JP2017131219A - Production of odd chain fatty acid derivatives in recombinant microbial cells - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide recombinant microbial cells engineered to produce fatty acid derivatives having linear chains containing an odd number of carbon atoms by the fatty acid biosynthetic pathway, and to provide methods for making odd chain fatty acid derivatives using the recombinant microbial cells, and compositions comprising odd chain fatty acid derivatives produced by such methods.SOLUTION: According to the present invention, a recombinant microbial cell comprises polynucleotides respectively encoding a polypeptide having enzymatic activity effective to produce an increased amount of propionyl-CoA, a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate, and a polypeptide having fatty acid derivative enzyme activity. Here, the recombinant microbial cell produces a fatty acid derivative composition comprising odd chain fatty acid derivatives when cultured in the presence of a carbon source under conditions effective to express the polynucleotides, and at least 10% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives.SELECTED DRAWING: None

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application is specifically related to US patent application Ser. No. 13 / 232,927 filed Sep. 14, 2011 and U.S. patent filed Sep. 15, 2010, which are incorporated herein by reference in their entirety. This is a continuation-in-part of provisional application No. 61 / 383,086 and claims their priority benefits.

INCORPORATION BY REFERENCE TO ELECTRONIC SUBMITTED MATERIALS This application contains a sequence listing filed in ASCII format by EFS-Web, which is incorporated herein by reference in its entirety. The ASCII copy created on March 7, 2012 is LS0033PC. It is called txt and has a size of 350,776 bytes.

  Crude oil is a very complex mixture containing a wide range of hydrocarbons. Crude oil is converted into a wide variety of fuels and chemicals through various chemical processes in refineries. Crude oil is a source of transportation fuel as well as a source of raw materials for producing petrochemical products. Petrochemical products are used to make specialty chemicals such as plastics, resins, fibers, elastomers, pharmaceuticals, lubricants and gels.

  The most important transportation fuels, namely gasoline, diesel and jet fuel, contain various mixtures of unique hydrocarbons that are tailored for optimal engine performance. For example, gasoline typically contains linear, branched and aromatic hydrocarbons in the range of about 4 to 12 carbon atoms, while diesel is predominantly about 9 to 23 carbon atoms. Includes a range of linear hydrocarbons. The quality of diesel fuel is evaluated by parameters such as cetane number, kinematic viscosity, oxidative stability, and cloud point (Knothe G., Fuel Process Technol. 86: 1059-1070 (2005)). . These parameters are influenced, inter alia, by the length of the hydrocarbon chain and the degree of hydrocarbon branching or saturation.

  Fatty acid derivatives produced by microorganisms can be specially prepared by genetic manipulation. By metabolic manipulation, microbial strains can produce various mixtures of fatty acid derivatives that can be optimized, for example, to meet or exceed fuel standards or other commercially relevant product specifications. is there. The microbial species can be engineered to produce chemical or precursor molecules that are usually obtained from petroleum. In some cases, it may be desirable to mimic the product profile of an existing product, for example, the product profile of an existing petroleum-derived fuel or chemical product, for provisional efficient adaptation or substitution. Recombinant cells and methods described herein can vary, for example, in odd to even length chain ratios as a means of precisely controlling the structure and function of hydrocarbon-based fuels and chemicals. Demonstrate the production of fatty acid derivatives by microorganisms.

  There is a need for a cost-effective petroleum product alternative that does not require exploration, extraction, long-distance transportation or sufficient refining, and that avoids the environmental damage problems associated with petroleum processing. For similar reasons, alternative sources of chemicals usually obtained from petroleum are needed. There is also a need for an efficient and cost-effective method of producing high quality biofuels, fuel substitutes and chemicals from renewable energy sources.

  Recombinant microbial cells engineered to produce fatty acid precursor molecules having the desired chain length (eg, chains having an odd number of carbons) and fatty acid derivatives made therefrom, and using these recombinant microbial cells Processes for producing compositions comprising fatty acid derivatives having desired acyl chain lengths and desired odd: even chain ratios, and compositions produced by these processes, solve these needs .

  The present invention provides novel recombinant microbial cells that produce odd chain length fatty acid derivatives and cell cultures containing such novel recombinant microbial cells. The present invention also provides methods for making compositions comprising odd chain length fatty acid derivatives comprising cultures of recombinant microbial cells of the invention, compositions made by such methods, and other properties revealed by further investigations. (Feature).

  In a first aspect, the invention relates to the production of propionyl-CoA in a parental microbial cell that lacks or has a reduced amount of effective enzymatic activity to increase the production of propionyl-CoA. A recombinant microbial cell comprising a polynucleotide encoding a polypeptide having said enzymatic activity effective to increase the production of propionyl-CoA in the cell, wherein the cell expresses the polynucleotide in the presence of a carbon source Therefore, a recombinant microbial cell that produces a fatty acid derivative composition comprising an odd-chain fatty acid derivative when cultured under effective conditions is provided. Recombinant microbial cells can (a) reduce the amount of propionyl-CoA produced in parental microbial cells that lack or have a reduced amount of effective enzymatic activity to produce increased amounts of propionyl-CoA. In contrast, a polynucleotide encoding a polypeptide having said enzymatic activity effective to produce increased amounts of propionyl-CoA in recombinant microbial cells, wherein the polypeptide is foreign to the recombinant microbial cells. Or a polynucleotide wherein the expression of the polynucleotide is modulated in recombinant microbial cells compared to the expression of the polynucleotide in the parental microbial cell, (b) β-ketoacyl-ACP synthase utilizing propionyl-CoA as a substrate (“FabH”) a polypeptide encoding a polypeptide having activity A recombinant microbial cell expressing a polynucleotide according to (a), (b) and (c) in the presence of a carbon source, comprising a polynucleotide encoding a nucleotide and (c) a polypeptide having fatty acid derivative enzymatic activity When cultured under conditions effective to produce a fatty acid derivative composition comprising an odd chain fatty acid derivative. In some embodiments, the expression of at least one polynucleotide according to (a) is modulated by overexpression of the polynucleotide, such as by operable linkage of the polynucleotide to an exogenous promoter.

  In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60% of the fatty acid derivatives in the composition produced by the microbial cells of the first aspect. %, At least 70%, at least 80% or at least 90% are odd chain fatty acid derivatives. In some embodiments, the recombinant microbial cell is cultured in a culture medium containing a carbon source under conditions effective to express the polynucleotide according to (a), (b), and (c). An odd chain fatty acid derivative of at least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10,000 mg / L Is generated.

  In some embodiments, a polynucleotide encoding a polypeptide having an enzymatic activity effective to produce an increased amount of propionyl-CoA in a recombinant microbial cell according to (a) comprises (i) an aspartokinase activity One or more polynucleotides encoding a polypeptide having homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity or threonine deaminase activity, (ii) (R) -citramalate synthase activity, isopropylmalate One or more polynucleotides encoding a polypeptide having isomerase activity or beta-isopropylmalate dehydrogenase activity and (iii) methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase activity, methyl It is selected from one or more polynucleotides encoding a polypeptide having a malonyl -CoA carboxyl transferase activity or methylmalonyl -CoA epimerase activity. In some embodiments, the microbial cell comprises one or more polynucleotides according to (i) and one or more polynucleotides according to (ii). In some embodiments, the microbial cell comprises one or more polynucleotides according to (i) and / or (ii) and one or more polynucleotides according to (iii).

  In some embodiments, the polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate is foreign to the recombinant microbial cell. In a more specific embodiment, the expression of a polypeptide having β-ketoacyl-ACP synthase activity that is endogenous to the recombinant microbial cell is attenuated.

  The fatty acid derivative enzyme activity may be endogenous ("natural") or exogenous. In some embodiments, the fatty acid derivative enzyme activity includes thioesterase activity, and the fatty acid derivative composition produced by the recombinant microbial cell includes odd and even chain fatty acids. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the fatty acids in the composition. % Are odd chain fatty acids. In some embodiments, the recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective to express the polynucleotide. It produces odd chain fatty acids of 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10,000 mg / L.

  In some embodiments of the first aspect, the fatty acid derivative enzyme activity includes ester synthase activity, and the fatty acid derivative composition produced by the recombinant microorganism includes odd-chain fatty esters and even-chain fatty esters. It is. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the fatty esters in the composition 90% are odd chain fatty esters. In some embodiments, the recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective to express the polynucleotide. Produce odd chain fatty esters of 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10,000 mg / L.

  In some embodiments of the first aspect, the fatty acid derivative enzyme activity includes fatty aldehyde biosynthetic activity, and the fatty acid derivative composition produced by the recombinant microbial cell comprises an odd chain fatty aldehyde and an even chain fatty aldehyde. Is included. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the fatty aldehydes in the composition 90% are odd chain fatty aldehydes. In some embodiments, the recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective to express the polynucleotide. It produces an odd chain fatty aldehyde of 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10000 mg / L.

  In some embodiments of the first aspect, the fatty acid derivative enzyme activity includes fatty alcohol biosynthetic activity, and the fatty acid derivative composition produced by the recombinant microbial cell comprises odd and even chain fatty alcohols. Is included. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the fatty alcohol in the composition 90% are odd chain fatty alcohols. In some embodiments, the recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective to express the polynucleotide. Produce odd chain fatty alcohols of 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10,000 mg / L.

  In some embodiments of the first aspect, the fatty acid derivative enzyme activity includes a hydrocarbon biosynthetic activity, and the fatty acid derivative composition produced by the recombinant microbial cell comprises an alkane composition, an alkene composition, a terminal A hydrocarbon composition, such as an olefin composition, an internal olefin composition, or a ketone composition, which includes odd and even chain hydrocarbons. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least of the hydrocarbons in the composition 90% are even chain hydrocarbons. In some embodiments, the recombinant microbial cells are at least 50 mg / L, at least 75 mg / L, at least when cultured in a culture medium containing a carbon source under conditions effective to express the polynucleotide. It produces even chain hydrocarbons of 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg / L, at least 5000 mg / L or at least 10,000 mg / L.

  In various embodiments, the carbon source includes carbohydrates such as sugars, such as monosaccharides, disaccharides, oligosaccharides or polysaccharides. In some embodiments, the carbon source is obtained from biomass such as cellulose hydrolysate.

  In various embodiments, the parent (eg, host) microbial cell is a prokaryotic cell such as a filamentous fungus, algae, yeast or bacterium. In various preferred embodiments, the host cell is a bacterial cell. In a more preferred embodiment, the host cell is E. coli. E. coli cells or Bacillus cells.

  Examples of pathways for making even-chain fatty acid derivatives and odd-chain fatty acid derivatives are shown in FIGS. 1A and 1B, respectively. FIGS. 2 and 3 are an overview of various approaches directed to metabolic flow through propionyl-CoA to increase odd-chain fatty acid derivative production, and FIG. 2 illustrates the pathway through the intermediate α-ketobutyric acid. An example is shown, and FIG. 3 shows an example of a pathway through the intermediate methylmalonyl-CoA.

  In one embodiment, the recombinant microbial cell according to the first aspect is β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, preferably β-ketoacyl-classified as EC 2.3.1.180. A polynucleotide encoding a polypeptide having ACP synthase III activity is included. In one embodiment, the polypeptide having β-ketoacyl-ACP synthase activity is encoded by the fabH gene. In one embodiment, the polypeptide having β-ketoacyl-ACP synthase activity is endogenous to the parent microbial cell. In another embodiment, the polypeptide having β-ketoacyl-ACP synthase activity is foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, a polypeptide having β-ketoacyl-ACP synthase activity utilizes propionyl-CoA as a substrate and is an odd chain acyl in vitro or in vivo, preferably in vivo. A β-ketoacyl-ACP synthase activity that catalyzes the condensation of propionyl-CoA and malonyl-ACP to form ACP, SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, A sequence selected from 10, 11, 12, 13, 146, 147, 148 or 149 or a variant or fragment thereof. In another embodiment, a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate comprises one or more sequence motifs selected from SEQ ID NOs: 14-19 and is in vitro or in vivo Preferably catalyze the condensation of propionyl-CoA and malonyl-ACP to form odd chain acyl-ACPs in vivo.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises an endogenous polynucleotide sequence encoding a polypeptide having β-ketoacyl-ACP synthase activity (eg, an endogenous fabH gene), but is recombinant. The expression of such endogenous polynucleotide sequences in microbial cells is attenuated. In some embodiments, expression of the endogenous polynucleotide is attenuated by deletion of all or part of the sequence of the endogenous polynucleotide in the recombinant microbial cell. Such a recombinant microbial cell comprising a attenuated endogenous β-ketoacyl-ACP synthase gene may further comprise a polypeptide encoding a foreign polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate. It preferably includes a nucleotide sequence.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having aspartokinase activity (FIG. 2, pathway (A)) classified as EC 2.7.2.4. Including. In some embodiments, the polypeptide having aspartokinase activity is encoded by a thrA, dapG or hom3 gene. In one embodiment, the polypeptide having aspartokinase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having aspartokinase activity is modulated in a recombinant microbial cell. In some cases, the expression of the polynucleotide is regulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having aspartokinase activity has aspartokinase activity and catalyzes the conversion of aspartic acid to aspartyl phosphate in vitro or in vivo, preferably in vivo. A sequence selected from 20, 21, 22, 23, 24 or a variant or fragment thereof.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having homoserine dehydrogenase activity classified as EC 1.1.1.3. In some embodiments, the polypeptide having homoserine dehydrogenase activity is encoded by a thrA, hom or hom6 gene. In one embodiment, the polypeptide having homoserine dehydrogenase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having homoserine dehydrogenase activity is regulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having homoserine dehydrogenase activity has homoserine dehydrogenase activity and a sequence that catalyzes the conversion of aspartate semialdehyde to homoserine in vitro or in vivo, preferably in vivo. A sequence selected from the numbers 20, 21, 25, 26, 27 or a variant or fragment thereof.

  In certain embodiments, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having both aspartokinase and homoserine dehydrogenase activity. In one embodiment, the polypeptide having aspartokinase and homoserine dehydrogenase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having aspartokinase and homoserine dehydrogenase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In one embodiment, the polypeptide having aspartokinase and homoserine dehydrogenase activity is converted in vitro or in vivo, preferably in vivo, from aspartate to aspartyl phosphate and from aspartate semialdehyde to homoserine. And variants or fragments thereof, such as SEQ ID NO: 20 or SEQ ID NO: 21.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having homoserine kinase activity classified as EC 2.7.1.39. In some embodiments, the polypeptide having homoserine kinase activity is encoded by a thrB gene or a thrI gene. In one embodiment, the polypeptide having homoserine kinase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having homoserine kinase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having homoserine kinase activity has homoserine kinase activity and catalyzes the conversion of homoserine to O-phospho-L-homoserine in vitro or in vivo, preferably in vivo. A sequence selected from 28, 29, 30, 31 or a variant or fragment thereof.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having threonine synthase activity classified as EC 4.2.3.1. In one embodiment, the polypeptide having threonine synthase activity is encoded by the thrC gene. In one embodiment, the polypeptide having threonine synthase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having threonine synthase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having threonine synthase activity has threonine synthase activity and catalyzes the conversion of O-phospho-L-homoserine to threonine in vitro or in vivo, preferably in vivo. A sequence selected from SEQ ID NOs: 32, 33, 34 or a variant or fragment thereof is included.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having threonine deaminase activity classified as EC 4.3.1.19. In some embodiments, the polypeptide having threonine deaminase activity is encoded by the tdcB gene or the ilvA gene. In one embodiment, the polypeptide having threonine deaminase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having threonine deaminase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having threonine deaminase activity has threonine deaminase activity and catalyzes the conversion of threonine to 2-ketobutyric acid in vitro or in vivo, preferably in vivo. , 37, 38, 39 or a variant or fragment thereof.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polypeptide having (R) -citramalic acid synthase activity (FIG. 2, pathway (B)) classified as EC 2.3.1.182. The encoding polynucleotide is included. In one embodiment, the polypeptide having (R) -citramalate synthase activity is encoded by the cimA gene. In one embodiment, the polypeptide having (R) -citramalate synthase activity is endogenous to the parent microbial cell or is exogenous to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having (R) -citramalate synthase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having (R) -citramalate synthase activity has (R) -citramalate synthase activity and is acetyl-CoA and pyruvate in vitro or in vivo, preferably in vivo. Comprising a sequence selected from SEQ ID NOs: 40, 41, 42, 43 or a variant or fragment thereof that catalyzes the reaction from to (R) -citramalic acid.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having isopropylmalate isomerase activity classified as EC 4.2.1.33. In one embodiment, the polypeptide having isopropylmalate isomerase activity comprises a large subunit and a small subunit encoded by the leuCD gene. In one embodiment, the polypeptide having isopropylmalate isomerase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having isopropylmalate isomerase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having isopropylmalate isomerase activity comprises a large subunit and a small subunit. In other embodiments, the polypeptide having isopropylmalate isomerase activity has isopropylmalate isomerase activity and is in vitro or in vivo, preferably in vivo, from (R) -citramalic acid to citraconic acid and from citraconic acid to beta. A large subunit sequence selected from SEQ ID NOs: 44 and 46 and a small subunit sequence selected from SEQ ID NOs: 45 and 47 or variants or fragments thereof that catalyze the conversion to methyl-D-malic acid .

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having beta-isopropylmalate dehydrogenase activity classified as EC 1.1.1.185. In some embodiments, the polypeptide having beta-isopropylmalate dehydrogenase activity is encoded by the leuB gene or the leu2 gene. In one embodiment, the polypeptide having beta-isopropylmalate dehydrogenase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having beta-isopropylmalate dehydrogenase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having beta-isopropylmalate dehydrogenase activity has beta-isopropylmalate dehydrogenase activity and is in vitro or in vivo, preferably in vivo, beta-methyl-D- A sequence selected from SEQ ID NOs: 48, 49, 50 or a variant or fragment thereof that catalyzes the conversion of malic acid to 2-ketobutyric acid.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA mutase activity (FIG. 3) classified as EC 5.4.99.2. In some embodiments, the polypeptide having methylmalonyl-CoA mutase activity is encoded by the scpA (also known as sbm) gene. In one embodiment, the polypeptide having methylmalonyl-CoA mutase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA mutase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having methylmalonyl-CoA mutase activity has methylmalonyl-CoA mutase activity and converts succinyl-CoA to methylmalonyl-CoA in vitro or in vivo, preferably in vivo. It comprises a sequence selected from SEQ ID NO: 51, 52, 53, 54, 55, 56, 57, 58 or a variant or fragment thereof that catalyzes.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA decarboxylase activity classified as EC 4.1.1.41. In some embodiments, the polypeptide having methylmalonyl-CoA decarboxylase activity is encoded by the scpB (also known as ygfG) gene. In one embodiment, the polypeptide having methylmalonyl-CoA decarboxylase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA decarboxylase is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having methylmalonyl-CoA decarboxylase activity has methylmalonyl-CoA decarboxylase activity and is converted from methylmalonyl-CoA to propionyl-CoA in vitro or in vivo, preferably in vivo. Including a sequence selected from SEQ ID NOs: 59, 60, 61 or variants or fragments thereof that catalyze the conversion.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA carboxyltransferase activity classified as EC 2.1.3.1. In one embodiment, the polypeptide having methylmalonyl-CoA carboxyltransferase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA carboxyltransferase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having methylmalonyl-CoA carboxyltransferase activity has methylmalonyl-CoA carboxyltransferase activity, and from methylmalonyl-CoA to propionyl-CoA in vitro or in vivo, preferably in vivo. Includes the sequence of SEQ ID NO: 62 or a variant or fragment thereof that catalyzes the conversion.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having methylmalonyl-CoA epimerase activity classified as EC 5.1.99.1. In one embodiment, the polypeptide having methylmalonyl-CoA epimerase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having methylmalonyl-CoA epimerase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having methylmalonyl-CoA epimerase activity has methylmalonyl-CoA epimerase activity and is from (R) -methylmalonyl-CoA to (S) in vitro or in vivo, preferably in vivo. -Comprises the sequence of SEQ ID NO: 63 or a variant or fragment thereof that catalyzes the conversion to methylmalonyl-CoA.

