetate was added to each well. Cells were extracted by vortexing at 2000 rpm for 15 minutes. The extract was derivatized with an equal volume of N, O-bis (trimethylsilyl) trifluoroacetamide (BSTFA) and then analyzed by GC (GC-FID) coupled with a hydrogen flame ionization detector.

The ratio of odd-chain fatty acids to total free fatty acids produced by strains expressing various fabH genes is listed in Table 12A-C below. The odd chain fatty acid ratios produced in the control DV2 strain are listed in Table 12A, while by either the citramalic acid pathway (route (B) in FIG. 2) or the threonine-dependent pathway (route (A) in FIG. 2). The odd chain fatty acid ratios in the strains engineered for increased metabolic flow to propionyl-CoA are shown in Tables 12B and 12C, respectively.

All strains listed in Tables 12A-12C have endogenous E. coli. The coli fabH gene was expressed. Strains 2-10 further contained the plasmid expression exogenous fabH gene, respectively. Intrinsic E. Deletion of the coli fabH gene and exogenous B. By chromosomal integration of the subtilis fabH1 gene, endogenous E.I. Colli fabH and plasmid expression exogenous B. It was shown in Table 11 (above) that a higher and higher proportion of oc-FA was produced compared to the strain containing Subtilis fabH1 (Table 11, strain 3) (Table 11, strain 4). Nonetheless, the results shown in Tables 12A-12C show that (a) all of the fatty acid-expressing strains tested were engineered for high α-ketobutyric acid and propionyl-CoA levels, DV2 simA 3.7 leuBCD. (Table 12B) and DV2thrA ^* BC tdcB (Table 12C) showed significant linear oc-fatty acid production, but less oc-fatty acid production was observed in the DV2 control strain (Table 12A), so propionyl- CoA is a necessary precursor for recombinant linear odd-chain fatty acid production in bacteria, and (b) recombinant linear oc-fatty acid production in which members contain branched and / or odd-chain fatty acids. It has been shown to occur in the presence of various heterologous FabH enzymes isolated from living organisms. Such FabH enzymes can utilize propionyl-CoA molecules in the priming reaction of fatty acid biosynthesis to impart odd-chain fatty acid biosynthesis ability to recombinant microorganisms.

In conclusion, in this example, microorganisms that normally produce even-chain fatty acids are odd by increasing the metabolic flow through propionyl-CoA and expressing the β-ketoacyl synthase (FabH) enzyme that utilizes propionyl-CoA. It shows that it can be engineered to produce chain fatty acids. Example 6 (below) presents an alternative pathway that can be engineered to increase metabolic flow through propionyl-CoA. Recombinant microorganisms engineered to produce odd-chain fatty acids can be further modified to produce odd-chain fatty acid derivatives such as odd-chain fatty alcohols (Example 7) and even-chain alkanes (Example 8). can.

E. for the production of odd-chain fatty acids by pathway (C). Manipulation of coli The following examples help increase the metabolic flow through the intermediate methylmalonyl-CoA to produce propionyl-CoA by pathway (C) in FIG. 3, and the odd chain acyls in these recombinant cells. Recombinant E. coli expressing a foreign gene encoding an enzyme that causes increased production of ACP and odd-chain fatty acid derivatives and / or overexpressing an endogenous gene. The construction of the coli strain is described. In particular, this example overexpresses the endogenous methylmalonyl-CoA mutase (scpA / sbm) and methylmalonyl-CoA decarboxylase (scpB / ygfG) genes in a plasmid and chromosomal propionyl-CoA: succinyl-CoA transferase ( The scpC / ygfH) and scpB / ygfG genes have been deleted from E. coli. The production of odd-chain fatty acids in the Kori strain is described.

E. The coli strain DV2, the plasmid pDG6 (expressing B. subtilis FabH1) and the plasmid pACYC-p _Trc2 -tesA (expressing the truncated'TesA polypeptide) were prepared as described in Example 1.