  In one embodiment, the recombinant microbial cell according to the first aspect is an endogenous polynucleotide sequence encoding a polypeptide having propionyl-CoA :: succinyl-CoA transferase activity (eg, the endogenous scpC gene (also known as ygfH)). The expression of such endogenous polynucleotides in recombinant microbial cells is attenuated. In some embodiments, expression of the endogenous polynucleotide is attenuated by deletion of all or part of the sequence of the endogenous polynucleotide in the recombinant microbial cell.

  In one embodiment, the recombinant microbial cell according to the first aspect comprises an endogenous polynucleotide sequence (eg, endogenous fadE gene) encoding a polypeptide having acyl-CoA dehydrogenase activity, and the recombinant microbial cell. The expression of such endogenous polynucleotide sequences in may or may not be attenuated.

  In another embodiment, the recombinant microbial cell according to the first aspect comprises a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity, and the recombinant microbial cell is odd when cultured in the presence of a carbon source. A fatty acid derivative composition comprising a chain fatty acid derivative is produced.

  In various embodiments, the fatty acid derivative enzyme activity includes thioesterase activity, ester synthase activity, fatty aldehyde biosynthesis activity, fatty alcohol biosynthesis activity, ketone biosynthesis activity and / or hydrocarbon biosynthesis activity. In some embodiments, the recombinant microbial cell comprises a polynucleotide that encodes two or more polypeptides, each polypeptide having a fatty acid derivative enzyme activity. In a more specific embodiment, the recombinant microbial cell comprises (1) a polypeptide having thioesterase activity, (2) a polypeptide having decarboxylase activity, (3) a polypeptide having carboxylic acid reductase activity, (4) Polypeptide having alcohol dehydrogenase activity (EC 1.1.1.1), (5) Polypeptide having aldehyde decarbonylase activity (EC 4.1.99.5), (6) Acyl-CoA-reductase Polypeptide having activity (EC 1.2.1.50), (7) polypeptide having acyl-ACP reductase activity, (8) polypeptide having ester synthase activity (EC 3.1.1.67), ( 9) Polypeptide having OleA activity, or (10) OleCD or OleBCD activity A recombinant microbial cell that expresses or overexpresses one or more polypeptides having a fatty acid derivative enzyme activity selected from repeptides, wherein the recombinant microbial cell is an odd chain fatty acid, odd chain fatty ester, odd chain wax ester, odd chain fat A composition comprising an aldehyde, an odd chain fatty alcohol, an even chain alkane, an even chain alkene, an even chain internal olefin, an even chain terminal olefin or an even chain ketone is produced.

  In one embodiment, the fatty acid derivative enzyme activity comprises thioesterase activity, and the culture comprising the recombinant microbial cells produces a fatty acid composition comprising odd chain fatty acids when cultured in the presence of a carbon source. In some embodiments, the polypeptide has an EC 3.1.1.5, an EC 3.1.2. -Or thioesterase activity classified as EC 3.1.2.14. In some embodiments, the polypeptide having thioesterase activity is encoded by a tesA, tesB, fatA or fatB gene. In some embodiments, the polypeptide having thioesterase activity is endogenous to the parent microbial cell or foreign to the parent microbial cell. In another embodiment, the expression of a polynucleotide encoding a polypeptide having thioesterase activity is modulated in a recombinant microbial cell. In some cases, expression of the polynucleotide is modulated by operably linking the polynucleotide to an exogenous promoter such that the polynucleotide is overexpressed in recombinant microbial cells. In another embodiment, the polypeptide having thioesterase activity has thioesterase activity and catalyzes the hydrolysis of odd chain acyl-ACP to odd chain fatty acids in vitro or in vivo, preferably in vivo, or A sequence selected from SEQ ID NOs: 64, 65, 66, 67, 68, 69, 70, 71 and 72, or a variant or fragment thereof, which catalyzes the alcoholysis of an odd chain acyl-ACP to an odd chain fatty ester. Including. In some embodiments, the recombinant microbial cell according to the first aspect comprising a polynucleotide encoding a polypeptide having thioesterase activity, when cultured in the presence of a carbon source, in a culture medium containing the carbon source. At least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L or at least 2000 mg / L when cultured under conditions effective to express the polynucleotide at Produces L odd chain fatty acids. In some embodiments, the recombinant microbial cell according to the first aspect comprising a polynucleotide encoding a polypeptide having thioesterase activity produces a fatty acid composition comprising odd and even chain fatty acids. In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the fatty acids in the composition. % Are odd chain fatty acids.

  The present invention includes a cell culture comprising a recombinant microbial cell according to the first aspect.

  In a second aspect, the present invention is a method for producing odd-chain fatty acid derivatives (or fatty acid derivative compositions comprising odd-chain fatty acid derivatives) in recombinant microbial cells, which increases the production of propionyl-CoA in the cells. In order to express a recombinant polypeptide having an effective enzymatic activity in the cell and to express the recombinant polypeptide in the presence of a carbon source and to produce an odd chain fatty acid derivative And culturing.

  In one embodiment, a method for producing a fatty acid derivative composition comprising an odd-chain fatty acid derivative comprises obtaining a recombinant microbial cell according to the first aspect and in a culture medium containing a carbon source (a), (b ) And (c) expressing the polynucleotide and culturing the cells under conditions effective to produce a fatty acid derivative composition comprising an odd chain fatty acid derivative, and optionally recovering the composition from the culture medium; including.

  In some embodiments, the fatty acid derivative composition produced by the method according to the second aspect comprises an odd chain fatty acid derivative and an even chain fatty acid derivative, and at least 5%, at least 6% by weight of the fatty acid derivative in the composition. %, At least 8%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% % Is an odd-chain fatty acid derivative. In some embodiments, the fatty acid derivative composition comprises an odd chain fatty acid derivative of at least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 200 mg / L, at least 500 mg / L, at least 1000 mg / L, at least 2000 mg. / L, at least 5000 mg / L, at least 10,000 mg / L or at least 20000 mg / L (eg, titer).

  In various embodiments of the second aspect, the fatty acid derivative enzyme activity includes thioesterase activity, ester synthase activity, fatty aldehyde biosynthesis activity, fatty alcohol biosynthesis activity, ketone biosynthesis activity and / or hydrocarbon biosynthesis. Activity included. In some embodiments, the recombinant microbial cell comprises a polynucleotide that encodes two or more polypeptides, each polypeptide having a fatty acid derivative enzyme activity. In a more specific embodiment, the recombinant microbial cell comprises (1) a polypeptide having thioesterase activity, (2) a polypeptide having decarboxylase activity, (3) a polypeptide having carboxylic acid reductase activity, (4) Polypeptide having alcohol dehydrogenase activity (EC1.1.1.1), (5) Polypeptide having aldehyde decarbonylase activity (EC4.11.99.5), (6) Acyl-CoA-reductase activity (7) a polypeptide having acyl-ACP reductase activity, (8) a polypeptide having ester synthase activity (EC 3.1.1.67), (9) ) A polypeptide having OleA activity, or (10) a polypeptide having OleCD or OleBCD activity. One or more polypeptides having fatty acid derivative enzyme activity selected from peptides are expressed or overexpressed, the recombinant microbial cell is one or more odd chain fatty acids, odd chain fatty esters, odd chain waxes A composition comprising an ester, an odd chain fatty aldehyde, an odd chain fatty alcohol, an even chain alkane, an even chain alkene, an even chain internal olefin, an even chain terminal olefin and an even chain ketone is produced.

  The present invention includes a fatty acid derivative composition comprising an odd chain fatty acid derivative produced by the method according to the second aspect.

  In a third aspect, the present invention provides a method for producing a recombinant microbial cell that produces a higher potency or higher proportion of odd-chain fatty acid derivatives than the parent microbial cell, which encodes a polypeptide having fatty acid derivative enzyme activity. Can produce or produce a larger amount of propionyl-CoA than the amount of propionyl-CoA produced by the parental microbial cell when cultured under the same conditions. Manipulating the parent microbial cell to obtain a recombinant microbial cell, wherein the recombinant microbial cell is effective to produce propionyl-CoA and fatty acid derivatives in the recombinant microbial cell in the presence of a carbon source. When cultured under the same conditions, the titer of the odd-chain fatty acid derivative produced by the parental microbial cells cultured under the same conditions. Includes against percentage, a method of generating a higher titers or high proportion odd-chain fatty acid moieties.

  In a fourth aspect, the present invention is a method for increasing the potency or proportion of odd-chain fatty acid derivatives produced by microbial cells, the same as obtaining parental microbial cells capable of producing fatty acid derivatives. Manipulating the parental microbial cell to obtain a recombinant microbial cell that produces or is capable of producing a larger amount of propionyl-CoA than the amount of propionyl-CoA produced by the parental microbial cell when cultured under conditions And when the recombinant microbial cell is cultured under conditions effective to produce propionyl-CoA and a fatty acid derivative in the recombinant microbial cell in the presence of a carbon source, Higher titer or higher percentage of odd chain fat relative to the potency or percentage of odd chain fatty acid derivatives produced by microbial cells It includes a method for generating acid derivative.

  In some embodiments according to the third or fourth aspects, the step of manipulating the parent microbial cell comprises (a) aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity. One or more polypeptides having: (b) one or more polypeptides having (R) -citramalic acid synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity, and ( c) a polypeptide selected from one or more polypeptides having methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase activity, methylmalonyl-CoA carboxyltransferase activity and methylmalonyl-CoA epimerase activity. Engineering the cell to express a polynucleotide encoding tide, wherein at least one polypeptide according to (a), (b) or (c) is foreign to the parental microbial cell, or ( The expression of at least one polynucleotide according to a), (b) or (c) is modulated in the recombinant microbial cell compared to the expression of the polynucleotide in the parental microbial cell. In some embodiments, the expression of at least one polynucleotide is modulated by overexpression of the polynucleotide, such as by operable linkage of the polynucleotide to an exogenous promoter. In some embodiments, the engineered cells express one or more polypeptides according to (a) and one or more polypeptides according to (b).

  In some embodiments according to the third or fourth aspects, the parental microbial cell comprises a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate. In some embodiments, the recombinant microbial cell expresses an exogenous polynucleotide that encodes a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate, or an endogenous polynucleotide. Is engineered to overexpress. In some embodiments, the recombinant microbial cell has been engineered to express an exogenous polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate; Expression of the endogenous polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity is attenuated. In some embodiments, the polynucleotide encoding a polypeptide having a β-ketoacyl-ACP synthase is a modified, mutated or mutated form of an endogenous polynucleotide, and is not modified endogenously. The polynucleotide is selected for enhanced affinity or activity for propionyl-CoA as a substrate. Numerous methods for generating modified mutants or mutant polynucleotides are well known in the art, examples of which are described herein below.

[Invention 1001]
(A) an increased amount of propionyl-CoA relative to the amount of propionyl-CoA produced in a parental microbial cell that lacks or has a reduced amount of effective enzymatic activity to produce propionyl-CoA. A polynucleotide encoding a polypeptide having said enzymatic activity effective for producing CoA in recombinant microbial cells, wherein said polypeptide is foreign to recombinant microbial cells or expression of said polynucleotide Wherein the polynucleotide is modulated in the recombinant microbial cell compared to the expression of the polynucleotide in the parental microbial cell,
(B) a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, and (c) a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity,
A recombinant microbial cell comprising
Fatty acid derivative composition comprising odd-chain fatty acid derivatives when recombinant microbial cells are cultured under conditions effective to express the polynucleotides according to (a), (b) and (c) in the presence of a carbon source Produce things,
A recombinant microbial cell, wherein at least 10% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives.
[Invention 1002]
The recombinant microbial cell of the invention 1001, wherein at least 20% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives.
[Invention 1003]
100. The recombinant microbial cell of the invention 1001 which produces an odd chain fatty acid derivative of at least 100 mg / L.
[Invention 1004]
The recombinant microbial cell of the invention 1001, wherein the expression of at least one polynucleotide according to (a) is modulated by overexpression of the polynucleotide in the recombinant microbial cell.
[Invention 1005]
A polynucleotide according to (a),
(I) one or more polynucleotides encoding a polypeptide having aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(Ii) one or more polynucleotides encoding a polypeptide having (R) -citramalate synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity; and (iii) methylmalonyl- One or more polynucleotides encoding a polypeptide having CoA mutase activity, methylmalonyl-CoA decarboxylase activity and methylmalonyl-CoA carboxyltransferase activity;
The recombinant microbial cell of the invention 1001, selected from the group consisting of:
[Invention 1006]
The recombinant microbial cell of the invention 1005, comprising one or more polynucleotides according to (i) and one or more polynucleotides according to (ii).
[Invention 1007]
A polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate is foreign to recombinant microbial cells and has β-ketoacyl-ACP synthase activity endogenous to recombinant microbial cells The recombinant microbial cell of the invention 1001, wherein the polypeptide expression is attenuated.
[Invention 1008]
The recombinant of invention 1001 wherein the fatty acid derivative enzyme activity comprises thioesterase activity, the recombinant microbial cell produces a fatty acid composition comprising odd chain fatty acids, wherein at least 10% of the fatty acids in the composition are odd chain fatty acids Microbial cell.
[Invention 1009]
The present invention wherein the fatty acid derivative enzyme activity comprises ester synthase activity and the recombinant microbial cell produces a fatty ester composition comprising an odd chain fatty ester, wherein at least 10% of the fatty esters in the composition are odd chain fatty esters The recombinant microbial cell of invention 1001.
[Invention 1010]
The fatty acid derivative enzyme activity comprises a fatty aldehyde biosynthetic activity and the recombinant microbial cell produces a fatty aldehyde composition comprising an odd chain fatty aldehyde, wherein at least 10% of the fatty aldehydes in the composition are odd chain fatty aldehydes; The recombinant microbial cell of the invention 1001.
[Invention 1011]
The fatty acid derivative enzyme activity comprises fatty alcohol biosynthetic activity, and the recombinant microbial cell produces a fatty alcohol composition comprising odd chain fatty alcohol, wherein at least 10% of the fatty alcohol in the composition is odd chain fatty alcohol; The recombinant microbial cell of the invention 1001.
[Invention 1012]
The fatty acid derivative enzyme activity comprises a hydrocarbon biosynthetic activity and the recombinant microbial cell produces a hydrocarbon composition comprising even chain hydrocarbons, wherein at least 10% of the hydrocarbons in the composition are even chain hydrocarbons; The recombinant microbial cell of the invention 1001.
[Invention 1013]
A cell culture comprising the recombinant microbial cell of the invention 1001.
[Invention 1014]
A method for producing a fatty acid derivative composition comprising an odd-chain fatty acid derivative,
Obtaining a recombinant microbial cell of the invention 1001;
Recombinant under conditions effective to express a polynucleotide according to (a), (b) and (c) in a culture medium containing a carbon source and produce a fatty acid derivative composition comprising an odd chain fatty acid derivative Culturing microbial cells, wherein at least 10% of the fatty acid derivatives in the composition are odd chain fatty acid derivatives, and optionally recovering the odd chain fatty acid derivative composition from the culture medium;
Including methods.
[Invention 1015]
Recombinant microbial cells
(1) a polypeptide having thioesterase activity;
(2) a polypeptide having decarboxylase activity;
(3) a polypeptide having carboxylate reductase activity;
(4) a polypeptide having alcohol dehydrogenase activity (EC 1.1.1.1);
(5) a polypeptide having aldehyde decarbonylase activity (EC 4.1.19.5);
(6) a polypeptide having an acyl-CoA-reductase activity (EC 1.2.1.50);
(7) a polypeptide having acyl-ACP reductase activity;
(8) a polypeptide having an ester synthase activity (EC 3.1. 1.67);
(9) a polypeptide having OleA activity; and (10) a polypeptide having OleCD or OleBCD activity;
Expressing one or more polynucleotides encoding a polypeptide having a fatty acid derivative enzyme activity selected from the group consisting of:
Recombinant microbial cell is one of odd chain fatty acid, odd chain fatty ester, odd chain fatty aldehyde, odd chain fatty alcohol, even chain alkane, even chain alkene, even chain end olefin, even chain internal olefin or even chain ketone or The method of the present invention 1014, wherein a composition comprising a plurality is produced.
[Invention 1016]
A method of making a recombinant microbial cell that produces a higher titer or a higher proportion of odd chain fatty acid derivatives than that produced by a parent microbial cell, comprising:
Obtaining a parental microbial cell comprising a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate and a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity, and the same Manipulating the parental microbial cell to obtain a recombinant microbial cell that produces or is capable of producing a larger amount of propionyl-CoA than the amount of propionyl-CoA produced by the parental microbial cell when cultured under conditions Including,
Potency or percentage of odd-chain fatty acid derivatives produced by parental microbial cells cultured under the same conditions when the recombinant microbial cells are cultured under conditions effective to express the polynucleotide in the presence of a carbon source To produce higher titers or higher proportions of odd chain fatty acid derivatives.
[Invention 1017]
The process of manipulating the parent microbial cells
(A) a polypeptide having aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(B) a polypeptide having (R) -citramalate synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity; and (c) methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase A polypeptide having either activity or methylmalonyl-CoA carboxyltransferase activity and optionally methylmalonyl-CoA epimerase activity,
Engineering a parental microbial cell to express a polynucleotide encoding a polypeptide selected from the group consisting of:
At least one polypeptide according to (a), (b) or (c) is foreign to the parental microbial cell, or at least one polynucleotide according to (a), (b) or (c) The method of invention 1016, wherein the expression of is modulated in a recombinant microbial cell as compared to the expression of a polynucleotide in the parental microbial cell.
[Invention 1018]
A recombinant microbial cell has been engineered to express an exogenous polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, and β-ketoacyl-ACP synthase The method of 1016 of this invention wherein the expression of the endogenous polynucleotide encoding the polypeptide having activity is attenuated.
[Invention 1019]
A method for increasing the potency or proportion of odd-chain fatty acid derivatives produced by microbial cells, comprising:
Can obtain or produce a larger amount of propionyl-CoA than the amount of propionyl-CoA produced by the parental microbial cells when obtained under parental microbial cells producing fatty acid derivatives Manipulating parent microbial cells to obtain recombinant microbial cells;
When recombinant microbial cells are cultured under conditions effective to produce propionyl-CoA and fatty acid derivatives in the recombinant microbial cells in the presence of a carbon source, they are produced by parental microbial cells cultured under the same conditions. A method of producing a higher titer or ratio of odd chain fatty acid derivatives relative to the potency or ratio of odd chain fatty acid derivatives.
[Invention 1020]
Fatty acid derivative composition produced by the method of the present invention 1014.
These and other objects and features of the invention will become more fully apparent when the following detailed description is read in conjunction with the accompanying drawings.

FIGS. 1A and 1B compare examples of intermediates and products of the fatty acid biosynthetic pathway when supplied with different acyl-CoA “primer” molecules. FIG. 1A shows an example of a reaction pathway utilizing the two-carbon primer acetyl-CoA, which produces an even chain length β-ketoacyl-ACP intermediate acetoacetyl-ACP and even chain (ec)- Acyl-ACP intermediates and even chain fatty acid derivatives produced therefrom are derived. FIG. 1B shows a reaction pathway utilizing the 3-carbon primer propionyl-CoA, which generates an odd chain length β-ketoacyl-ACP intermediate 3-oxovaleryl-ACP and odd chain (oc) -acyl. -ACP intermediates and odd chain fatty acid derivatives produced therefrom are derived. FIG. 2 shows the production of propionyl-CoA via the intermediate α-ketobutyric acid by the threonine biosynthetic pathway (route (A)) and citramalic acid biosynthetic pathway (route (B)) as described herein. The example of the path | route for increase is shown. FIG. 3 shows an example of a pathway for increased production of propionyl-CoA via the methylmalonyl-CoA biosynthetic pathway (route (C)) as described herein.

  The particular compositions and methods described herein can of course vary, and the invention is not so limited. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention.

  Accession number: Throughout this description, the accession number is obtained from a database provided by NCBI (National Center for Biotechnology Information) maintained by the National Institutes of Health in the United States (herein referred to as “NCBI Accession Number” or “GenBank”). (Identified as “Accession Number”), from the UniProt Knowledge Database (UniProtKB) and Swiss-Prot Database provided by the Swiss Institute of Bioinformatics (identified herein as “UniProtKB Accession Number”). Unless specifically indicated otherwise, the sequence identified by the NCBI / GenBank accession number is version number 1 (ie, the version number of the sequence is “accession number 1”). The NCBI and UniProtKB accession numbers provided herein were current as of August 2, 2011.

  Enzyme Classification (EC) Number: The EC number is established by the International Biochemistry and Molecular Biology Union (IUBMB) nomenclature committee and its description is available on the IUBMB enzyme nomenclature website on the World Wide Web. EC numbers classify enzymes according to the reaction they catalyze. The EC numbers referenced herein are obtained from the KEGG ligand database maintained by Kyoto Encyclopedia of Genes and Genomics, partially supported by the University of Tokyo. Unless otherwise indicated, EC numbers are as provided in the KEGG database as of August 2, 2011.

  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred compositions and methods are now described.

Definitions As used herein, the term “fatty acid” refers to a carboxylic acid having the formula R— (C═O) —OH, wherein R is between about 4 and about 36 carbon atoms in length, More generally, it represents a carbon chain that may be between about 4 and about 22 carbon atoms in length. The fatty acid may be saturated or unsaturated. When unsaturated, R may have one or more points of unsaturation, i.e. R may be monounsaturated or polyunsaturated. R may be a straight chain (also referred to herein as a “linear chain”) or a branched chain. The term “fatty acid” may be used herein to refer to a “fatty acid derivative” that may include one or more different fatty acid derivatives or mixtures of fatty acid derivatives.

  As used herein, “odd chain fatty acid” (abbreviated “oc-FA”) refers to a fatty acid molecule having a linear carbon chain containing an odd number of carbon atoms, including the carbonyl carbon. Non-limiting examples of oc-FA include saturated oc-FAs tridecanoic acid (C13: 0), pentadecanoic acid (C15: 0) and heptadecanoic acid (C17: 0) and unsaturated (ie monounsaturated) oc -FA includes heptadecanoic acid (C17: 1).

  As used herein, the term “β-ketoacyl-ACP” refers to beta-ketoacyl-ACP synthase activity (eg, as represented by part (D) of the pathway shown in FIGS. 1A and 1B. Refers to the condensation product of an acyl-CoA primer molecule and malonyl-ACP catalyzed by an enzyme having EC 2.3.1.180). The acyl-CoA primer molecule may have an acyl group containing an even number of carbon atoms, such as acetyl-CoA shown in FIG. 1A, in which case the resulting β-ketoacyl-ACP intermediate is acetocetyl- ACP, which is an even chain (ec-) β-ketoacyl-ACP. The acyl-CoA primer molecule may have an acyl group containing an odd number of carbon atoms such as propionyl-CoA as depicted in FIG. 1B, in which case the resulting β-ketoacyl-ACP intermediate is 3-Oxovaleryl-ACP, which is an odd chain (oc-) β-ketoacyl-ACP. The β-ketoacyl-ACP intermediate enters the fatty acid synthase (FAS) cycle depicted in part (E) of FIGS. 1A and 1B and undergoes a round of elongation reactions (ie, keto reduction, dehydration and enoyl reduction) and acyl. Two carbon units are added to the chain, followed by further extension cycles, each cycle involving condensation with another malonyl-ACP molecule, keto reduction, dehydration and enoyl reduction, thus acyl-ACP. The acyl chain is extended by 2 carbon units per extension cycle.

  “Acyl-ACP” generally refers to the product of one or more FAS-catalyzed extensions of a β-ketoacyl-ACP intermediate. Acyl-ACP is an acyl thioester formed between the carbonyl carbon of the alkyl chain and the sulfhydryl group of the 4′-phosphopanthethionyl moiety of the acyl carrier protein (ACP), and in the case of a linear carbon chain, usually Having the formula CH3- (CH2) n-C (= O) -s-ACP, where n is an even number (e.g. "even chain acyl-ACP" or "ec-acyl-ACP", e.g. acetyl Generated when CoA is a primer molecule, see FIG. 1A) or odd (eg, “odd chain acyl-ACP” or “oc-acyl-ACP”, eg, generated when propionyl-CoA is a primer molecule , See FIG. 1B).

  Unless otherwise stated, a “fatty acid derivative” (abbreviated as “FA derivative”) is intended to include any product produced at least in part by the fatty acid biosynthetic pathway of recombinant microbial cells. Fatty acid derivatives also include any product made at least in part by a fatty acid pathway intermediate, such as an acyl-ACP intermediate. The fatty acid biosynthetic pathway described herein can include a fatty acid derivative enzyme that can be manipulated to produce a fatty acid derivative, and in some cases, for example, a carbon chain containing the desired number of carbon atoms. Expressing further enzymes to produce fatty acid derivatives with the desired carbon chain properties, such as compositions of fatty acid derivatives having a desired ratio of fatty acid derivatives having a desired ratio of derivatives containing odd numbers of carbon chains, etc. Can be made. Fatty acid derivatives include, but are not limited to, fatty acids, fatty aldehydes, fatty alcohols, fatty esters (such as waxes), hydrocarbons (such as alkanes and alkenes (including terminal and internal olefins)) and ketones.

  The term “odd chain fatty acid derivative” (abbreviated as “oc-FA derivative”) refers to the product of the reaction of oc-acyl-ACP with one or more fatty acid derivative enzymes, as defined above. Unless the fatty acid derivative itself is a product of decarbonylation or decarboxylation of an oc-FA derivative or oc-acyl-ACP, i.e. if the resulting oc-FA derivative has an even number of carbon atoms For example, a fatty acid derivative is produced by decarboxylation of ec-alkane or ec-alkene produced by decarbonylation of oc-fatty aldehyde, ec-terminal olefin produced by decarboxylation of oc-fatty acid, oc-acyl-ACP Unless the ec-ketone or ec-internal olefin is used, the fatty acid derivative product obtained in the same manner has a linear carbon chain containing an odd number of carbon atoms. Such even chain length products of oc-FA derivatives or oc-acyl-ACP precursor molecules have a linear chain containing an even number of carbon atoms but still fall within the definition of “oc-FA derivative” Should be understood as being considered.

  An “endogenous” polypeptide refers to a polypeptide encoded by the genome of a parent microbial cell (also referred to as a “host cell”) from which a recombinant cell has been engineered (or “obtained”).

  A “foreign” polypeptide refers to a polypeptide that is not encoded by the genome of the parental microbial cell. A variant (ie, mutant) polypeptide is an example of a foreign polypeptide.

  In embodiments of the invention in which the polynucleotide sequence encodes an endogenous polypeptide, in some cases the endogenous polypeptide is overexpressed. As used herein, “overexpression” refers to a polynucleotide or polypeptide in a cell at a higher concentration than would normally be produced in the corresponding parent cell (eg, wild type cell) under the same conditions. It means creating or causing creation. A polynucleotide or polypeptide when a polynucleotide or polypeptide is present at a higher concentration in a recombinant microbial cell compared to a concentration in a homologous non-recombinant microbial cell (eg, a parental microbial cell) under the same conditions Can be “overexpressed” in recombinant microbial cells. Overexpression can be achieved by any suitable means known in the art.

  In some embodiments, overexpression of endogenous polypeptides in recombinant microbial cells can be achieved through the use of exogenous regulatory elements. The term “exogenous regulatory element” generally refers to a regulatory element (eg, an expression control sequence or compound) that originates from outside the host cell. However, in certain embodiments, the term “exogenous regulatory element” (eg, “foreign promoter”) is replicated in its function to control expression of an endogenous polypeptide in a recombinant cell. Or it may refer to a regulatory element obtained from a host cell that has been deprived. For example, if the host cell is E. coli. In the case of E. coli cells, the polypeptide is an endogenous polypeptide, and the expression of the endogenous polypeptide in the recombinant cell is different from that of E. coli. It can be controlled by a promoter obtained from the E. coli gene. In some embodiments, the exogenous regulatory element that causes an increase in the level of expression and / or activity of the endogenous polypeptide is a compound such as a small molecule.

In some embodiments, the exogenous regulatory element that controls expression of a polynucleotide encoding an endogenous polypeptide (eg, an endogenous polynucleotide) manipulates the endogenous polynucleotide into the genome of the host cell by recombinant integration. An expression control sequence that can be linked. In certain embodiments, expression control sequences are integrated into the host cell chromosome by homologous recombination using methods known in the art (eg, Datsenko et al., Proc. Natl. Acad. Sci. U. SA, 97 (12):
6640-6645 (2000)).

  Expression control sequences are known in the art and include, for example, promoters, enhancers, polyadenylation signals, transcription terminators, ribosomal internal entry sites (IRES), and the like that provide for expression of polynucleotide sequences in host cells. Expression control sequences interact specifically with cellular proteins involved in transcription (Maniatis et al., Science 236: 1237-1245 (1987)). Examples of expression control sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif. (1990).

  In the methods of the invention, the expression control sequence is operably linked to the polynucleotide sequence. “Operably linked” refers to polynucleotide sequences and expression control in a manner that allows gene expression when an appropriate molecule (eg, a transcriptional activation protein) is attached to the expression control sequence (s). Means that array (s) are connected. An operably linked promoter is located upstream of the polynucleotide sequence selected in terms of the direction of transcription and translation. The operably linked enhancer can be located upstream, internal or downstream of the selected polynucleotide. Additional nucleic acid sequences, such as nucleic acid sequences encoding selectable markers, purification moieties, target proteins, and the like, can be operably linked to the polynucleotide sequence such that the additional nucleic acid sequence is expressed along with the polynucleotide sequence.

  In some embodiments, the polynucleotide sequence is provided to the recombinant cell by a recombinant vector comprising a promoter operably linked to the polynucleotide sequence. In certain embodiments, the promoter is a developmentally regulated, organelle-specific, tissue-specific, inducible, constitutive or cell-specific promoter.

  As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another linked nucleic acid, ie, a polynucleotide sequence. One useful vector is an episome (ie, a nucleic acid capable of extrachromosomal replication). Useful vectors are vectors that allow self-replication and / or expression of linked nucleic acids. A vector that can be targeted for expression of an operably linked gene is referred to herein as an “expression vector”. In general, expression vectors useful in recombinant DNA technology are often in the form of “plasmids” that usually refer to circular double stranded DNA loops that do not bind to the chromosome in vector form. In the present specification, the terms “plasmid” and “vector” are used interchangeably as the plasmid is the most commonly used form of vector. However, such other forms of expression vectors that perform equivalent functions and become known in the art in the future are also included.

  In some embodiments, the recombinant vector comprises (a) an expression control sequence operably linked to the polynucleotide sequence, (b) a selectable marker operably linked to the polynucleotide sequence, (c) to the polynucleotide sequence. An operably linked marker sequence, (d) a purified moiety operably linked to the polynucleotide sequence, (e) a secretory sequence operably linked to the polynucleotide sequence, and (f) an operably linked to the polynucleotide sequence. At least one sequence selected from the group consisting of selected target sequences.

  The expression vectors described herein comprise a polynucleotide sequence described herein in a form suitable for expression of the polynucleotide sequence in a host cell. One skilled in the art will appreciate that the design of the expression vector can depend on factors such as the choice of host cell to transform, the expression level of the desired polypeptide, and the like. The expression vectors described herein can be introduced into a host cell to produce a polypeptide comprising a fusion polypeptide encoded by the polynucleotide sequences described herein.

  Prokaryotic cells such as E. coli. Expression of a gene encoding a polypeptide in E. coli is often performed with a vector containing a constitutive or inducible promoter directed to the expression of either a fused or non-fused polypeptide. A fusion vector adds several amino acids to the polypeptide encoded in the vector, usually at the amino or carboxy terminus of the recombinant polypeptide. Such fusion vectors typically serve one or more of the following three purposes: (1) increased expression of the recombinant polypeptide, (2) increased solubility of the recombinant polypeptide, and (3) affinity. Assisting in the purification of recombinant polypeptides by acting as a ligand in purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant polypeptide. This allows the recombinant polypeptide to be separated from the fusion moiety after purification of the fusion polypeptide. Examples of such enzymes and cognate recognition sequences include factor Xa, thrombin and enterokinase. Examples of fusion expression vectors include pGEX (Pharmacia Biotech, Inc., Piscataway, NJ; Smith et al., Gene, 67: 31-40 (1988)), pMAL (New England Biolabs, BEVERP, BEVERP, and BEVERP) Pharmacia Biotech, Inc., Piscataway, NJ), each of which fuses a target recombinant polypeptide with glutathione S-transferase (GST), maltose E binding protein or protein A.

  Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or gene transfer techniques. As used herein, the terms “transformation” and “gene transfer” refer to exogenous nucleic acids (eg, including calcium phosphate or calcium chloride coprecipitation, gene transfer with DEAE dextran, lipofection or electroporation (eg, Refers to various art-recognized techniques for introducing DNA) into host cells. Suitable methods for transforming or transfecting host cells are described, for example, in Sambrook et al. (Above) can be found.

  For stable transformation of bacterial cells, depending on the expression vector and transformation technique used, it is known to remove only a small fraction of cells and replicate the expression vector. In order to identify and select these transformants, a gene encoding a selectable marker (eg, resistance to antibiotics) can be introduced into the host cells along with the gene of interest. Selectable markers include, but are not limited to, markers that confer resistance to drugs such as ampicillin, kanamycin, clamphenicol, or tetracycline. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding the polypeptides described herein or can be introduced on a separate vector. Host cells that are stably transformed with the introduced nucleic acid to yield recombinant cells can be identified by growth in the presence of an appropriate selection agent.

  Similarly, for stable gene transfer of mammalian cells, depending on the expression vector and gene transfer technique used, it is known that only a small fraction of cells can incorporate foreign DNA into its genome. In order to identify and select these integrants, a gene that encodes a selectable marker (eg, resistance to antibiotics) can be introduced into the host cells along with the gene of interest. Preferred selectable markers include markers that confer resistance to drugs such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding the polypeptides described herein or can be introduced on a separate vector. Host cells that are stably transfected with the introduced nucleic acid to yield recombinant cells can be identified by growth in the presence of an appropriate selection agent.

  As used herein, “gene knockout” refers to a procedure that modifies or inactivates a gene that encodes a target protein to reduce or eliminate the function of the intact protein. Inactivation of genes can be achieved by mutagenesis by UV irradiation or treatment with N-methyl-N′-nitro-N-nitrosoguanidine, site-directed mutagenesis, homologous recombination, insertion deletion mutations or “Red-drive” integration "(Datsenko et al., Proc. Natl. Acad. Sci. USA, 97: 6640-45, 2000). For example, in one embodiment, the construct is introduced into the parent cell so that homologous recombination events can be selected in the resulting recombinant cell. One skilled in the art can easily design knockout constructs containing both positive and negative selection genes to efficiently select transgenic (ie, recombinant) cells that have undergone homologous recombination events in the construct. I can do it. Changes in the parent cell can be obtained by replacing the wild-type (ie, endogenous) DNA sequence with the DNA sequence containing the change, eg, by single or double crossover recombination. For convenient selection of transformants (ie, recombinant cells), this change may be, for example, a DNA sequence encoding an antibiotic resistance marker or a gene that complements the host's potential auxotrophy. May be. Mutations include, but are not limited to, deletion insertion mutations. An example of such a change in a recombinant cell includes gene disruption, i.e. gene disruption, such that a product normally produced from a gene is not produced in a functional form. This can be done by complete deletions, selection marker deletions or insertions, selection marker insertions, frameshift mutations, in-frame deletions or point mutations that cause premature termination. In some cases, there is no total mRNA of the gene. In other situations, the amount of mRNA produced will vary.

  The expression “increased expression level of endogenous polypeptide” means to cause overexpression of a polynucleotide sequence encoding the endogenous polypeptide or to cause overexpression of an endogenous polypeptide sequence. The degree of overexpression is about 1.5 times or more, about 2 times or more, about 3 times or more, about 5 times or more, about 10 times or more, about 20 times or more, about 50 times or more, about 100 times or more or those An arbitrary range may be used.

  The expression “increasing the level of activity of an endogenous polypeptide” means enhancing the biochemical or biological function (eg, enzymatic activity) of the endogenous polypeptide. The degree of activity enhancement is about 10% or more, about 20% or more, about 50% or more, about 75% or more, about 100% or more, about 200% or more, about 500% or more, about 1000% or more, or any of them It may be a range.

  The expression “expression of said polynucleotide sequence is altered relative to the wild-type polynucleotide sequence” as used herein means an increase in the level of expression and / or activity of the endogenous polynucleotide sequence or Means decrease. In some embodiments, the exogenous regulatory element that controls the expression of the endogenous polynucleotide is an expression control sequence that is operably linked to the genome of the host cell by recombinant integration. In some embodiments, expression control sequences are integrated into the host cell chromosome by homologous recombination using methods known in the art.

  As used herein, the expression “under conditions effective to express the polynucleotide sequence (s)” is any that allows a recombinant cell to produce the desired fatty acid derivative. Means the condition. Suitable conditions include, for example, fermentation conditions. Fermentation conditions can include many parameters such as temperature range, aeration level and medium composition. Each of these conditions, individually and in combination, allows for host cell growth. Examples of culture media include broth or gel. In general, the medium includes a carbon source that can be directly metabolized by the recombinant cells. Fermentation means the use of a carbon source by a production host such as the recombinant microbial cell of the present invention. Fermentation may be aerobic, anaerobic or variants thereof (such as microaerobic). As will be appreciated by those skilled in the art, the recombinant microbial cell may have a carbon source of oc-acyl-ACP or a desired oc-FA derivative (eg, oc-fatty acid, oc-fatty ester, oc-fatty aldehyde, oc-fatty alcohol). , Ec-alkanes, ec-alkenes or ec-ketones) will vary in part based on the particular microorganism. In some embodiments, this process occurs in an aerobic environment. In some embodiments, this process occurs in an anaerobic environment. In some embodiments, this process occurs in a microaerobic environment.

As used herein, the term “carbon source” refers to a substrate or compound suitable for use as a source of carbon for the growth of prokaryotic or simple eukaryotic cells. Carbon sources include, but are not limited to polymers, carbohydrates (eg, saccharides such as monosaccharides, disaccharides, oligosaccharides and polysaccharides), acids, alcohols, aldehydes, ketones, amino acids, peptides and gases (eg, CO and CO _It may be in various forms including ₂ ). Examples of carbon sources include, but are not limited to, monosaccharides such as glucose, fructose, mannose, galactose, xylose and arabinose, disaccharides such as sucrose, maltose, cellobiose and turanose, oligosaccharides such as fructo-oligosaccharide and galacto-oligosaccharide, Polysaccharides such as starch, cellulose, pectin and xylan, cellulose materials and variants such as hemicellulose, methylcellulose and sodium carboxymethylcellulose, saturated or unsaturated fatty acids, alcohols such as succinic acid, lactic acid and acetic acid, ethanol, methanol and glycerol or those A mixture of The carbon source may be a product of photosynthesis such as glucose. In certain preferred embodiments, the carbon source is derived from biomass. In another preferred embodiment, the carbon source includes sucrose. In another preferred embodiment, the carbon source includes glucose.

  As used herein, the term “biomass” refers to any biological material from which a carbon source is obtained. In some embodiments, the biomass is processed into a carbon source suitable for bioconversion. In other embodiments, the biomass need not be further processed into a carbon source. The carbon source can be converted to biofuel. Examples of biomass sources are plant matter or vegetation such as corn, sugar cane or American sugar cane. Another example of a biomass source is metabolic waste such as animal matter (eg, cow manure). Further examples of biomass sources include algae and other marine plants. Biomass also includes, but is not limited to, waste from industry, agriculture, forestry and household, including fermentation waste, ensilage, straw, wood, sewage, garbage, cellulosic urban waste and leftover food. The term “biomass” also refers to a carbon source, such as a carbohydrate (eg, a monosaccharide, disaccharide or polysaccharide).