Plasmid pACYC-P _Trc -sbm-ygfG
The plasmid pACYC-P _Trc -sbm-ygfG encodes methylmalonyl-CoA mutase from E. coli. E. coli encoding coli sbm and methylmalonyl-CoA decarboxylase. It is a pACYC-P _Trc plasmid (Example 1) that overexpresses coli ygfG. The sequence of pACYC-P _Trc -sbm-ygfG is designated as SEQ ID NO: 80 in the present specification.

sDF4 strain In the sDF4 strain, the scpB and scpC genes of the chromosome were deleted, the natural frd promoter was replaced with the trc promoter, and the'tesA gene was integrated into the Tn7 attachment site of the chromosome. Kori strain DV2.

In order to integrate the'tesA gene, the pACYC-P _Trc -'tesA plasmid (Example 1) was added to the following primers:
IFF: 5'-GGGTCAATAGGCGCCGCAAATTCGCGCGCGGAAGGCG (SEQ ID NO: 140)
IFR: 5'-TGGCCGCGCCTCCTACAGGGCATTACCGCTGACTTGACGGG (SEQ ID NO: 141)
A PTrc- _'tesA built-in cassette was first prepared by amplification using.

The integration cassette was inserted into the NotI and AvrII restriction sites of pGRG25 (GenBank Accession No. DQ460223) to create a Tn7tes plasmid (SEQ ID NO: 81) with Tn7 ends flanking left and right of the lacIq, PTrc- _'tesA cassette.

To prepare the sDF4 strain, McKenzie et al. , BMC Microbiology 6:39 (2006), using the protocol described by the plasmid Tn7tes first. Electroporation was performed on the coli strain DV2 (Example 1). After electroporation, ampicillin-resistant cells were selected by growing them overnight at 32 ° C. in LB medium containing 0.1% glucose and 100 μg / mL carbenicillin. This was followed by overnight cell growth at 32 ° C. on LB and arabinose 0.1% plates to select plasmids containing the Tn7 gene transfer fraction. Single colonies were selected and strimulated on fresh LB medium plates with and without ampicillin and grown overnight at 42 ° C. to recover the Tn7tes plasmid. Therefore, lacIq, _PTrc -'tesA is located between the pstS and glmS genes. It was integrated into the attTn7 site of the coli chromosome. Integration of these genes was confirmed by PCR and sequencing. The obtained strain was referred to as DV2Tn7-tesA.

The following two primers were used to remove the scpBC gene from DV2Tn7-tesA.
ScpBC-KOfwd 5'-GCTCAGTGAATTTATTCCAGACGGCAATTTTTGATTAAAGGA ATTTTT TATTGTTCCG GGGATCCGTCGACC (SEQ ID NO: 142);

ScpBC-KOfwd and ScpBC-KOrc primers were used to amplify a kanamycin resistant (Km ^R ) cassette from plasmid pKD13 by PCR (Datsenko et al., Supra). The PCR product was then used to contain the plasmid pKD46, which has already been induced with arabinose for 3-4 hours and expresses the Red recombinase. Cory DV2 Tn7-tesA cells (Dassenko et al., Supra) were transformed. After growing in SOC medium at 37 ° C. for 3 hours, cells were seeded on Luria agar plates containing 50 μg / mL kanamycin. Tolerant colonies were identified, incubated overnight at 37 ° C. and then isolated. Disruption of the scpBC gene was designed to be adjacent to the chromosomal scpBC gene: ScpBC check-60 fwd 5'-CGGGTTCTGACTTGTAGCG (SEQ ID NO: 144).
ScpBC check +60 rc 5'-CCAACTTCGAAGCAATTGATTGATG (SEQ ID NO: 145)
Was confirmed by PCR amplification using.

After confirming scpBC deletion, a single colony was harvested and used to remove the Km ^R marker using the pCP20 plasmid (Datsenko et al., Supra). Datsenko et al. The native fumarate reductase (frd) promoter was replaced with the PTrc promoter using the modification method of the procedure (above). The obtained E. Kori DV2 ΔscpBC :: FRT, ΔPfrd :: FRT-PTrc, attTn7 :: PTrc-'tesA strain was referred to as "sDF4".

Strains were transformed with plasmids as shown below and evaluated for fatty acid production using the 96 deep well plate fermentation procedure described in Example 5, and since ScpA is a B-12 dependent enzyme, 4N-BT cultures. The medium was supplemented with cobalamin.