  In order to determine whether the conditions are sufficient to allow product production or polypeptide expression, recombinant microbial cells can be expressed, for example, at about 4, 8, 12, 24, 36, 48, 72 You may incubate for time or more. During and / or after culture, a sample can be taken and analyzed to determine if the conditions allow production or expression. For example, the presence of a desired product of recombinant microbial cells in a sample or medium in which the recombinant microbial cells are grown can be tested. When testing for the presence of a desired product, such as, but not limited to, an odd chain fatty acid derivative (eg, oc-fatty acid, oc-fatty ester, oc-fatty aldehyde, oc-fatty alcohol or ec-hydrocarbon) Chromatography (GC), mass spectrometry (MS), thin layer chromatography (TLC), high performance liquid chromatography (HPLC), liquid chromatography (LC), GC with flame ionization detector (GC-FID), GC- Assays such as MS and LC-MS can be used. When testing polypeptide expression, techniques such as, but not limited to, Western blots and dot blots may be used.

  As used herein, the term “microorganism” means prokaryotic and eukaryotic microbial species of archaeal, bacterial and eukaryotic domains, including the yeast and filamentous fungi, protozoa, algae and Higher protozoa are included. “Microbe” and “microbial cell” (ie, microbial cell) are used interchangeably with “microorganism” and refer to a cell or small organism that can only be viewed using a microscope. .

  In some embodiments, the host cell (eg, parent cell) is a microbial cell. In some embodiments, the host cell is Escherichia, Bacillus, Lactobacillus, Pantoea, Zymomonas, Rhodococulus, Pseudomus sp. (Trichoderma), Neurospora, Fusarium, Humicola, Rhizomucor, Kryveromyces, Pichia, Micole, icillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces, Stenotrosonas Microbial cells selected from the genera Streptomyces, Synechococcus, Chlorella or Prototheca.

In other embodiments, the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus lichenifolis cell, or a Bacillus lichenifolis cell. Bacillus alkalophilus cells, Bacillus coagulans cells, Bacillus circulans cells, Bacillus pumilis cells, genus Bacillus pulis sill , Bacillus clausii (Bacillus
clausii cells, Bacillus megaterium cells, Bacillus subtilis cells or Bacillus amyloliquefaciens cells.

  In other embodiments, the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma reegi Aspergillus awamori cells, Aspergillus fumigatus cells, Aspergillus fetidus cells, Aspergillus nidulans (Aspergillus sp.) gills niger cells, Aspergillus oryzae cells, Humicola insolens cells, Humicola lanocinho cells Mucor michei cells.

  In still other embodiments, the host cell is a Streptomyces lividans cell or a Streptomyces murinus cell.

  In yet other embodiments, the host cell is an Actinomyces cell.

  In some embodiments, the host cell is a Saccharomyces cerevisiae cell.

  In still other embodiments, the host cell is a CHO cell, COS cell, VERO cell, BHK cell, HeLa cell, Cvl cell, MDCK cell, 293 cell, 3T3 cell or PC12 cell.

  In some embodiments, the host cell is a eukaryotic plant, algae, cyanobacteria, green sulfur bacterium, green non-sulfur bacterium, red sulfur bacterium, red non-sulfur bacterium, extreme bacterium, yeast, fungus, manipulation thereof Cell of a living organism or a synthetic organism. In some embodiments, the host cell is light dependent or fixes carbon. In some embodiments, the host cell has autotrophic activity. In some embodiments, the host cell has photoautotrophic activity, such as in the presence of light. In some embodiments, the host cell is heterotrophic or mixed vegetative in the absence of light.

  In certain embodiments, the host cell is an Arabidopsis thaliana, Panicum virgatum, Miscanthus gigantesus, Zea maitus cc, braunii), Chlamydomonas reinhardtii, Donariena salina (Dunaliela salina), Synechococcus sp. PCC7002, Synecococcus sp. ococcus elongates) BP-1, Chlorobium tepidum, Chloroflexus aurticus, Chromatium bursum, Chromatium bursum Rhodopseudomonas palusris, Clostridium ljungdahlii, Clostridium thermocellum, Peni Pichia pastoris (Pichia pastoris), Saccharomyces cerevisiae, Schizosaccharomyces pombe (Schizosaccharomyces pombe), Pseudomonas fluorescens (Pseia pastures) It is a cell of Zymomonas mobilis. In certain embodiments, the host cell can be Chlorella fusca, Chlorella protothecoides, Chlorella pyrenoidosa, Chlorella kesleri, Chlorella Chlorella vulgaris), Chlorella saccharophila, Chlorella sorokiniana, Chlorella eliposider, Proto-c prototeca Prototheca portoricensis), Prototheca moriformis (Prototheca moriformis), which is a cell of Prototheca Wikkahamii (Prototheca wickerhamii) or Prototheca Sophie (Prototheca zopfii).

  In some embodiments, the host cell is a bacterial cell. In some embodiments, the host cell is a Gram positive bacterial cell. In some embodiments, the host cell is a Gram negative bacterial cell.

  In some embodiments, the host cell is E. coli. It is a coli cell. In some embodiments, E.I. The E. coli cells are B, C, K or W strains E. coli. It is a coli cell.

  In certain embodiments of the invention, the host cell has been engineered to express (or overexpress) the transport protein. Transport proteins can carry polypeptides and organic compounds (eg, fatty acids or their derivatives) out of the host cell.

  As used herein, the term “metabolically engineered” or “metabolic engineered” refers to oc-β-in recombinant cells such as, for example, recombinant microbial cells as described herein. Rational pathway design to produce desired metabolites such as ketoacyl-ACP, oc-acyl-ACP or oc-fatty acid derivatives and polynucleotides corresponding to biosynthetic genes, genes associated with operons and such poly Includes assembly of nucleotide control elements. “Metabolic engineering” further regulates transcription, translation, protein stability and protein function using genetic manipulation and appropriate culture conditions, including reduction, disruption or knockout of competing metabolic pathways that compete with intermediates that lead to the desired pathway And optimization of metabolic flow by optimization. A “biosynthetic gene” may be endogenous (natural) to the host cell (ie, a gene that has not been modified from the host cell) or it may be foreign to the host cell or suddenly in a recombinant cell It may be foreign (heterologous) to the host cell by being modified by mutagenesis, recombination and / or by association with foreign (heterologous) expression control sequences. A biosynthetic gene encodes a “biosynthetic polypeptide” or “biosynthetic enzyme”.

  The term “biosynthetic pathway”, also called “metabolic pathway”, refers to a series of biochemical reactions catalyzed by a biosynthetic enzyme that converts one species to another. As used herein, the term “fatty acid biosynthetic pathway” (or more simply “fatty acid pathway”) refers to fatty acid derivatives (eg, fatty acids, fatty esters, fatty aldehydes, fatty alcohols, alkanes, alkenes). , Ketone, etc.). The fatty acid pathway can be engineered to produce fatty acid derivatives as described herein, and in some embodiments, additional enzymes to produce fatty acid derivatives having the desired carbon chain properties. Fatty acid pathway biosynthetic enzymes (ie, “fatty acid pathway enzymes”) that can be expressed together with are included. For example, the “odd chain fatty acid biosynthetic pathway” described herein (ie, the “oc-FA pathway”) includes sufficient enzymes to produce oc-fatty acid derivatives.

  The term “recombinant microbial cell” refers to the introduction of genetic material into a selected “parental microbial cell” (ie, a host cell), thereby altering or altering the cellular physiology and biochemical functions of the parental microbial cell. Refers to a genetically modified (ie, engineered) microbial cell (ie, a microorganism). With the introduction of genetic material, recombinant microbial cells have new or improved properties compared to the parent microbial cells, such as the ability to produce new or existing intracellular metabolites in greater quantities To win. Recombinant microbial cells provided herein can include, for example, a plurality of biosynthetic enzymes involved in the pathway for generating oc-acyl-ACP intermediates or oc-fatty acid derivatives from a suitable carbon source (eg, oc- Expresses fatty acid pathway enzymes such as FA pathway enzymes). The genetic material introduced into the parental microbial cell is the gene (s) or genes of one or more enzymes that are involved in the biosynthetic pathway (ie, biosynthetic enzymes) for the production of oc-fatty acid derivatives. Alternatively, or in addition, it may contain further elements for the expression and / or regulation of expression of genes encoding such biosynthetic enzymes, such as promoter sequences. Accordingly, the recombinant microbial cells described herein are genetically engineered to express or overexpress biosynthetic enzymes involved in the oc-fatty acid (oc-FA) biosynthetic pathway described herein. ing.

  It should be understood that the terms “recombinant microbial cell” and “recombinant microorganism” refer not only to a specific recombinant microbial cell / microorganism, but also to the progeny or potential progeny of such a cell.

  Recombinant microbial cells, instead of, or in addition to containing genetic material introduced into parental microbial cells, reduce genes or polynucleotides that alter the cellular physiological and biochemical functions of the parental microbial cells. , Disruptions, deletions or “knockouts”. Even with a reduction, disruption, deletion or “knockout” of a gene or polynucleotide (also known as “attenuation” of a gene or polynucleotide), the recombinant microbial cell is new compared to the parent microbial cell. Reduced or improved properties (eg, ability to generate new or higher amounts of intracellular metabolites, ability to improve metabolite flow through desired pathways, and / or generation of unwanted by-products Abilities).

Manipulation of recombinant microbial cells to produce odd-chain fatty acid derivatives Many microbial cells usually produce linear fatty acids in which the linear aliphatic chain contains mainly even-numbered carbon atoms, with odd-numbered carbon atoms The amount of fatty acid having a linear aliphatic chain contained is generally relatively small. E. The amount of linear odd-chain fatty acid (oc-FA) and other linear odd-chain fatty acid derivatives (oc-FA derivatives) produced by such microbial cells such as E. coli may be relatively small in some cases. May be due to low levels of propionyl-CoA present in such cells. Such cells primarily utilize acetyl-CoA as a primer molecule for fatty acid biosynthesis to yield the majority of fatty acids, and other fatty acid derivatives produced by such cells are linear even chain fatty acids (ec -FA) and other linear even chain fatty acid derivatives (ec-FA derivatives).

  The present invention relates to oc-FA in which an engineered microorganism is produced by a parental microorganism by manipulating the microorganism to produce an increased amount of propionyl-CoA compared to the propionyl-CoA produced by the parental microorganism. A higher proportion of oc-FA derivative is produced in comparison with the amount of oc-FA derivative in the fatty acid derivative composition produced by a higher amount (titer) of oc-FA derivative compared to the amount of derivative and / or produced by the parent microorganism. Based in part on the discovery of producing a fatty acid derivative composition having an FA derivative.

  The ultimate goal is to realize an environmentally reliable and cost-effective method for producing fatty acid derivatives, including oc-FA derivatives, initiated from carbon sources on an industrial scale (eg carbohydrates or biomass) Therefore, by improving the yield of oc-FA derivative molecules produced by microorganisms and / or optimizing the composition of fatty acid derivative molecules produced by microorganisms (such as by increasing the ratio of odd chain products to even chain products) ) Is desired. Therefore, strategies to overproduce various pathway intermediates were investigated to increase metabolic flux through pathways leading to odd-chain fatty acid production. Pathways that aim for metabolic flow from starting materials such as sugars to propionyl-CoA, through odd-chain acyl-ACP (oc-acyl-ACP) intermediates, and to oc-FA derivative products, are useful in industrially useful microorganisms. Can be operated.

  In one aspect, the invention involves propionyl-CoA biosynthesis and / or oc when the recombinant microbial cell is cultured in the presence of a carbon source under conditions effective to express the polynucleotide. A recombinant microbial cell comprising one or more polynucleotides encoding a polypeptide having an enzymatic activity involved in the biosynthesis of an acyl-ACP intermediate (eg, an enzyme). In some embodiments, the recombinant microbial cells further comprise one or more polynucleotides that each encode a polypeptide having fatty acid derivative enzyme activity, wherein the recombinant microbial cells are polyvalent in the presence of a carbon source. When cultured under conditions sufficient to express nucleotides, odd-chain fatty acid derivatives are produced. The invention also includes a method of making a composition comprising an odd chain length fatty acid derivative comprising culturing a recombinant microbial cell of the invention. The present invention also includes methods for increasing the amount of propionyl-CoA produced by microbial cells and methods for increasing the amount or proportion of odd chain fatty acid derivatives produced by microbial cells and other properties apparent from further investigation. .

  The recombinant microbial cell may be a prokaryotic cell (eg, E. coli or Bacillus species) such as filamentous fungi, algae, yeast or bacteria.

  In general, odd chain fatty acid derivatives [including odd chain fatty acids, odd chain fatty esters (including odd chain fatty acid methyl esters (oc-FAME), odd chain fatty acid ethyl esters (oc-FAEE) and odd chain wax esters), odd chains Even chain hydrocarbons such as even chain alkanes, even chain alkenes, even chain terminal olefins, even chain internal olefins and even chain ketones by decarbonylation or decarboxylation of fatty aldehydes, odd chain fatty alcohols and odd chain precursors] Can be produced in the recombinant microbial cells of the invention via the odd-chain fatty acid biosynthetic pathway shown in FIG. 1B (“oc-FA pathway”).

  To produce odd chain fatty acid derivatives, recombinant microbial cells utilize propionyl-CoA as a “primer” to initiate the fatty acyl chain extension process. As shown in FIG. 1B, the fatty acyl extension process begins with the first odd-chain β-ketoacyl-ACP intermediate (eg, 3-oxovaleryl-ACP) as shown in step (D) of FIG. 1B. Requires the condensation of an odd chain primer molecule propionyl-CoA and malonyl-ACP molecule catalyzed by an enzyme having β-ketoacyl ACP synthase activity (eg, β-ketoacyl ACP synthase III enzyme). To do. The odd chain β-ketoacyl-ACP intermediate undergoes keto reduction, dehydration and enoyl reduction at the β carbon by the fatty acid synthase (FAS) complex to form the first odd chain acyl-ACP intermediate, As shown in step (E) of 1B, condensation with malonyl-ACP, keto reduction, dehydration to form an acyl-ACP intermediate with increased odd carbon chain length (“oc-acyl-ACP”) And undergo additional cycles of eionyl reduction to add 2 carbon units per cycle. The oc-acyl-ACP intermediate reacts with one or more fatty acid derivative enzymes to produce odd chain fatty acid derivative (oc-FA derivative) products, as shown in step (F) of FIG. 1B. This is in contrast to processes in cells that produce relatively low levels of propionyl-CoA, such as wild type E. coli cells. Such cells mainly produce linear fatty acids having an even number of carbon atoms, and the amount of linear fatty acids having an odd number of carbon atoms is low or trace. As shown in FIG. 1A, the even chain primer molecule acetyl-CoA is first prepared with an even chain β-ketoacyl-ACP intermediate (eg, acetoacetyl-ACP) as shown in step (D) of FIG. 1A. To form an acyl-ACP intermediate with increased even carbon chain length (“ec-acyl-ACP”), as shown in step (E) of FIG. 1A. In order to do so, it undergoes a FAS-catalyzed cycle of keto reduction, dehydration, eionyl reduction and condensation with further malonyl-ACP molecules, similarly adding two carbon units per cycle. The ec-acyl-ACP intermediate reacts with one or more fatty acid derivative enzymes to produce even chain fatty acid derivatives, as shown in step (F) of FIG. 1A.

  Propionyl-CoA “primer” molecules can be supplied to the oc-FA biosynthetic pathway of the recombinant microbial cells of the present invention by several methods. Methods for increasing the production of propionyl-CoA in microbial cells include, but are not limited to:

  Propionyl-CoA can be produced by the natural biosynthetic machinery of the parent microbial cell (eg, by an enzyme that is endogenous to the parent microbial cell). If it is desired to increase the amount of propionyl-CoA produced in the parental microbial cell, one or more enzymes endogenous to the parental microbial cell that contribute to the production of propionyl-CoA are excessed in the recombinant microbial cell. Can be expressed.

  Propionyl-CoA overexpresses endogenous enzymes that alter the course of metabolic flow through the intermediate α-ketobutyrate and / or manipulates cells to express foreign enzymes, as shown in FIG. Can be generated by Non-limiting examples of enzymes for use in such pathway manipulation are listed in Tables 1 and 2 below.

  Propionyl-CoA, as shown in FIG. 3, overexpresses an endogenous enzyme that changes the course of metabolic flow from succinyl-CoA through the intermediate methylmalonyl-CoA and / or expresses an exogenous enzyme. Can be produced by manipulating cells. Examples of non-limiting enzymes for use in manipulation of such pathways are listed in Table 3 below.

  In an example approach, propionyl-CoA overexpresses an endogenous enzyme that alters the course of metabolic flow from malonyl-CoA through the intermediate malonic acid semialdehyde and 3-hydroxypropionic acid and / or expresses an exogenous enzyme Can be generated by manipulating the cells. Non-limiting examples of enzymes for use in manipulation of such pathways are listed, for example, in US Patent Application Publication No. US20110101068A1.

  In another approach, propionyl-CoA overexpresses an endogenous enzyme that alters the pathway of metabolic flow from D-lactate through the intermediate lactoyl-CoA and acryloyl-CoA and / or expresses an exogenous enzyme. Can be produced by manipulating cells. Non-limiting examples of enzymes for use in manipulation of such pathways are listed, for example, in US Patent Application Publication No. US20110101068A1.

  As mentioned above, the initiation of the odd chain extension process requires condensation of propionyl-CoA and malonyl-ACP molecules to form an oc-β-ketoacyl-ACP intermediate. As shown in part (D) of FIG. 1B, this step is performed in a recombinant microbial cell using β-ketoacyl-ACP synthase activity, preferably β-ketoacyl-ACP synthase III, which uses propionyl-CoA as a substrate. Catalyzed by an active enzyme (eg, EC 2.3.1.180). The enzyme may be endogenous to the recombinant microbial cell or exogenous to the recombinant microbial cell.

  In one embodiment, a polynucleotide encoding a polypeptide endogenous to a parental microbial cell having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate is expressed in recombinant microbial cells or in excess. To express. In another embodiment, a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate that is foreign to the parent microbial cell is expressed in the recombinant microbial cell. To do.

  The oc-β-ketoacyl-ACP intermediate produced in step (D) of the oc-FA pathway (FIG. 1B) is a beta catalyzed by, for example, a fatty acid synthase (FAS) complex such as a type II FAS complex. The oc-acyl-ACP intermediate represented by step (E) of FIG. 1B can be subjected to elongation by successive cycles of keto reduction at carbon, dehydration and enoyl reduction, further condensation with malonyl-ACP molecules. Two carbon units are added to the long odd carbon chain of the body. In one embodiment, the endogenous FAS complex native to the recombinant microbial cell catalyzes the condensation / keto reduction / dehydration / enoyl reduction cycle with malonyl-ACP to produce an oc-acyl-ACP intermediate. .

  Odd-chain fatty acid derivatives (oc-fatty acids, oc-fatty esters, oc-fatty aldehydes, oc-fatty alcohols, ec-ketones and ec-hydrocarbons) are oc-acyl-ACP intermediates as described in detail below. Can be generated from the body. Thus, in some embodiments, the recombinant microbial cell further comprises one or more polynucleotide sequences, eg, thioesterase (eg, TesA), decarboxylase, carvone, each encoding a peptide having fatty acid derivative enzyme activity. Acid reductase (CAR such as CarA, CarB or FadD9), alcohol dehydrogenase / aldehyde reductase, aldehyde decarbonylase (ADC), fatty alcohol forming acyl-CoA reductase (FAR), acyl ACP reductase (AAR), ester synthesis A recombinant microbial cell comprising an enzyme, acyl-CoA reductase (ACR1), OleA, OleCD, or OleBCD, is cultured under conditions effective to express the polynucleotide in the presence of a carbon source. Sometimes microbial cells are oc-fatty acids, oc-fatty esters (oc-fatty acid methyl esters, oc-fatty acid ethyl esters, oc-wax esters, etc.) oc-fatty aldehydes, oc-fatty alcohols, ec-ketones or ec-carbonized. A composition comprising hydrogen (such as ec-alkane, ec-alkene, ec-terminal olefin or ec-internal olefin) is produced. The present invention also includes a method for producing an oc-fatty acid derivative comprising culturing the recombinant microbial cell of the present invention.

Manipulating microbial cells to produce increased amounts of propionyl-CoA In one aspect, the present invention includes a method for increasing the amount of odd chain fatty acid derivatives produced by microbial cells, wherein increased amounts of propionyl are included. -Manipulating the parent microbial cell to produce CoA. Manipulation of parental microbial cells to produce increased amounts of propionyl-CoA include, for example, (a) a polypeptide having aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity (B) a polypeptide having (R) -citramalic acid synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity, or (c) a polypeptide having methylmalonyl-CoA mutase activity and methyl One or more polypeptides having malonyl-CoA decarboxylase activity and methylmalonyl carboxyltransferase activity, and a polynucleotide encoding a polypeptide having methylmalonyl epimerase activity as appropriate Can be achieved by manipulating the cell to express the leotide, wherein the at least one polypeptide is foreign to the recombinant microbial cell or the expression of the at least one polynucleotide is the parental microbial cell Is modulated in the recombinant microbial cell relative to the expression of the polynucleotide in the recombinant microbial cell when cultured under conditions effective to express the polynucleotide in the presence of a carbon source. Produce more propionyl-CoA than the amount of propionyl-CoA produced by the parent microbial cells cultured below.

  In some embodiments, the at least one polypeptide encoded by the polynucleotide according to (a) is an exogenous polypeptide (eg, a polypeptide originating from an organism other than the parent microbial cell or native to the parent microbial cell). Variant of polypeptide). In some cases, the at least one polypeptide encoded by the polynucleotide according to (a) is an endogenous polypeptide (ie, a polypeptide that is native to the parent microbial cell), and the endogenous polypeptide is in a recombinant microbial cell. Overexpressed.

  In some embodiments, at least one polypeptide encoded by the polynucleotide according to (b) is an exogenous polypeptide. Optionally, at least one polypeptide encoded by the polynucleotide according to (b) is an endogenous polypeptide, and the endogenous polypeptide is overexpressed in the recombinant microbial cell.

  In some embodiments, the recombinant microbial cell comprises one or more polynucleotides according to (a) and one or more polynucleotides according to (b). Optionally, at least one polypeptide encoded by the polynucleotide according to (a) or (b) is an exogenous polypeptide. Optionally, at least one polypeptide encoded by the polynucleotide according to (a) or (b) is an endogenous polypeptide, and the endogenous polypeptide is overexpressed in the recombinant microbial cell.

  In some embodiments, at least one polypeptide encoded by the polynucleotide according to (c) is a foreign polypeptide. Optionally, the at least one polypeptide encoded by the polynucleotide according to (c) is an endogenous polypeptide, and the endogenous polypeptide is overexpressed in the recombinant microbial cell.

  By manipulating the parent microbial cell to obtain a recombinant microbial cell with increased metabolic flux through propionyl-CoA compared to the parent (eg, non-engineered) microbial cell, the engineered microbial cell is Of the oc-FA derivative in the fatty acid derivative composition that produces a greater amount (titer) of the oc-FA derivative and / or produced by the parental microbial cell compared to the amount of oc-FA derivative produced by To produce a fatty acid derivative composition having a higher proportion of oc-FA derivatives.

  Thus, in another aspect, the present invention provides a method for increasing the amount or proportion of odd chain fatty acid derivatives produced by microbial cells, comprising propionyl-CoA produced by parental microbial cells cultured under the same conditions. Manipulating the parent microbial cell to obtain a recombinant microbial cell that produces, or is capable of producing, a larger amount of propionyl-CoA relative to the amount, When cultured under the same conditions, each effective in increasing the level of propionyl-CoA in the recombinant microbial cell compared to the parent microbial cell, in the presence of a carbon source, the culture of the recombinant microbial cell is A higher or higher proportion of odd-chain fatty acids relative to the amount or proportion of odd-chain fatty acid derivatives produced by the cells It includes a method for generating conductor. In some embodiments, the recombinant microbial cell comprises a polynucleotide encoding a polypeptide according to one or more of pathways (a), (b) and (c) as described in more detail below, and at least One encoded polypeptide is foreign to the recombinant microbial cell, or the expression of at least one polynucleotide is modulated in the recombinant microbial cell compared to the expression of the polynucleotide in the parental microbial cell. ing. In some embodiments, the recombinant microbial cell comprises at least one polypeptide encoding a polypeptide having fatty acid derivative enzyme activity. In some embodiments, the recombinant microbial cell comprises a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity that utilizes propionyl-CoA as a substrate.

  Examples of metabolic pathways useful for increasing propionyl-CoA production in recombinant microbial cells are described below. Examples of these pathways for increasing propionyl-CoA production in recombinant cells do not limit the scope of the invention, but increase propionyl-CoA production in cells and / or add propionyl-CoA intermediates. It should be understood that any suitable metabolic pathway that increases metabolic flow in the passing cell is suitable for use in the recombinant microbial cells, compositions and methods of the present invention. Metabolic pathways that increase propionyl-CoA production and / or increase metabolic flux through the propionyl-CoA intermediate are therefore suitable for use in the recombinant microbial cells, compositions and methods of the present invention.

Production of propionyl-CoA via α-ketobutyric acid intermediates Manipulation of various amino acid biosynthetic pathways has been shown to increase the production of these various amino acids in microbial cells (Guilleuet S., et al. Environ.Microbiol.65: 3100-3107 (1999); Lee K.H., et al., Mol. Syst. Biol.
3: 149 (2007)). The amino acid biosynthetic pathway is It has been used in the production of short-chain branched alcohols in E. coli (Atsumi S. and Liao JC, Appl. Environ. Microbiol. 74 (24): 7802-7808 (2008); Can A.F. and Liao J. C., Appl Microbiol Biotechnol.81 (1): 89-98 (2008); Zhang K., et al., Proc. Natl. Acad. Sci. USA 105 (52): 20653-20658 (2008). ).

  The course of the flow of certain amino acid biosynthetic metabolites is also known as the intermediate α-ketobutyric acid (also known as alpha-ketobutyric acid, 2-ketobutyric acid, 2-ketobutanoate, 2-oxobutyric acid and 2-oxobutanoate) Is directed to the production of propionyl-CoA. Thus, in one embodiment, the present invention provides that when a recombinant microbial cell is cultured under conditions sufficient to express a polynucleotide in the presence of a carbon source, from a carbon source (eg, a carbohydrate such as a sugar). Recombinant microbial cells comprising a polynucleotide encoding one or more enzymes involved in conversion to α-ketobutyric acid (ie, “oc-FA pathway enzymes”) are included. The α-ketobutyric acid molecule is an intermediate in the microbial production of propionyl-CoA that serves as a primer in the production of linear odd-chain fatty acid derivatives via the oc-FA pathway (FIG. 1B).

The pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of α-ketobutyric acid to produce propionyl-CoA in bacteria (Danchin, A. et al.
et al. , Mol. Gen. Genet. 193: 473-478 (1984); Bisswanger, H .; , J. et al. Biol. Chem. 256: 815-822 (1981)). The pyruvate dehydrogenase complex is a multi-enzyme complex containing three types of activities: pyruvate decarboxylase (E1), dihydrolipoyl transacetylase (E2) and dihydrolipoyl dehydrogenase (E3). . There are other suitable keto acid dehydrogenase complexes that use similar catalytic modalities that utilize α-keto acid substrates other than pyruvate. The TCA cycle α-ketoglutarate dehydrogenase complex is an example. In one embodiment, a pyruvate dehydrogenase complex that is endogenous to the host cell (ie, a pyruvate dehydrogenase complex that is native to the parent cell) catalyzes the conversion of α-ketobutyrate to propionyl-CoA. Used for. In other embodiments, the gene encoding one or more PDC complex polypeptides having pyruvate decarboxylase, dihydrolipoyl transacetylase and / or dihydrolipoyl dehydrogenase activity is expressed in a recombinant microbial cell. Overexpressed. Other enzymes or enzyme complexes that catalyze the conversion of α-ketobutyric acid to propionyl-CoA are expressed or overexpressed in recombinant microbial cells to further increase the metabolic flux from α-ketobutyric acid to propionyl-CoA can do.

Conversion of α-ketobutyric acid to propionyl-CoA can also be achieved by conversion of α-ketobutyric acid to propionic acid and activation of propionic acid to propionyl-CoA. The conversion of α-ketobutyric acid to propionic acid is the E. coli encoded by the poxB gene. It can be catalyzed by pyruvate oxidase (EC 1.2.3.3) such as colipyruvate oxidase (Grabau and Cronan, Nucleic Acids Res. 14 (13): 5449-5460 (1986)). Natural E. coli Coli PoxB enzyme reacts with α-ketobutyrate and pyruvate and is selective for pyruvate, but Chang and Cronan (Biochem J. 352: 717-724 (2000)) is directed against α-ketobutyrate. A PoxB mutant enzyme has been described that retains full activity and has reduced activity against pyruvate. Activation of propionic acid to propionyl-CoA can be catalyzed by acyl-CoA synthases such as acetyl-CoA synthase (Doi et al., J. Chem).
Soc. 23: 1696 (1986)). Yeast acetyl-CoA synthase has been shown to catalyze the activation of propionic acid to propionyl-CoA (Patel).
and Walt, J.A. Biol. Chem. 262: 7132 (1987)). Propionic acid can also be activated to propionyl-CoA by the action of acetate kinase (ackA) and phosphotransacetylase (pta).

  One or more enzymes that are endogenous to the parent microbial cell may compete with the substrate of an engineered oc-FA biosynthetic pathway in the recombinant microbial cell, or an intermediate (eg, α The genes encoding such undesirable endogenous enzymes may be odd-chain fatty acid derivatives by recombinant microbial cells, which may degrade -ketobutyric acid) or otherwise divert from the oc-FA biosynthetic pathway. Can be attenuated to increase production. For example, E.I. In E. coli, endogenous acetohydroxyacid synthases such as AHAS I (eg, encoded by the ilvBN gene), AHAS II (eg, encoded by the ilvGM gene) and AHAS III (eg, encoded by the ilvIH gene) The (AHAS) complex catalyzes the conversion of α-ketobutyric acid to α-aceto-α-hydroxybutyric acid, thus changing the course of metabolic flow from propionyl-CoA and reducing oc-FA production. is there. Thus, by depriving or otherwise reducing the expression of one or more endogenous AHAS genes, biosynthesis in recombinant microbial cells is more directed to propionyl-CoA, and ultimately more odd chain fatty acids. Can be generated. Other endogenous enzymes that can compete with the oc-FA biosynthetic pathway enzymes include isomers of acetohydroxy acid that catalyze the conversion of α-aceto-α-hydroxybutyric acid to 2,3-dihydroxy-3-methylvaleric acid. Enzymes with reductase activity (eg, encoded by the ilvC gene) and dihydroxy acid dehydrase activity that catalyzes the conversion of 2,3-dihydroxy-3-methylvalerate to 2-keto-3-methylvalerate Included enzymes (e.g., encoded by the ilvD genes), thereby making biosynthesis in recombinant microbial cells more difficult by lacking or otherwise reducing expression of one or more of these genes. It can be directed to propionyl-CoA and ultimately to the production of odd chain fatty acids.

  Either or both of the following pathways are engineered in recombinant microbial cells to increase metabolic flux through common α-ketobutyric acid intermediates and cause an increase in intracellular propionyl-CoA production. can do. Examples of these routes are shown in FIG. 2 and are described in more detail below.

Pathway A (threonine intermediate)
The first pathway leading to the general α-ketobutyric acid intermediate represented by pathway (A) in FIG. 2 includes the production of the intermediate threonine by threonine biosynthetic enzyme, followed by the enzyme with threonine dehydrase activity. Involves the deamination of threonine to α-ketobutyric acid catalyzed by.

In pathway (A), an increase in metabolic flow to threonine is also referred to as aspartate kinase activity (eg EC 2.7.2.4; aspartokinase activity) that catalyzes the conversion of aspartate to aspartyl phosphate. ), Aspartic acid-semialdehyde dehydrogenase activity that catalyzes the conversion of aspartyl phosphate to aspartic acid semialdehyde (eg, EC 1.2.1.11), and catalyzes the conversion of aspartic acid semialdehyde to homoserine. Homoserine dehydrogenase activity (eg EC 1.1.1.3), homoserine kinase activity catalyzing the conversion of homoserine to O-phospho-L-homoserine (eg EC 2.7.1.39) and O- Threonine synthase activity that catalyzes the conversion of phospho-L-homoserine to threonine (eg, Comprising an enzyme having EC4.2.3.1), it can be achieved by expressing a polynucleotide encoding an enzyme involved in threonine biosynthesis. In order to increase metabolic flow through the threonine intermediate, not all of the activities listed above need to be manipulated in the recombinant microbial cell, and in some cases the activity already present in the parent microbial cell (eg, the parent microbial cell). Polypeptides having activity produced by natural genes in) will be sufficient to catalyze the steps listed above. In one embodiment, the recombinant microbial cell is a polypeptide having aspartate kinase activity, the polynucleotide encoding a polypeptide that catalyzes the conversion of aspartate to aspartyl phosphate, aspartate semialdehyde dehydrogenation. A polypeptide having an enzyme activity, the polynucleotide encoding a polypeptide that catalyzes the conversion of aspartyl phosphate to aspartate semialdehyde, a polypeptide having homoserine dehydrogenase activity, and comprising an aspartate semialdehyde A polynucleotide that encodes a polypeptide that catalyzes the conversion from homoserine to homoserine, a polypeptide having homoserine kinase activity, and a polynucleotide that encodes a polypeptide that catalyzes the conversion of homoserine to O-phospho-L-homoserine Recombining one or more polynucleotides selected from polynucleotides encoding otide and threonine synthase activity polypeptides that catalyze the conversion of O-phospho-L-homoserine to threonine Recombinant microbial cells are engineered to be expressed by the expression of the metabolic pathway through the pathway intermediate threonine compared to the parental microbial cells. In some cases, the polypeptide encoded by the recombinantly expressed polynucleotide is present in the recombinant microbial cell at a higher concentration compared to the concentration in the parental microbial cell when cultured under the same conditions, i.e. This polypeptide is “overexpressed” in recombinant cells. For example, a recombinantly expressed polynucleotide can be operably linked to a promoter that expresses the polynucleotide in a recombinant microbial cell at a higher concentration than that normally expressed in the parental microbial cell when cultured under the same conditions. . In one embodiment, an E. coli encoding bifunctional ThrA having aspartate kinase and homoserine dehydrogenase activity. The coli thrA gene is used. In another embodiment, a mutant E. coli encoding a mutant enzyme having aspartate kinase and homoserine dehydrogenase activity and having reduced feedback inhibition relative to the parental ThrA enzyme. The E. coli thrA gene is used (referred to as ThrA ^* ; Ogawa-Miyata, Y., et al., Biosci. Biotechnol. Biochem. 65: 1149-1154 (2001); Lee J.-H., et al., J Bacteriol.185: 5442-5451 (2003)).

  Threonine is produced by enzymes with threonine deaminase activity (eg, EC 4.3.1.19; also known as threonine ammonia lyase activity, previously classified as EC 4.2.1.16, threonine dehydrase). Can be deaminated to α-ketobutyric acid. In one embodiment, the threonine deaminase activity already present in the parental microbial cell (ie, endogenous) is sufficient to catalyze the conversion of threonine to α-ketobutyric acid. In another embodiment, the recombinant microbial cell is engineered to recombinantly express a polypeptide having threonine deaminase activity that catalyzes the conversion of threonine to α-ketobutyric acid. In some embodiments, the polypeptide having threonine deaminase activity is overexpressed in recombinant microbial cells.

  Non-limiting examples of enzymes for use in route (A) manipulation and polynucleotides encoding such enzymes are listed in Table 1.

  For example, for the polypeptides classified by the above EC numbers, all of the related databases available on the World Wide Web [KEGG database (University of Tokyo), PROTEIN or GENE database (Entrez database; NCBI), UNIPROTKB or ENZYME By searching the database (ExPASy; Swiss Institute of Bioinformatics) and the BRENDA database (The Comprehensive Enzyme Information System; Technical University of Braunschweig)], polypeptides can be further identified. For example, aspartokinase polypeptides can be further identified by searching for polypeptides classified in EC 2.7.2.4, homoserine dehydrogenase polypeptides can further be identified as EC 1.1.1.3. And homoserine kinase polypeptides can be further identified by searching for polypeptides classified in EC 2.7.1.39, and threonine synthesis Enzyme polypeptides can be further identified by searching for polypeptides classified as EC 4.2.3.1, and threonine deaminase polypeptides can be further identified as polypeptides classified as EC 4.3.1.19. Can be identified by searching.

  In some embodiments, a polynucleotide encoding a parent fatty acid pathway polypeptide (eg, a polypeptide described in Table 1 or identified by EC number or by homology to an example polypeptide) comprises the enzyme described above Generate variant polypeptides with improved activity compared to that of the parent polypeptide (eg, aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity, threonine deaminase activity) This property can be modified using methods well known in the art, such as increased catalytic activity or improved stability under conditions of culturing recombinant microbial cells, by cellular metabolites, or in culture media Manipulation such as reduction of inhibition by components, etc. (eg reduction of feedback inhibition) Adapted by microbial cells and / or pathway.

Pathway B (citramal acid intermediate)
As shown in the pathway (B) of FIG. 2, the second pathway leading to a general α-ketobutyric acid intermediate includes an intermediate citramalic acid (2- The conversion of citramalic acid to α-ketobutyric acid by the production of isopropylmalate isomerase and an enzyme with alcohol dehydrogenase activity is also involved.

  The citramalic acid synthase activity that catalyzes the reaction of acetyl-CoA with pyruvic acid to form (R) -citramalic acid (eg EC 2.3.1.182) is Yannaskii (SEQ ID NO: 40) or L. Can be supplied by expression of a bacterial cimA gene, such as Methanococcus jannaschi or Leptospira interrogans, which encodes a CimA polypeptide, such as CimA of interrogans (SEQ ID NO: 42) (Howell, MM et al., J. Bacteriol.181 (1): 331-3 (1999); Xu, H., et al., J. Bacteriol.186: 5400-5409 (2004)). Alternatively, for example, Atsumi S. et al. and Liao J.M. C. (Appl. Environ. Microbiol. 74 (24): 7802-7808 (2008)), a set of CimaA, preferably a CimA3.7 variant (SEQ ID NO: 41) encoded by the cimA3.7 gene Modified cimA nucleic acid sequences encoding CimA variants with improved catalytic activity or stability and / or reduced feedback inhibition in recombinant microbial cells can be used. Alternatively, a Leptospira interrogans CimA variant (SEQ ID NO: 43) can be used. First, isopropylmalate isomerase activity that catalyzes the conversion of (R) -citramalic acid to citraconic acid and then to beta-methyl-D-malic acid (EC 4.2.3.33, also called isopropylmalate dehydrase) For example, E.I. Coli or B. This can be effected by expression of a heterodimeric protein encoded by the subtilis leuCD gene. Alcohol dehydrogenase activity (EC 1.1.1.185, beta-isopropylmalate dehydrogenase) that catalyzes the conversion of beta-methyl-D-malate to 2-ketobutyrate (ie α-ketobutyrate) is E.g. Coli or B. It can be brought about by expression of the subtilis leuB gene or the yeast leu2 gene. Non-limiting examples of polynucleotides encoding such enzymes for use in manipulation of fatty acid pathway enzymes and pathway (B) of the oc-FA pathway are listed in Table 2.

  For example, for the polypeptides classified by the above EC numbers, all of the related databases available on the World Wide Web [KEGG database (University of Tokyo), PROTEIN or GENE database (Entrez database; NCBI), UNIPROTKB or ENZYME By searching the database (ExPASy; Swiss Institute of Bioinformatics) and the BRENDA database (The Comprehensive Enzyme Information System; Technical University of Braunschweig)], polypeptides can be further identified. For example, (R) -citramalate synthase polypeptides can be further identified by searching for polypeptides classified in EC 2.3.1.182, and isopropylmalate isomerase polypeptides can further be identified as EC4. 2.1-33 can be identified by searching for a polypeptide classified as beta-isopropylmalate dehydrogenase polypeptide further searched for a polypeptide classified as EC 1.1.1.185 Can be identified.