In microbial cells that overexpress the genes involved in the production of propionyl-CoA mediated by the intermediates succinyl-CoA and methylmalonyl-CoA, the proportion of odd-chain fatty acids produced by the cells increased. The production of odd-chain long fatty acids in the DV2 strain (Strain 1 in Table 13) was negligible, but the endogenous E. coli. The sDF4 strain overexpressing the coli sbm and ygfG genes (encoding a polypeptide having methylmalonyl-CoA mutase activity and methylmalonyl-CoA decarboxylase activity) increased the production of odd chain length fatty acids.

Strains 2 and 3 in Table 13 show the effect on oc-FA production by including an exogenous β-ketoacyl ACP synthase having high specificity for propionyl-CoA. Strain 2 is a natural E.I. It contained the coli fabH gene. B. By introducing a plasmid expressing the subtilis fabH1 gene, oc-FA production was further increased from about 4% of the fatty acids produced in strain 2 to about 16% of the fatty acids produced in strain 3.

E. Generation of odd-chain fatty alcohols in coli The following shows the production of odd-chain fatty alcohols by the previously described strains in this example, which also expressed a polypeptide having acyl-ACP reductase (AAR) activity. AAR activity converted the oc-acyl-ACP intermediate to oc-fatty aldehyde, which reacted with the endogenous aldehyde reductase to form oc-fatty alcohol.

Stock DV2, DV2 PL-thrA ^* BC PL- _tdcB P _T5 - _BsfabH1
ΔEcfabH and G1 (prepared as described in Examples 1, 2 and 4, respectively) were transformed with either plasmid pLS9185 or pDS171s. The plasmid pLS9185 expressed Synechococcus elongatas fatty acyl-ACP reductase (AAR; GenBank Accession No. YP_40061). The plasmid pDS171s is described in S.I. Elongatas AAR, cyanobacteria Nostoc punctiforme (cACP; GenBank Accession No. YP_001867863) acyl carrier protein (ACP) and Bacillus subtilis (Sfp; GenBank Accession No. 13-transferase) Was expressed. These strains were evaluated for fatty alcohol production using the 96 deep well plate fermentation procedure described in Example 5.

Compared to the control strain DV2, the strain DV2 thrA ^* BC tdcB BsfabH1 ΔEcfabH and G1 are both significantly higher in potency when transformed with a plasmid expressing AAR or a plasmid expressing AAR, cACP and Sfp (Table 14). Generated odd chain fatty alcohols of valence and proportion. The proportion of fatty alcohols produced as odd-chain fatty alcohols largely reflects the proportions observed when assessing the fatty acid production of these strains (Table 11), where AAR is an odd-chain or similar overall chain length. It was suggested that even chain acyl-ACP showed no selectivity.

E. Generation of even-chain alkanes in coli The following examples show the production of even-chain alkanes by strains expressing polypeptides with acyl-ACP reductase (AAR) activity and polypeptides with aldehyde decarbonilase (ADC) activity. .. AAR activity converted the oc-acyl-ACP intermediate to oc-lipoaldehyde, and ADC activity decarbonylated the oc-lipoaldehyde to form even-chain (ec-) alkanes.

Strains DV2, DV2 thrA ^* BC tdcB BsfabH1 ΔEcfabH and G1 (prepared as described in Examples 1, 2 and 4, respectively) were transformed with plasmids pLS9185 and pLS9181. The plasmid pLS9185 expressed Synechococcus elongatas fatty acyl-ACP reductase (AAR; GenBank Accession No. YP_40061). The plasmid pLS9181 expressed nostock punctuformeraldehyde decarbonylase (ADC; GenBank Accession No. YP_001865325). Strains transformed with both plasmids used the 96 deep well plate fermentation procedure described in Example 5 above, but were further supplemented with MnSO ₄₂₅ μM (final concentration) at the time of induction to analyze alkane production.

Compared to control strain DV2, DV2 thrA ^* BC tdcB BsfabH1 ΔEcfabH and G1 both produced significantly higher titers and proportions of even-chain alkanes when transformed with plasmids expressing AAR and ADC (Table 15). did. The proportion of alkanes produced as even-chain alkanes largely reflects the proportion of odd-chain products produced when assessing the fatty acid production (Table 11) and fatty alcohol production (Table 14) of these strains. Suggested that, like AAR, it did not show selectivity between odd- or even-chain substrates of similar overall chain length.