  In some embodiments, a polynucleotide encoding a parent fatty acid pathway polypeptide (eg, a polypeptide described in Table 2 or identified by EC number or by homology to an example polypeptide) comprises the enzyme described above Variant polypeptides having improved activity (eg, (R) -citramalate synthase activity, isopropylmalate isomerase activity, beta-isopropylmalate dehydrogenase activity) and properties compared to those of the parent polypeptide Modified using methods well known in the art to produce, for example, increased or stable catalytic activity under conditions in which recombinant microbial cells are cultured compared to the properties of the parent polypeptide. Improved inhibition, reduced by cellular metabolites, or by culture media components (e.g., feedback) Adapted by microbial cells and / or pathways to manipulate, such as reduced inhibition).

Propionyl-CoA production pathway C via methylmalonyl-CoA (methylmalonyl-CoA intermediate)
The following pathway example can be manipulated in recombinant microbial cells to increase metabolic flux through the methylmalonyl-CoA intermediate and cause an increase in intracellular propionyl-CoA production. An example of this route is shown in FIG. 3 and described in more detail below.

  Directing the metabolic stream to methylmalonyl-CoA can cause an increase in propionyl-CoA production. Thus, in one embodiment, the present invention provides that when a recombinant microbial cell is cultured under conditions sufficient to express a polynucleotide in the presence of a carbon source, from a carbon source (eg, a carbohydrate such as a sugar). Recombinant microbial cells comprising polynucleotides encoding those involved in the conversion to succinyl-CoA and methylmalonyl-CoA are included. Succinyl-CoA and methylmalonyl-CoA are intermediates in the microbial production of propionyl-CoA that serve as primers in the production of linear odd-chain fatty acid derivatives via the oc-FA pathway (FIG. 1B).

  The pathway leading to propionyl-CoA as shown in FIG. 3 (also referred to herein as “route (C)”) involves succinyl-CoA to methylmalonyl-CoA via an enzyme having methylmalonyl-CoA mutase activity. And the conversion of methylmalonyl-CoA to propionyl-CoA by the action of an enzyme having methylmalonyl-CoA decarboxylase activity and / or the action of an enzyme having methylmalonyl-CoA carboxyltransferase activity. In some cases, depending on the particular methylmalonyl-CoA decarboxylase or methylmalonyl-CoA stereoisomer utilized by the methylmalonyl-CoA carboxyltransferase used, the enzyme having methylmalonyl-CoA epimerase activity may be (R )-And (S) -methylmalonyl-CoA may be utilized for interconversion.

  Succinyl-CoA can be provided to this pathway by the cellular TCA cycle. In some cases, the flow from fumaric acid to succinic acid may be increased, for example, by overexpression of endogenous frd (fumarate reductase) or other gene (s) involved in the production of succinic acid or succinyl-CoA. . The conversion of succinyl-CoA to methylmalonyl-CoA can be catalyzed by an enzyme having methylmalonyl-CoA mutase activity (eg, EC 5.4.99.2). Such activity can be supplied to recombinant microbial cells by expression of an exogenous scpA (also known as sbm) gene or by overexpression of an endogenous scpA gene. An example of an sbm gene is an E. coli encoding Sbm polypeptide having the methylmalonyl-CoA mutase activity (Accession No. NP — 417392, SEQ ID NO: 51). Contains the genes for E. coli (Haller, T. et al., Biochemistry 39: 4622-4629 (2000)). Alternatively, for example, Propionibacterium Freudenreich subspecies comprising an α-subunit or “large subunit” (MutB, accession number YP — 003687736) and a beta-subunit or “small subunit” (MutA, accession number CAA33089). The methylmalonyl-CoA mutase from Shamani (Propionibacterium freundrenreichii subsp. Non-limiting examples of polypeptides that catalyze the conversion of succinyl-CoA to methylmalonyl-CoA are listed in Table 3 below.

  In one embodiment, conversion of methylmalonyl-CoA to propionyl-CoA results in methylmalonyl-CoA decarboxylase activity that catalyzes the decarboxylation of methylmalonyl-CoA to propionyl-CoA (eg, EC 4.1.1. 41). Such activity can be supplied to the recombinant microbial cell by expression of an exogenous scpB (also known as ygfG) gene or by overexpression of an endogenous scpB gene. Examples of methylmalonyl-CoA decarboxylase polypeptides include, for example, E. coli. Methylmalonyl-CoA decarboxylase polypeptide (Haller et al., Supra) encoded by the coli scpB gene or methylmalonyl-CoA encoded by Salmonella enterica or Yersinia enterocolitica Carboxylase polypeptides are included. In another embodiment, the conversion of methylmalonyl-CoA to propionyl-CoA is, for example, P.I. Can be catalyzed by a polypeptide having methylmalonyl-CoA carboxyltransferase activity (eg, EC 2.1.3.1), such as methylmalonyl-CoA carboxyltransferase of Freudenreich subsp. Shamani (mmdA, NBCI accession number Q8GBW6.3) . Depending on the methylmalonyl-CoA stereoisomer utilized by methylmalonyl-CoA decarboxylase or by methylmalonyl-CoA carboxyltransferase, for example, Bacillus subtilis (yqjC; Haller et al., Biochemistry 39: 4622-4629 (2000)) or a polypeptide having a methylmalonyl-CoA epimerase activity (eg EC 5.11.99.1) such as methylmalonyl-CoA epimerase of Propionibacterium freudenreich subsp. Shamani (NCBI accession number YP_003688018) A conversion between (R) -methylmalonyl-CoA and (S) -methylmalonyl-CoA, which can be catalyzed by, may be desired.

  Whether the enzyme or enzymes endogenous to the parental microbial cell may compete with the substrate of the engineered oc-FA biosynthetic pathway in the recombinant microbial cell or degrade the intermediate Otherwise, it may be diverted from the oc-FA biosynthetic pathway, and the genes encoding such undesirable endogenous enzymes are attenuated to increase the production of odd-chain fatty acid derivatives by recombinant microbial cells. Can be made. For example, E.I. In E. coli. Endogenous propionyl-CoA: succinyl-CoA transferase (NCBI accession number NP — 417395) encoded by the coli ScpC (also known as ygfH) gene catalyzes the conversion of propionyl-CoA to succinyl-CoA, and thus It can change the course of metabolic flow from propionyl-CoA and reduce oc-FA production. Thus, lacking or otherwise reducing the expression of the scpC (ygfH) gene will direct biosynthesis in recombinant microbial cells to more propionyl-CoA and ultimately to the production of odd chain fatty acids. Can do.

  Fatty acid pathway enzymes for use in the manipulation of pathway (C) of the oc-FA pathway and such enzymes that catalyze the conversion of succinyl-CoA to methylmalonyl-CoA and the conversion of methylmalonyl-CoA to propionyl-CoA Non-limiting examples of polynucleotides encoding are listed in Table 3.

  For example, for the polypeptides classified by the above EC numbers, all of the related databases available on the World Wide Web [KEGG database (University of Tokyo), PROTEIN or GENE database (Entrez database; NCBI), UNIPROTKB or ENZYME By searching the database (ExPASy; Swiss Institute of Bioinformatics) and the BRENDA database (The Comprehensive Enzyme Information System; Technical University of Braunschweig)], polypeptides can be further identified. For example, a methylmalonyl-CoA mutase polypeptide can be further identified by searching for polypeptides classified as EC 5.4.99.2, and a methylmalonyl-CoA decarboxylase polypeptide can further be identified as EC 4.1. .1.41 can be identified by searching for polypeptides, and methylmalonyl-CoA carboxyltransferase polypeptides can be further searched by searching for polypeptides classified as EC 2.1.3.1. The methylmalonyl-CoA epimerase polypeptide can be further identified by searching for polypeptides classified in EC5.11.99.1.

  In some embodiments, a polynucleotide encoding a parent fatty acid pathway polypeptide (eg, a polypeptide described in Table 3 or identified by an EC number or by homology to an example polypeptide) comprises the enzyme described above Have improved properties compared to the properties of the parent polypeptide, such as activity (eg, methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase activity, methylmalonyl-CoA epimerase activity, methylmalonyl-CoA carboxyltransferase activity) Modified using methods well known in the art to produce variant polypeptides, such as increased catalytic activity or improved stability under conditions in which recombinant microbial cells are cultured, cellular metabolism Depending on the product or culture medium components Reduction in harm (e.g., reduction of feedback inhibition) are adapted by microbial cells and / or paths to operate such.

Manipulation of Microbial Cells to Generate Increased Amounts of oc-FA Derivatives Propionyl-CoA to oc-β-ketoacyl-ACP
As mentioned above, propionyl-CoA serves as a primer for the subsequent FAS-catalyzed extension step in the production of oc-FA derivatives. The initiation of this process requires condensation of propionyl-CoA and malonyl-ACP molecules to form the oc-β-ketoacyl-ACP intermediate 3-oxovaleryl-ACP (FIG. 1B). As shown in step (D) of FIG. 1B, this initiation step is performed in an enzyme having β-ketoacyl-ACP synthase activity using propionyl-CoA as a substrate [for example, type III β -Ketoacyl-ACP synthase (eg EC 2.3.1.180)].

The substrate specificity of the β-ketoacyl-ACP synthase of a particular microorganism often reflects the fatty acid composition of that microorganism (Han, L., et al., J. Bacteriol. 180: 4481-4486 (1998). Qui, X., et al., Protein Sci. 14: 2087-2094 (2005)). For example, E.I. The E. coli FabH enzyme utilizes propionyl-CoA and acetyl-CoA, but has a very high selectivity for acetyl-CoA, reflecting a high proportion of linear even chain fatty acids (Choi , KH, et al., J. Bacteriology 182: 365-370 (2000);
On the other hand, the Streptococcus pneumoniae enzyme produces a variety of linear and branched chain fatty acids, reflecting a short length of between 2 and 4 carbons. A chain acyl-CoA primer is utilized as well as various branched chain acyl-CoA primers (Khandekar SS, et al., J. Biol. Chem. 276: 30024-30030 (2001)). Polynucleotide sequences encoding polypeptides having β-ketoacyl-ACP synthase activity that utilize propionyl-CoA as a substrate generally include β-ketoacyl-ACP synthases with a wide range of acyl-CoA substrate specificities. It can be obtained from the contained microbial cells. Β-ketoacyl-ACP synthase sources with broad substrate specificity include, for example, Bacillus (eg B. subtilis), Listeria [eg L. L. monocytogenes], Streptomyces [e.g. Bacteria that produce a variety of fatty acid structures, including branched chain fatty acids, such as S. coelicolor and Propionibacterium (eg, P. fredenreiich subsp. Shamani) can be included. Particularly preferred β-ketoacyl-ACP synthases include those that are selective for propionyl-CoA versus acetyl-CoA over that exhibited by endogenous FabH. For example, E.I. When manipulating E. coli cells, preferred β-ketoacyl-ACP synthases include, but are not limited to: Subtilis FabH1 (Choi
et al. 2000, supra), Streptomyces glaussens FabH (Han, L., et al., J. Bacteriol. 180: 4481-4486 (1998)), Streptococcus pneumoniae FabH (Khandekar S. , Et al., J. Biol. Chem. 276: 30024-30030 (2001) and Staphylococcus aureus FabH (Qui, X. et al., Protein Sci. 14: 2087-2094 (2005). ) Can be included.

  The endogenous enzyme or enzymes may compete with the substrate of the engineered oc-FA biosynthetic pathway in the recombinant microbial cell, or may degrade the oc-FA pathway intermediate. Otherwise, the course of metabolic flow may be diverted from oc-FA production, and genes encoding such undesirable endogenous enzymes are attenuated to increase the production of oc-FA derivatives by recombinant microbial cells. be able to. For example, E.I. Β-ketoacyl-ACP synthase encoded by E. coli endogenous fabH utilizes propionyl-CoA as a substrate, but is more selective for 2-carbon acetyl-CoA molecules than 3-carbon propionyl-CoA molecules ( Choi et al. 2000, supra). Thus, E.I. Cells expressing the coli fabH gene selectively utilize acetyl-CoA as a primer for fatty acid synthesis and mainly produce even chain fatty acid molecules in vivo. Expressing an exogenous gene encoding a β-ketoacyl-ACP synthase that lacks or otherwise reduces expression of the endogenous fabH gene and is selective by propionyl-CoA over that exhibited by endogenous FabH (Eg, when manipulating E. coli, endogenous E. coli FabH has a higher selectivity for propionyl-CoA over B. subtilis FabH1 or acetyl-CoA than demonstrated by E. coli FabH. Substituting with an exogenous exogenous FabH), the metabolic stream in the recombinant microbial cells can be more directed to the oc-β-ketoacyl-ACP intermediate and ultimately to the production of more oc-FA derivatives.

  Non-limiting examples of polynucleotides encoding such enzymes for use in the manipulation of fatty acid pathway enzymes and step D of the oc-FA pathway are listed in Table 4.

  The β-ketoacyl-ACP synthase polypeptide is a related database [KEGG database (University of Tokyo), all of which are available on the World Wide Web, for example, for polypeptides classified in EC 2.3.1.180. Protein or Genene database (Entrez database; NCBI), UNIPROTKB or ENZYME database (ExPASy; Swiss Bioinformatics Institute) and BRENDA database (The Comprehensive Enzyme Information System; TechNy Can do.

  The β-ketoacyl-ACP synthase polypeptide also searches sequence pattern databases such as the Prosite database (ExPASy Proteomics Server, Swiss Bioinformatics Institute) for polypeptides that contain one or more of the sequence motifs listed below Can be further identified. This is easily accomplished, for example, by using the ScanProsite tool available on the ExPaSy proteomics server world wide web site.

In one embodiment, the β-ketoacyl-ACP synthase polypeptide comprises one or more sequence motifs selected from:
DT- [N, S] D- [A, E] -WIx (2)-[M, R] -TGIx- [N, E] -R- [R, H] (SEQ ID NO: 14)
[S, A] -xDx (2) -A- [A, V] -C- [A, S] -GFx (3)-[M, L] -x (2) -A (SEQ ID NO: 15)
DRxT- [A, I]-[I, V] -xF- [A, G] -DGA- [A, G]-[G, A]-[A, V] (SEQ ID NO: 16)
HQANxRI- [M, L] (SEQ ID NO: 17)
GNT- [G, S] -AAS- [V, I] -Px (2)-[I, L] -x (6) -G (SEQ ID NO: 18)
[I, V] -xLx (2) -FGGG- [L, F]-[T, S] -WG (SEQ ID NO: 19)
Each amino acid residue in parentheses indicates an alternative amino acid residue at a specific position, each x indicates an arbitrary amino acid residue, and each n in “x (n)” is x in a consecutive series of amino acid residues. Indicates the number of residues.

  In some embodiments, a polynucleotide encoding a parent fatty acid pathway polypeptide (eg, a polypeptide described in Table 4 or identified by homology to an EC number or motif or polypeptide example) is β- Ketoacyl-ACP synthase activity and modified using methods well known in the art to produce variant polypeptides with improved properties compared to the properties of the parent polypeptide, which properties are for example Increased catalytic activity and / or increased specificity for propionyl-CoA (eg compared to acetyl-CoA), improved catalytic activity or improved stability under conditions in which recombinant microbial cells are cultured, cells Reduced inhibition by metabolites, culture medium components, etc. (eg reduced feedback inhibition) Adapted by microorganisms and / or pathways operations.

  The present invention is a recombinant microbial cell comprising a polynucleotide encoding a polypeptide, wherein the polypeptide is SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. , 13, 146, 147, 148 and 149 at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96 Recombinant microbial cells comprising a polypeptide sequence having%, at least 97%, at least 98% or at least 99% identity, wherein the polypeptide utilizes propionyl-CoA as a substrate including. In some cases, the polypeptide sequence comprises one or more sequence motifs selected from SEQ ID NOs: 14-19. The invention also includes an isolated polypeptide comprising the polypeptide sequence and an isolated polynucleotide encoding the polypeptide. In one embodiment, the polypeptide comprises a substitution at position W310 or equivalent. In one embodiment, the polypeptide comprises a W310G substitution. In one embodiment, the polypeptide is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% relative to SEQ ID NO: 7. A sequence having at least 97%, at least 98% or at least 99% identity and including the substitution W310G. In some embodiments, the polypeptide exhibits greater specificity for propionyl-CoA than acetyl-CoA.

  As used herein, a “polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate” includes a detectable level of β-ketoacyl when supplied with the substrate propionyl-CoA. Any polypeptide having ACP synthase activity is included.

The enzymatic activity and specificity of β-ketoacyl-ACP synthase for substrates such as propionyl-CoA can be measured using known methods. For example, Choi et
al. (J. Bacteriology 182 (2): 365-370 (2000)) is a suitable filter disc assay for measuring β-ketoacyl-ACP synthase (“FabH”) activity on acetyl-CoA substrates. ), And this assay can be modified to assay propionyl-CoA as a substrate. The assay consists of ACP 25 μM, β-mercaptoethanol 1 mM, malonyl-CoA 65 μM, [1- ¹⁴ C] acetyl-CoA 45 μM (specific activity approximately 45.8 Ci / mol), E. coli in a final volume of 40 μL. Contains Kori FadD (0.2 μg) and 0.1 M sodium phosphate buffer (pH 7.0). To assay β-ketoacyl-ACP synthase activity, [1- ¹⁴ C] acetyl-CoA can be replaced with ¹⁴ C-labeled propionyl-CoA. The reaction is started by adding FabH and the mixture is incubated at 37 ° C. for 12 minutes. Next, a fixed amount of 35 mL is removed and deposited on Whatman 3MM filter discs. The disc is then washed with 3 changes of ice-cold trichloroacetic acid (20 mL / disc for 20 minutes each). Next, in each continuous wash, the concentration of trichloroacetic acid is reduced from 10% to 5% and further to 1%. Filters are dried and counted in 3 mL scintillation cocktail.

Alternatively, FabH activity can be measured using radioactively labeled malonyl-CoA substrate and gel electrophoresis to separate and quantify products (Choi et al. 2000, supra). Assay mixture consists of ACP 25 μM, β-mercaptoethanol 1 mM, [2- ¹⁴ C] malonyl-CoA 70 μM (specific activity about 9 Ci / mol), CoA substrate (eg acetyl-CoA or propionyl-CoA) in a final volume of 40 μL. Contains 45 μL, FadD (0.2 μg), NADPH 100 μM, FabG (0.2 μg) and 0.1 M sodium phosphate buffer (pH 7.0). The reaction can be initiated by adding FAbH. The mixture is incubated at 37 ° C. for 12 minutes and then placed in an ice slurry, then gel loading buffer is added and the mixture is applied to a conformation sensitive 13% polyacrylamide gel containing 0.5 M to 2.0 M urea. Load it. Electrophoresis can be performed at 25 mA at 32 mA / gel. The gel is then dried and the bands are quantified by exposing the gel to a phosphoimager screen. Specific activity can be calculated from the slope of a plot of product formation versus FabH protein concentration during the assay.

oc-β-ketoacyl-ACP to oc-acyl-ACP
As shown in step (E) of FIG. 1B, the oc-β-ketoacyl-ACP intermediate 3-oxovaleryl-ACP produced in step (D) is a fatty acid synthase such as a type II fatty acid synthase complex. It can be subjected to elongation by successive cycles of condensation / keto reduction / dehydration / enoyl reduction with malonyl-ACP catalyzed by (FAS) complex, resulting in the resulting long fatty acid chain of oc-acyl-ACP Two carbon units are added. In one embodiment, an FAS enzyme complex endogenous to the microbial cell (eg, a type II FAS complex) is condensed / ketoreduced / dehydrated with malonyl-ACP to produce an oc-acyl-ACP intermediate. / Used to catalyze the enoyl reduction cycle.

oc-acyl-ACP to oc-FA derivatives Odd-chain fatty acid derivatives can be produced by the recombinant microbial cells of the present invention. As shown in step (F) of FIG. 1B, the oc-acyl-ACP intermediate is oc in a reaction catalyzed by one or more enzymes each having fatty acid derivatization activity (ie, a fatty acid derivative enzyme). -Converted to a FA derivative. The fatty acid derivative enzyme can, for example, convert oc-acyl-ACP to a first oc-FA derivative or convert a first oc-FA derivative to a second oc-FA derivative. In some cases, the first oc-FA derivative is converted to a second oc-FA derivative by enzymes having different fatty acid derivatization activities. In some cases, the second oc-FA derivative is further converted to a third oc-FA derivative by another fatty acid derivative enzyme, and the like.

  Thus, in some embodiments, the recombinant microbial cell further comprises one or more polynucleotides, each polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity, wherein the recombinant microbial cell is a carbon. When cultured under conditions effective to express the polynucleotide in the presence of the source, an oc-FA derivative is produced.

  In various embodiments, the fatty acid derivatization activity includes thioesterase activity in which recombinant microbial cells produce oc-fatty acids, ester synthase activity in which recombinant microbial cells produce oc-fatty esters, recombinant microbial cells Fatty aldehyde biosynthetic activity for producing oc-fatty aldehyde, fatty alcohol biosynthetic activity for producing recombinant microbial cells with oc-fatty alcohol, ketone biosynthetic activity for producing ec-ketones with recombinant microbial cells or recombinant microorganisms Includes hydrocarbon biosynthetic activity in which cells produce ec-hydrocarbons. In some embodiments, the recombinant microbial cell comprises a polynucleotide that encodes two or more polypeptides, each polypeptide having a fatty acid derivative enzyme activity.

  In a more specific embodiment, the recombinant microbial cell expresses or overexpresses one or more polypeptides having fatty acid derivative enzyme activity as described above, and the recombinant microbial cell is oc-fatty acid, oc-fatty ester. An oc-FA composition comprising oc-wax ester, oc-fatty aldehyde, oc-fatty alcohol, ec-ketone, ec-alkane, ec-alkane, ec-internal olefin or ec-terminal olefin.

  The following are further examples of fatty acid derivative enzymes and oc-FA derivatives produced by reactions catalyzed by such enzymes, according to various embodiments of the invention.

oc-Fatty Acids In one embodiment, the recombinant microbial cell includes a polynucleotide encoding thioesterase, and the oc-acyl-ACP intermediate produced by the recombinant microbial cell is a thioesterase (eg, 3.1). 1.5, EC 3.1.2.-, such as EC 3.1.2.14, etc.) leading to the production of oc-fatty acids. In some embodiments, a composition comprising a fatty acid comprising an oc-fatty acid (also referred to herein as a “fatty acid composition”) under conditions effective to express the polynucleotide in the presence of a carbon source. Produced by culturing recombinant cells in In some embodiments, the fatty acid composition includes oc-fatty acids and ec-fatty acids. In some embodiments, the composition is recovered from the cell culture.

  In some embodiments, the recombinant microbial cell comprises a polynucleotide encoding a polypeptide having thioesterase activity and one or more additional polynucleotides encoding polypeptides having other fatty acid derivative enzyme activities. In such a case, the oc-fatty acid produced by the action of thioesterase is converted into one or more enzymes having various fatty acid derivative enzyme activities, for example, oc-fatty ester, oc-fatty aldehyde, oc-fatty. Converted to another oc-fatty acid derivative such as alcohol or ec-hydrocarbon.

  In one embodiment, the oc-acyl-ACP intermediate reacts with thioesterase to form an oc-fatty acid. The oc-fatty acid can be recovered from the cell culture or further converted into another oc-FA derivative such as oc-fatty ester, oc-fatty aldehyde, oc-fatty alcohol or ec-terminal olefin. it can.

The chain length of fatty acids or fatty acid derivatives made from them can be selected by altering the expression of certain thioesterases. Thioesterase affects the chain length of the fatty acids produced as well as the chain length of derivatives made from them. Thus, the recombinant microbial cell expresses, attenuates, or expresses one or more selected thioesters to increase production of a preferred fatty acid or fatty acid derivatized substrate. Can be operated so as not to. For example, C ₁₀ fatty acids, to express thioesterase selecting product to C ₁₀ fatty acids, and C ₁₀ thioesterase selecting the generation of fatty acids other than fatty acids (e.g., thioesterase prefer production of C ₁₄ fatty acids) attenuating Can be generated. This results in a relatively uniform population of fatty acids having 10 carbon chain lengths. In other cases, C ₁₄ fatty acids can be produced by attenuating endogenous thioesterases that produce non-C ₁₄ fatty acids and expressing thioesterases using C ₁₄ -ACP. _{Sometimes, C 12} fatty acids _can be expressed thioesterase using the C 12-ACP, it produces by attenuating thioesterase to form _{non-C 12} fatty acids. Fatty acid overproduction can be verified by methods known in the art, such as the use of radioactive precursors after cell lysis, HPLC or GC-MS.

  Additional non-limiting examples of thioesterases and polynucleotides encoding them for use in the oc-fatty acid pathway are listed in Table 5 and PCT Publication No. WO2010 / 075483, incorporated herein by reference.

oc-Fatty Ester In one embodiment, the recombinant microbial cell produces an oc-fatty ester such as, for example, oc-fatty acid methyl ester or oc-fatty acid ethyl ester or oc-wax ester. In some embodiments, oc-fatty acids produced by recombinant microbial cells are converted to oc-fatty esters.

  In some embodiments, the recombinant microbial cell encodes a polypeptide (ie, enzyme) having ester synthase activity (also referred to herein as “ester synthase polypeptide” or “ester synthase”). The oc-fatty ester comprising the polynucleotide is produced by a reaction catalyzed by an ester synthase polypeptide expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising a fatty ester comprising an oc-fatty ester (also referred to herein as a “fatty ester composition”) is effective to express a polynucleotide in the presence of a carbon source. Produced by culturing recombinant cells under mild conditions. In some embodiments, the fatty ester composition includes oc-fatty esters and ec-fatty esters. In some embodiments, the composition is recovered from the cell culture.

  Ester synthase polypeptides include, for example, ester synthase polypeptides classified as EC 2.3.1.7, or, without limitation, wax-ester synthase, acyl-CoA: alcohol transacylase, acyltransferase or Fatty acyl-CoA: Any other polypeptide that catalyzes the conversion of acyl-thioesters to fatty esters, including fatty alcohol acyltransferases, is included. For example, the polynucleotide may be wax / dgat, Simsonia chinensis, Acinetobacter sp. It may encode the bifunctional ester synthase / acyl-CoA: diacylglycerol acyltransferase of (Fundibacter jadensis), Arabidopsis thaliana or Alkaligenes eutrophus. In certain embodiments, the ester synthase polypeptide is Acinetobacter sp. Diacylglycerol O-acyltransferase (wax-dgaT; UniProtKB Q8GGGG1, GenBank AAO17391) or Simonsia quinensis wax synthase (UniProtKB Q9XGY6), GenBank 80, GenB80. In certain embodiments, a polynucleotide encoding an ester synthase polypeptide is overexpressed in a recombinant microbial cell. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

  In another embodiment, the recombinant microbial cell produces an oc-fatty ester, such as, for example, oc-fatty acid methyl ester or oc-fatty acid ethyl ester, and the recombinant microbial cell is AtfA1 (Alkanibolax volcumensis SK2). Acyltransferase obtained from UniProtKB Q0VKV8, GenBank YP — 694462) or AtfA2 (another acyltransferase obtained from Alcanibolax vorcumensis SK2, UniProtKB Q0VNJ6, GenBank YP — 6931.2), etc. A polynucleotide encoding the ester synthase / acyltransferase polypeptide. In certain embodiments, a polynucleotide encoding an ester synthase polypeptide is overexpressed in a recombinant microbial cell. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

  In another embodiment, the recombinant microbial cell produces an oc-fatty ester such as, for example, oc-fatty acid methyl ester or oc-fatty acid ethyl ester, and the recombinant microbial cell is ES9 (Marino encoded by the ws2 gene. Wax ester synthase from Unibacter hydrocarbonoplasticus DSM 8798, UniProtKB A3RE51, GenBank ABO21021) or ES376 (from Marinobacter hydrocarbonocus M DS 98 encoded by ws1 gene) Other wax ester synthases, such as UniProtKB A3RE50, GenBank ABO21020) A polynucleotide encoding a synthase polypeptide is expressed. In certain embodiments, a polynucleotide encoding an ester synthase polypeptide is overexpressed in a recombinant microbial cell. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

  Additional non-limiting examples of ester synthase polypeptides suitable for use in these embodiments and polynucleotides encoding them include PCT Publication Nos. WO2007 / 136762 and WO2008 /, which are incorporated herein by reference. 119082 are included.

oc-fatty aldehyde In one embodiment, the recombinant microbial cell produces oc-fatty aldehyde. In some embodiments, oc-fatty acids produced by recombinant microbial cells are converted to oc-fatty aldehydes. In some embodiments, oc-fatty aldehyde produced by recombinant microbial cells is then converted to oc-fatty alcohol or ec-hydrocarbon.

  In some embodiments, the recombinant microbial cell is a polypeptide having a fatty aldehyde biosynthetic activity (also referred to herein as a “fatty aldehyde biosynthetic polypeptide” or “fatty aldehyde biosynthetic enzyme”) (ie, an enzyme). Oc-fatty aldehyde is produced by a reaction catalyzed by a fatty aldehyde biosynthetic polypeptide expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising a fatty aldehyde comprising oc-fatty aldehyde (also referred to herein as a “fatty aldehyde composition”) is effective to express a polynucleotide in the presence of a carbon source. Produced by culturing recombinant cells under mild conditions. In some embodiments, the fatty aldehyde composition includes oc-fatty aldehyde and ec-fatty aldehyde. In some embodiments, the composition is recovered from the cell culture.

  In some embodiments, the oc-fatty aldehyde encodes a polypeptide having fatty aldehyde biosynthetic activity, such as carboxylate reductase (CAR) activity (eg, encoded by the car gene) in recombinant microbial cells. Produced by expressing or overexpressing a polynucleotide. Examples of carboxylate reductase (CAR) polypeptides and polynucleotides encoding them useful according to this embodiment include, but are not limited to, FadD9 (EC6.2.1.- UniProtKB Q50631, GenBank NP — 217106), CarA ( GenBank ABK75684), CarB (GenBank YP889972) and related polypeptides described in PCT Publication No. WO2010 / 042664, incorporated herein by reference. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

  In some embodiments, the oc-fatty aldehyde encodes a fatty aldehyde biosynthetic polypeptide, such as a polypeptide having acyl-ACP reductase (AAR) activity encoded by the aar gene in recombinant microbial cells. Produced by expressing or overexpressing a polynucleotide. Examples of acyl-ACP reductase polypeptides useful according to this embodiment include, but are not limited to, Synechococcus elongatas PCC7942 (GenBank YP — 400611) acyl-ACP reductase and PCT Publication No. WO2010 / 042664, incorporated herein by reference. Related polypeptides described in.

  In some embodiments, the oc-fatty aldehyde is a fat such as a polypeptide having acyl-CoA reductase activity (eg, EC1.1.2.x) encoded by the acr1 gene in the recombinant microbial cell. Produced by expressing or overexpressing a polynucleotide encoding an aldehyde biosynthetic polypeptide. Examples of acyl-CoA reductase polypeptides useful according to this embodiment include, but are not limited to, ACR1 of Acinetobacter sp. Strain ADP1 (GenBank YP — 047869) and PCT Publication No. WO2010 / 042664, incorporated herein by reference. Related polypeptides. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase and an acyl-CoA synthase.

oc-fatty alcohol In one embodiment, the recombinant microbial cell produces oc-fatty alcohol. In some embodiments, oc-fatty aldehyde produced by recombinant microbial cells is converted to oc-fatty alcohol. In other embodiments, oc-fatty acids produced by recombinant microbial cells are converted to oc-fatty alcohols.

  In some embodiments, the recombinant microbial cell is a polypeptide (ie, enzyme) having fatty alcohol biosynthetic activity (also referred to herein as a “fatty alcohol biosynthetic polypeptide” or “fatty alcohol biosynthetic enzyme”). The oc-fatty alcohol is produced by a reaction catalyzed by a fatty alcohol biosynthetic enzyme that is expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising a fatty alcohol comprising oc-fatty alcohol (also referred to herein as a “fatty alcohol composition”) is effective to express a polynucleotide in the presence of a carbon source. Produced by culturing recombinant cells under mild conditions. In some embodiments, the fatty alcohol composition includes oc-fatty alcohol and ec-fatty alcohol. In some embodiments, the composition is recovered from the cell culture.

  In some embodiments, the oc-fatty alcohol is a polypeptide having alcohol dehydrogenase (aldehyde reductase) activity, eg, fatty alcohol biosynthetic activity, such as EC 1.1.1.1, in recombinant microbial cells. Produced by expressing or overexpressing the encoding polynucleotide. Examples of alcohol dehydrogenase polypeptides useful according to this embodiment include, but are not limited to Included are coli alcohol dehydrogenase YqhD (GenBank AP — 003562) and related polypeptides described in PCT Publication Nos. WO2007 / 136762 and WO2008 / 119082, which are incorporated herein by reference. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a fatty aldehyde biosynthetic polypeptide. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

  In some embodiments, the oc-fatty alcohol is a fatty alcohol forming acyl-ACP reductase (FAR) activity, eg, EC1.1.1. Produced by expressing or overexpressing a polynucleotide encoding a fatty alcohol biosynthetic polypeptide, such as a polypeptide having x. Examples of FAR polypeptides useful according to this embodiment include, but are not limited to, the polypeptides described in PCT Publication No. WO2010 / 062480, incorporated herein by reference. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase and an acyl-CoA synthase.

ec-Hydrocarbons In one embodiment, the recombinant microbial cells produce ec-hydrocarbons such as ec-alkanes or ec-alkenes (eg, ec-terminal olefins or ec-internal olefins) or ec-ketones. In some embodiments, the oc-acyl-ACP intermediate is converted by decarboxylation to remove one carbon atom to form an ec-internal olefin or ec-ketone. In some embodiments, oc-fatty aldehyde produced by recombinant microbial cells is converted by decarbonylation to remove one carbon atom to form an ec-hydrocarbon. In some embodiments, oc-fatty acids produced by recombinant microbial cells are converted by decarboxylation to remove one carbon atom to form an ec-terminal olefin.

  In some embodiments, the recombinant microbial cell is a polypeptide having hydrocarbon biosynthetic activity (ie, an enzyme) (also referred to herein as a “hydrocarbon biosynthetic polypeptide” or “hydrocarbon biosynthetic enzyme”). The ec-hydrocarbon is produced by a reaction catalyzed by a hydrocarbon biosynthetic enzyme that is expressed or overexpressed in recombinant microbial cells. In some embodiments, a composition comprising a hydrocarbon comprising ec-hydrocarbons (also referred to herein as a “hydrocarbon composition”) is effective to express a polynucleotide in the presence of a carbon source. Produced by culturing recombinant cells under mild conditions. In some embodiments, the hydrocarbon composition comprises ec-hydrocarbon and oc-hydrocarbon. In some embodiments, the hydrocarbon composition is recovered from the cell culture.

  In some embodiments, the ec-hydrocarbon is a polypeptide having hydrocarbon biosynthetic activity, such as aldehyde decarbonylase (ADC) activity (eg, EC 4.11.99.5), in recombinant microbial cells. Encoding polynucleotides, eg, encoding aldehyde decarbonylase of Prochlorococcus marinus MIT9313 (GenBank NP — 895059) or Nostock punctiforme (GenBank accession number YP — 001865325) Or it is produced by overexpression. Additional examples of aldehyde decarbonylases and related polypeptides useful according to this embodiment include, but are not limited to, those described in PCT Publication Nos. WO 2008/119082 and WO 2009/140695, which are incorporated herein by reference. Polypeptides are included. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a fatty aldehyde biosynthetic polypeptide. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding an acyl-ACP reductase.

  In some embodiments, the ec-terminal olefin is a polypeptide having decarboxylase activity in a recombinant microbial cell, eg, as described in PCT Publication No. WO 2009/085278, incorporated herein by reference. Produced by expressing or overexpressing a polynucleotide encoding a hydrocarbon biosynthetic polypeptide. In some embodiments, the recombinant microbial cell further comprises a polynucleotide encoding a thioesterase.

  In some embodiments, the ec-internal olefin is a poly having an OleCD or OleBCD activity in recombinant microbial cells, for example, as described in PCT Publication No. WO 2008/147781, incorporated herein by reference. Produced by expressing or overexpressing a polynucleotide encoding a hydrocarbon biosynthetic polypeptide, such as a peptide.

  In some embodiments, the ec-ketone, such as a polypeptide having OleA activity, as described in PCT Publication No. WO2008 / 147781, which is incorporated herein by reference, in recombinant microbial cells. Produced by expressing or overexpressing a polynucleotide encoding a hydrocarbon biosynthetic polypeptide.

Saturation levels of oc-FA derivatives The saturation of oc-acyl-ACP (which can then be converted to various oc-FA derivatives as described above) is controlled by adjusting the saturation of the fatty acid intermediate. can do. For example, the sfa, gns and fab family genes can be expressed (eg, attenuated) at expressed, overexpressed or reduced levels to control the amount of oc-acyl-ACP saturation.

oc-FA pathway polypeptides and polynucleotides The present disclosure identifies polynucleotides useful in the recombinant microbial cells, methods and compositions of the invention, but does not require absolute sequence identity to such polynucleotides I want you to recognize that. For example, changes can be made in a particular polynucleotide sequence and the activity of the encoded polypeptide can be screened. Such changes usually include conserved mutations and silent mutations (eg, codon optimization, etc.). Modified or mutated (ie mutant) polynucleotides and encoded variant polypeptides may be used to increase catalytic activity, increased stability, or without limitation using methods known in the art. One can screen for a desired function, such as an improved function compared to the parent polypeptide that includes decreased inhibition (eg, decreased feedback inhibition).

  The present disclosure identifies enzyme activities involved in various steps (ie reactions) of the oc-FA biosynthetic pathway described herein according to enzyme classification (EC) numbers, and is classified into such EC numbers. Examples of polypeptides (ie, enzymes) and polynucleotides encoding such polypeptides are provided. Examples of such polypeptides and polynucleotides identified herein by accession number and / or sequence identification number (SEQ ID NO) are oc in parental microbial cells to obtain the recombinant microbial cells described herein. -Useful for manipulating the FA pathway. However, it should be understood that the polypeptides and polynucleotides described herein are exemplary and not limiting. Sequences of homologues of the example polypeptides described herein are provided by, for example, the Entrez database, Swiss Bioinformatics Institute, provided by the National Center for Biotechnology Information (NCBI) available on the World Wide Web Those skilled in the art are able to use such databases as the ExParsy database, the BRENDA database provided by Technical University of Braunschweig, and the KEGG database provided by the Kyoto University and the University of Tokyo Bioinformatics Center.

  It should further be appreciated that various microbial cells can be modified to contain the oc-FA pathway described herein to yield recombinant microbial cells suitable for the production of odd chain fatty acid derivatives. It should also be understood that the various cells can provide a source of genetic material comprising a sequence of polynucleotides that encode a polypeptide suitable for use in the recombinant microbial cells provided herein.

  The present disclosure provides numerous examples of polypeptides (ie, enzymes) that have suitable activity for use in the oc-FA biosynthetic pathway described herein. Such polypeptides are collectively referred to herein as “oc-FA pathway polypeptides” (or “oc-FA pathway enzymes”). Non-limiting examples of oc-FA pathway polypeptides suitable for use in the recombinant microbial cells of the invention are described in the tables and descriptions and examples herein.

  In some embodiments, the invention includes a recombinant microbial cell comprising a polynucleotide sequence encoding an oc-FA pathway polypeptide (also referred to herein as an “oc-FA pathway polynucleotide” sequence). included.