Although the present invention has been described in conjunction with their detailed description, the above description is illustrative of the invention, not limiting its scope, but defined by the appended claims. I want you to understand. Other aspects, advantages and modifications are within the claims below.

Knothe G. , Fuel Process Technology. 86: 1059-1070 (2005)

Claims (20)

(A) Recombinant microorganisms relative to the amount of propionyl-CoA produced in parent microbial cells that lack or have reduced amounts of effective enzymatic activity to produce increased amounts of propionyl-CoA. A polynucleotide encoding a polypeptide having said enzymatic activity effective for producing an increased amount of propionyl-CoA in a cell, wherein the polypeptide is exogenous to recombinant microbial cells or said poly. Nucleotides whose expression of nucleotides is modulated in recombinant microbial cells as compared to expression of polynucleotides in parental microbial cells,
A set containing (b) a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, and (c) a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity. It is a replacement microbial cell,
Fatty acid derivative composition comprising an odd chain fatty acid derivative when the recombinant microbial cells are cultured in the presence of a carbon source under conditions effective for expressing the polynucleotide according to (a), (b) and (c). Generate things,
Recombinant microbial cells in which at least 10% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives. The recombinant microbial cell according to claim 1, wherein at least 20% of the fatty acid derivatives in the fatty acid derivative composition are odd-chain fatty acid derivatives. The recombinant microbial cell according to claim 1, which produces at least 100 mg / L of an odd-chain fatty acid derivative. The recombinant microbial cell according to claim 1, wherein the expression of at least one polynucleotide according to (a) is modulated by the overexpression of the polynucleotide in the recombinant microbial cell. The polynucleotide according to (a)
(I) One or more polynucleotides encoding a polypeptide having aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(Ii) (R) -One or more polynucleotides encoding a polypeptide having citramalate synthase activity, isopropylamolic acid isomerase activity and beta-isopropylmalonyl dehydrogenase activity; and (iii) methylmalonyl- One or more polynucleotides encoding a polypeptide having CoA mutase activity, methylmalonyl-CoA decarboxylase activity and methylmalonyl-CoA carboxyltransferase activity,
The recombinant microbial cell according to claim 1, which is selected from the group consisting of. The recombinant microbial cell according to claim 5, which comprises one or more polynucleotides according to (i) and one or more polynucleotides according to (ii). Polypeptides with β-ketoacyl-ACP synthase activity that utilize propionyl-CoA as a substrate have β-ketoacyl-ACP synthase activity that is exogenous to recombinant microbial cells and endogenous to recombinant microbial cells. The recombinant microbial cell according to claim 1, wherein the expression of the polypeptide is attenuated. The first aspect of claim 1, wherein the fatty acid derivative enzyme activity comprises thioesterase activity, recombinant microbial cells produce a fatty acid composition comprising an odd chain fatty acid, and at least 10% of the fatty acids in the composition are odd chain fatty acids. Recombinant microbial cells. Claimed that the fatty acid derivative enzyme activity comprises an ester synthase activity, recombinant microbial cells produce an adipose ester composition comprising an odd chain adipose ester, and at least 10% of the adipose ester in the composition is an odd chain adipose ester. Item 2. The recombinant microbial cell according to Item 1. Fatty acid derivative enzyme activity comprises lipoaldehyde biosynthesis activity, recombinant microbial cells produce fatty aldehyde compositions comprising odd chain fatty aldehydes, and at least 10% of the fatty aldehydes in the composition are odd chain fatty aldehydes. The recombinant microbial cell according to claim 1. Fatty acid derivative enzyme activity comprises fatty alcohol biosynthesis activity, recombinant microbial cells produce fatty alcohol compositions containing odd chain fatty alcohols, and at least 10% of the fatty alcohols in the composition are odd chain fatty alcohols. The recombinant microbial cell according to claim 1. The fatty acid derivative enzyme activity comprises a hydrocarbon biosynthesis activity, recombinant microbial cells produce a hydrocarbon composition comprising even-chain hydrocarbons, and at least 10% of the hydrocarbons in the composition are even-chain hydrocarbons. The recombinant microbial cell according to claim 1. A cell culture containing the recombinant microbial cell according to claim 1. A method for producing a fatty acid derivative composition containing an odd-chain fatty acid derivative.
Obtaining the recombinant microbial cell according to claim 1,
Recombined under conditions effective for expressing the polynucleotides according to (a), (b) and (c) in a culture medium containing a carbon source and producing a fatty acid derivative composition containing an odd chain fatty acid derivative. By culturing microbial cells, at least 10% of the fatty acid derivatives in the composition are odd chain fatty acid derivatives, and optionally, recovering the odd chain fatty acid derivative composition from the culture medium.
How to include. Recombinant microbial cells,
(1) Polypeptide having thioesterase activity;
(2) Polypeptide having decarboxylase activity;
(3) Polypeptide having carboxylic acid reductase activity;
(4) Polypeptide having alcohol dehydrogenase activity (EC 1.1.1.1);
(5) Polypeptide having aldehyde decarbonylase activity (EC 4.1.999.5);
(6) A polypeptide having acyl-CoA-reductase activity (EC1.2.1.50);
(7) Polypeptide having acyl-ACP reductase activity;
(8) Polypeptide having ester synthase activity (EC 3.11.67);
(9) Polypeptides with OleA activity; and (10) Polypeptides with OleCD or OleBCD activity,
A fatty acid derivative selected from the group consisting of expressing one or more polynucleotides encoding a polypeptide having enzyme activity.
Recombinant microbial cells are one of odd chain fatty acids, odd chain adipose esters, odd chain fatty aldehydes, odd chain fatty alcohols, even chain alkenes, even chain alkenes, even chain terminal olefins, even chain internal olefins or even chain ketones. 14. The method of claim 14, wherein a composition comprising a plurality thereof is produced. A method for producing recombinant microbial cells that produce higher titers or higher proportions of odd-chain fatty acid derivatives than those produced by parental microbial cells.
Obtaining parental microbial cells containing a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity and a polypeptide encoding a fatty acid derivative enzyme activity utilizing propionyl-CoA as a substrate, and the same. Manipulate parent microbial cells to produce recombinant microbial cells that produce or are capable of producing more propionyl-CoA than the amount of propionyl-CoA produced by the parent microbial cells when cultured under conditions. That, including
When recombinant microbial cells are cultured in the presence of a carbon source under conditions effective for expressing the polynucleotide, the titer or percentage of odd-chain fatty acid derivatives produced by the parent microbial cells cultured under the same conditions. A method of producing a higher titer or a higher proportion of odd-chain fatty acid derivatives. The process of manipulating parental microbial cells
(A) Polypeptide having aspart kinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(B) Polypeptides with (R) -citramalate synthase activity, isopropylamonic acid isomerase activity and beta-isopropylmalonyl dehydrogenase activity; and (c) methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase. Polypeptides having either active or methylmalonyl-CoA carboxytransferase activity and optionally methylmalonyl-CoA epimerase activity,
Containing the manipulation of parent microbial cells to express a polynucleotide encoding a polypeptide selected from the group consisting of
At least one polynucleotide according to (a), (b) or (c) is exogenous to the parent microbial cell, or at least one polynucleotide according to (a), (b) or (c) 16. The method of claim 16, wherein the expression of is modulated in recombinant microbial cells as compared to the expression of polynucleotides in parental microbial cells. Recombinant microbial cells have been engineered to express foreign polynucleotides encoding polypeptides with β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, β-ketoacyl-ACP synthase. 16. The method of claim 16, wherein the expression of an endogenous polynucleotide encoding an active polypeptide is attenuated. A method of increasing the titer or proportion of odd-chain fatty acid derivatives produced by microbial cells.
Propionyl-CoA can be produced or produced in greater amounts than the amount of propionyl-CoA produced by the parent microbial cells when the parent microbial cells that produce the fatty acid derivatives are obtained and cultured under the same conditions. Including manipulating parental microbial cells to obtain recombinant microbial cells, including
When recombinant microbial cells are cultured in the presence of a carbon source under conditions effective for producing propionyl-CoA and fatty acid derivatives in recombinant microbial cells, they are produced by the parent microbial cells cultured under the same conditions. A method for producing an odd-chain fatty acid derivative having a higher titer or a higher proportion than the titer or proportion of the odd-chain fatty acid derivative. The fatty acid derivative composition produced by the method according to claim 14.

Images