  Additional oc-FA pathway polypeptides and polynucleotides encoding them suitable for use in the manipulation of the oc-FA pathway in the recombinant microbial cells of the invention can be obtained by several methods. For example, EC numbers classify enzymes according to the reaction they catalyze. Enzymes that catalyze reactions in the biosynthetic pathway described in this specification include, for example, the KEGG database (Kyoto Encyclopedia of Genes and Genomics; Kyoto University and Tokyo University), UNIPROTKB database, or ENZYME database, all available on the World Wide Web. (ExPASy Proteomics Server; Swiss Bioinformatics Institute), PROTEIN database or GENE database (Entrez database; National Center for Biotechnology Information (NCBI)) or BRENDA database (The Comprehensive Enzyme Information System; TechnicalBicycle) It can be identified by searching the EC number corresponding to the reaction in a database, such as aunschweig). In one embodiment, an oc-FA pathway polynucleotide encoding an oc-FA pathway polypeptide having enzymatic activity classified by an EC number (such as an EC number listed in the description or one of the tables herein) or its Those fragments or variants having activity are used in the operation of the corresponding step of the oc-FA pathway in recombinant microbial cells.

  In some embodiments, the oc-FA pathway polynucleotide sequence encodes a polypeptide that is endogenous to the parent cell of the engineered recombinant cell. Some such endogenous polypeptides are overexpressed in recombinant microbial cells. As used herein, “endogenous polypeptide” refers to a polypeptide encoded by the genome of a parent (eg, wild type) cell that has been engineered to produce recombinant microbial cells.

  For example, an oc-FA pathway polypeptide, such as an endogenous oc-FA pathway polypeptide, can be overexpressed by any suitable means. As used herein, “overexpression” expresses a polynucleotide or polypeptide in a cell at a higher concentration than would normally be expressed in the corresponding parent (eg, wild type) cell under the same conditions. Or cause expression. For example, when a polypeptide is present at a higher concentration in a recombinant cell when cultured under the same conditions as compared to the concentration in a homologous non-recombinant host cell (eg, a parent cell), the peptide Is "overexpressed" within.

  In some embodiments, the oc-FA pathway polynucleotide sequence encodes a foreign or heterologous polypeptide. In other words, the polypeptide encoded by the polynucleotide is foreign to the parental microbial cell. As used herein, a “foreign” (or “heterologous”) polypeptide is encoded by the genome of a parent (eg, wild type) microbial cell that has been engineered to produce recombinant microbial cells. Refers to a non-polypeptide. Such polypeptides can also be referred to as “non-natural” polypeptides.

  In certain embodiments, the oc-FA pathway polypeptide comprises an amino acid sequence other than one of the example polypeptide sequences provided herein, eg, the oc-FA pathway polypeptide is an example of a polypeptide. Sequences that are homologues, fragments or variants of the sequence can be included.

  As used herein, the terms “homologue”, “homologue” and “homologue” are at least 50% of the corresponding polynucleotide or polypeptide sequence, preferably At least 60%, more preferably at least 70% (eg, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) refers to a polynucleotide or polypeptide comprising a sequence that is homologous. Those skilled in the art will be familiar with methods for measuring the homology of two or more sequences. Briefly, the calculation of “homology” between two sequences can be performed as follows. Align sequences for optimal comparison (eg, gaps can be introduced into one or both of the first and second amino acid or polynucleotide sequences for optimal alignment, and heterologous for comparison Can be ignored). In a preferred embodiment, the length of the first sequence aligned for comparison is at least about 30%, preferably about 40%, more preferably at least about 50%, even more preferably the length of the second sequence. Is at least about 60%, even more preferably at least about 70%, at least about 80%, at least about 90%, or about 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions in the first and second sequences are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, the amino acid Or “identity” of nucleic acids is equivalent to “homology” of amino acids or nucleic acids). The percent identity between the two sequences is the same position shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences. It is a function of numbers.

  Sequence comparison between two sequences and determination of percent homology (ie, percent identity) was performed using BLAST (Altschul et al., J. Mol. Biol., 215 (3): 403-410 (1990)). Can be implemented using mathematical algorithms such as The percent homology between the two amino acid sequences is also calculated using either the Blossum 62 matrix or the PAM 250 matrix, using the Needleman and Wunsch algorithms embedded in the GAP program in the GCG software package. , 14, 12, 10, 8, 6 or 4 and length weights 1, 2, 3, 4, 5 or 6 (Needleman and Wunsch, J. Mol. Biol., 48: 444). -453 (1970)). The percent homology of the two nucleotide sequences can also be determined using the GAP program in the GCG software package using NWSgapdna. It can be measured using a CMP matrix and gap weights 40, 50, 60, 70 or 80 and length weights 1, 2, 3, 4, 5 or 6. One skilled in the art can first perform the homology calculation, thereby adapting the algorithm parameters. A preferred parameter set (and parameters that should be used if the physician is unsure which parameter to apply to determine whether the molecule is within the homology limits of the claims) is the Blossum 62 scoring matrix Thus, a gap penalty 12, a gap extension penalty 4, and a frame shift gap penalty 5 are used. Additional methods of sequence alignment are known in the biotechnology art (see, eg, Rosenberg, BMC Bioinformatics, 6: 278 (2005); Altschul et al., FEBS J., 272 (20): 5101-5109 (2005)). reference).

  An “equivalent position” (eg, “equivalent amino acid position” or “equivalent nucleic acid position”) is referred to herein when optimally aligned using the alignment algorithm described herein. Defined as the position (eg, amino acid position or nucleic acid position) of the test polypeptide (or test polynucleotide) sequence that aligns with the corresponding position in the polypeptide (or reference polynucleotide) sequence. The equivalent amino acid position of the test polypeptide need not be the same numeric position number as the corresponding position of the reference polypeptide; similarly, the equivalent nucleic acid position of the test polynucleotide corresponds to the corresponding position of the reference polynucleotide. It need not be the same position number as the position.

  In some embodiments, the oc-FA pathway polypeptide is a variant of a reference (eg, parent) polypeptide, such as a variant of the example oc-FA pathway polypeptide described herein. As used herein, a “variant” (or “mutant”) polypeptide is a polypeptide having an amino acid sequence that differs from a parent (eg, wild-type) polypeptide by at least one amino acid. Point to. A variant can contain one or more conservative amino acid substitutions and / or can contain one or more non-conservative substitutions relative to the parent polypeptide sequence. In some embodiments, the variant polypeptide has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, compared to the parent polypeptide sequence. Has 50 or more amino acid substitutions, additions, insertions or deletions. In some embodiments, the sequence of the variant polypeptide is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least with the sequence of the parent polypeptide. 95%, at least 96%, at least 97%, at least 98% or at least 99% identical.

  In some embodiments, the oc-FA pathway polypeptide is a fragment of a reference (eg, parent) polypeptide, such as an example fragment of an oc-FA pathway polypeptide described herein. The term “fragment” refers to a shorter portion of a full-length polypeptide or protein ranging in size from four amino acid residues to the entire amino acid sequence minus one amino acid residue. In certain embodiments of the invention, a fragment refers to the entire amino acid sequence of a polypeptide or protein domain (eg, a substrate binding domain or catalytic domain).

  In some embodiments, a homologue, variant or fragment comprises one or more sequence motifs as defined herein. In one embodiment, a homologue, variant or fragment of a β-ketoacyl-ACP synthase polypeptide comprises one or more sequence motifs selected from SEQ ID NOs: 14-19. The determination that a sequence contains a particular sequence motif can be easily accomplished using, for example, the ScanProsite tool available on the World Wide Web site of the ExPASy proteomics server.

The oc-FA polypeptide has a conservative or non-essential amino acid substitution relative to the parent polypeptide that has no substantial effect on the biological function or properties of the oc-FA polypeptide. I hope you understand. Whether a particular substitution is tolerated (ie, does not adversely affect the desired biological function, such as enzyme activity) is, for example, Bowie
et al. (Science, 247: 1306-1310 (1990)).

  A “conservative amino acid substitution” is an amino acid substitution in which the amino acid residue is replaced with an amino acid residue having a similar side chain. A family of amino acid residues having similar side chains has been defined in the art. These families include basic side chains (eg lysine, arginine, histidine), acidic side chains (eg aspartic acid, glutamic acid), uncharged polar side chains (eg glycine, asparagine, glutamine, serine, threonine). , Tyrosine, cysteine), non-polar side chains (eg alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains ( For example, amino acids having tyrosine, phenylalanine, tryptophan, histidine) are included.

  Variants may occur naturally or may be generated in vitro. In particular, variants can be created using genetic engineering techniques such as site-directed mutagenesis, random chemical mutagenesis, exonuclease III deletion procedures or standard cloning techniques. Alternatively, such variants, fragments, analogs or derivatives can be created using chemical synthesis or modification procedures.

  Methods for producing mutants are well known in the art. These encode polypeptides with properties that enhance value in industrial or laboratory applications, including but not limited to increased catalytic activity (turnover number), improved stability and reduced feedback inhibition In order to produce a nucleic acid, a procedure is included that modifies the nucleic acid sequence obtained from the natural isolate. In such procedures, a number of modified nucleic acid sequences that differ by one or more nucleotides with respect to sequences obtained from natural isolates are generated and characterized. Typically, these nucleotide differences cause amino acid changes with respect to the polypeptide encoded by the nucleic acid of the natural isolate. For example, variants can be prepared by using random or site-directed mutagenesis.

  Variants can also be created by in vivo mutagenesis. In some embodiments, the random mutation in the nucleic acid sequence is an E. coli having a mutation in one or more of the DNA repair pathways. Generated by sequence propagation in bacterial strains such as E. coli strains. Such “mutagenesis” strains have a higher random mutation rate than wild type strains. Propagation of DNA sequences in one of these strains will ultimately generate random mutations in the DNA. Suitable mutant strains for use in in vivo mutagenesis are described, for example, in International Patent Application Publication No. WO1991 / 016427.

  Variants can also be generated using cassette mutagenesis. In cassette mutagenesis, a small region of a double-stranded DNA molecule is replaced with a synthetic oligonucleotide “cassette” that differs from the native sequence. Oligonucleotides often contain native sequences that are fully and / or partially randomized.

  Recursive ensemble mutagenesis can also be used to generate variants. Recursive ensemble mutagenesis is an algorithm for protein manipulation (ie, protein mutagenesis) that was developed to generate a diverse population of mutants with different member amino acid sequences but related phenotypes. is there. This method uses a feedback mechanism to control a series of combinatorial alkaset mutagenesis. Recursive ensemble mutagenesis is described, for example, in Arkin et al. , Proc. Natl. Acad. Sci. , U. S. A. 89: 7811-7815 (1992).

  In some embodiments, the variants are created using exponential ensemble mutagenesis. Exponential ensemble mutagenesis is a method for generating combinatorial libraries with a high proportion of unique functional mutants, in parallel with identifying amino acids that lead to functional proteins at each altered position. And a small group of residues is randomized. Exponential ensemble mutagenesis is described, for example, by Delegave et al. , Biotech. Res, 11: 1548-1552 (1993).

  Preferred fragments or variants of the parent polypeptide (eg, fragments or variants of the parent oc-FA pathway polypeptide) are some of the biological functions or properties (eg, enzyme activity, thermostability) of the parent polypeptide. Or keep everything. In some embodiments, fragments or variants retain at least 75% (eg, at least 80%, at least 90% or at least 95%) of the biological function or property of the parent polypeptide. In other embodiments, fragments or variants retain about 100% of the biological function or property of the parent polypeptide.

In some embodiments, a fragment or variant of the parent polypeptide exhibits increased catalytic activity relative to the parent polypeptide (e.g., higher turnover number, change) under conditions in which the recombinant microbial cells are cultured. PH reflectivity, as reflected by decreased K _{m for the} desired substrate or increased k _cat / K _m for the desired substrate). For example, if the parent polypeptide is endogenous to the thermophilic cell (ie, obtained from the thermophilic cell) and if the recombinant microbial cell is typically cultured at a lower temperature than the thermophilic cell, the parent polypeptide is May exhibit significantly reduced activity at lower temperatures, in which case the variant polypeptide may have increased catalytic activity relative to the parent polypeptide (eg, higher turnover number) at such lower temperatures. ) Is preferable.

  In other embodiments, the fragment or variant of the parent polypeptide exhibits improved stability relative to the stability of the parent polypeptide under conditions in which the recombinant microbial cells are cultured. Such stability may include stability against changes in temperature, ionic strength, pH or any other difference in growth or media conditions between the recombinant microbial cell and the cell from which the parent polypeptide was obtained. For example, a parent polypeptide is relatively unstable at higher temperatures when the parent polypeptide is obtained from cold-tolerant cells, and when recombinant microbial cells are generally cultured at higher temperatures than cold-tolerant cells. In this case, it is preferred that the mutant polypeptide exhibits improved stability relative to the stability of the parent polypeptide at such high temperatures.

  In other embodiments, a fragment or variant of the parent polypeptide is against cellular cell metabolite or culture medium components against such inhibition exhibited by the parent polypeptide under conditions in which the recombinant microbial cells are cultured. Shows a decrease in the inhibition of catalytic activity due to (eg, a decrease in feedback inhibition).

  In certain embodiments, the oc-FA pathway polypeptide is a homologue, fragment or variant of the parent polypeptide, and the oc-FA pathway polypeptide is used to perform the oc-FA pathway reaction in recombinant microbial cells. It is valid. Such oc-FA pathway polypeptides are suitable for use in the recombinant microbial cells of the invention.

  The effectiveness of a test polypeptide (eg, an oc-FA pathway polypeptide described herein or a homologue, fragment or variant thereof) in performing an oc-FA pathway reaction is measured by several methods. be able to. For example, to determine the effectiveness of a test polypeptide in catalyzing a particular reaction in a biochemical pathway, first, except for the particular pathway reaction being tested, all necessary to catalyze the biochemical pathway reaction in question Manipulate cells (if necessary) to obtain parental cells that contain activity (in some cases, the parental cell may express endogenous polypeptide (s) that catalyze the particular pathway reaction being tested. In such cases, however, the intrinsic activity is preferably low enough to readily detect an increase in product due to the activity of the test polypeptide). A polynucleotide encoding a test polypeptide operably linked to a suitable promoter (eg, in an expression vector) is then introduced into the parent cell to generate a test cell. Test cells and parent cells are cultured separately under identical conditions sufficient for expression of pathway polypeptides in parent and test cell cultures and expression of test polypeptides in test cell cultures. Samples are taken from the test cell culture and the parent cell culture at various times during and / or after culture. Samples are analyzed for the presence of specific pathway intermediates or products. The presence of pathway intermediates or products is not limited, but includes gas chromatography (GC), mass spectrometry (MS), thin layer chromatography (TLC), high performance liquid chromatography (HPLC), liquid chromatography (LC). It can be measured by methods including GC with a flame ionization detector (GC-FID), GC-MS and LC-MS. The presence of the oc-FA pathway intermediate or product in the test cell culture sample (s) and the absence of the oc-FA pathway intermediate or product (or amount) in the parent culture sample (s). Lower) suggests that the test polypeptide is effective in performing the oc-FA pathway reaction and is suitable for use in the recombinant microbial cells of the invention.

Production of Odd-Chain Fatty Acid Derivatives in Recombinant Microbial Cells In one aspect, the invention provides a method for making an odd-chain fatty acid derivative composition, wherein a recombinant polynucleotide sequence is expressed in a culture medium containing a carbon source. A method comprising culturing the recombinant microbial cell of the present invention under conditions effective for the purpose and appropriately isolating the produced odd-chain fatty acid derivative composition.

  “Odd chain fatty acid derivative composition” (abbreviated as “oc-FA derivative composition”) includes, for example, odd chain fatty acids, odd chain fatty esters (eg, odd chain fatty methyl esters, odd chain fatty ethyl esters, odd chain waxes). Esters), odd chain fatty aldehydes, odd chain fatty alcohols, even chain hydrocarbons (even chain alkanes, even chain alkenes, even chain terminal olefins, even chain internal olefins, etc.) or odd numbers as defined herein A composition comprising a chain fatty acid derivative. Similarly, an “odd chain fatty acid composition” is a composition that includes an odd chain fatty acid, an “odd chain fatty alcohol composition” is a composition that includes an odd chain fatty alcohol, and an “even chain alkane composition”. Are compositions containing even chain alkanes and the like. It should also be understood that compositions comprising odd chain fatty acid derivatives may also comprise even chain fatty acid derivatives.

  In one aspect, the invention provides a method of making a composition comprising an odd-chain fatty acid derivative, wherein: (a) lacks or is effective enzymatic activity to produce an increased amount of propionyl-CoA. A polypeptide encoding a polypeptide having said enzymatic activity effective to produce increased amounts of propionyl-CoA in recombinant microbial cells relative to the amount of propionyl-CoA produced in the parental microbial cell having reduced A nucleotide and at least one polypeptide is foreign to the recombinant microbial cell, or the expression of at least one polynucleotide is modulated in the recombinant microbial cell relative to the expression of the polynucleotide in the parental microbial cell. (B) Utilizing propionyl-CoA as a substrate A recombinant microbial cell (eg, a recombinant microorganism) comprising a polynucleotide encoding a polypeptide having ketoacyl-ACP synthase activity and (c) one or more polynucleotides encoding a polypeptide having fatty acid derivative enzyme activity In which the recombinant microbial cells are cultured under conditions effective to express the polynucleotides according to (a), (b) and (c) in the presence of a carbon source. Producing a fatty acid derivative composition containing an odd-chain fatty acid derivative and an even-chain fatty acid derivative, and expressing the polynucleotide according to (a), (b) and (c) in a culture medium containing a carbon source. Recombinant microbial cells under conditions effective to produce a fatty acid derivative composition that also includes an odd chain fatty acid derivative and an even chain fatty acid derivative And a method comprising appropriately recovering the composition from the culture medium.

  In some embodiments, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% by weight of the fatty acid derivative in the composition. % By weight, at least 80% by weight or at least 90% by weight are odd chain fatty acid derivatives. In some embodiments, the fatty acid derivative composition is at least 10 mg / L, at least 15 mg / L, at least 20 mg / L, at least 25 mg / L, at least 50 mg / L, at least 75 mg / L, at least 100 mg / L, at least 125 mg. / L, at least 150 mg / L, at least 175 mg / L, at least 200 mg / L, at least 225 mg / L, at least 250 mg / L, at least 275 mg / L, at least 300 mg / L, at least 325 mg / L, at least 350 mg / L, at least 375 mg / L, at least 400 mg / L, at least 425 mg / L, at least 450 mg / L, at least 475 mg / L, at least 500 mg / L, at least 525 mg / L, at least 550 mg / L, at least 575 mg / L, at least 600 mg / L, at least 625 mg / L, at least 650 mg / L, at least 675 mg / L, at least 700 mg / L, at least 725 mg / L, at least 750 mg / L, at least 775 mg / L, at least 800 mg / L, at least 825 mg / L, at least 850 mg / L, at least 875 mg / L, at least 900 mg / L, at least 925 mg / L, at least 950 mg / L, at least 975 mg / L, at least 1000 mg / L, at least 1050 mg / L, at least 1075 mg / L, at least 1100 mg / L, at least 1125 mg / L, at least 1150 mg / L, at least 1175 mg / L, at least 200 mg / L, at least 1225 mg / L, at least 1250 mg / L, at least 1275 mg / L, at least 1300 mg / L, at least 1325 mg / L, at least 1350 mg / L, at least 1375 mg / L, at least 1400 mg / L, at least 1425 mg / L, at least 1450 mg / L, at least 1475 mg / L, at least 1500 mg / L, at least 1525 mg / L, at least 1550 mg / L, at least 1575 mg / L, at least 1600 mg / L, at least 1625 mg / L, at least 1650 mg / L, at least 1675 mg / L, at least 1700 mg / L, at least 1725 mg / L, at least 1750 mg / L, at least 1775 mg / L, less 1800 mg / L, at least 1825 mg / L, at least 1850 mg / L, at least 1875 mg / L, at least 1900 mg / L, at least 1925 mg / L, at least 1950 mg / L, at least 1975 mg / L, at least 2000 mg / L, at least 3000 mg / L, In an amount of at least 4000 mg / L, at least 5000 mg / L, at least 6000 mg / L, at least 7000 mg / L, at least 8000 mg / L, at least 9000 mg / L, at least 10000 mg / L, at least 20000 mg / L (eg, titer), or Odd-chain fatty acid derivatives are included in the range bounded by any two of the above values.

  In various embodiments, the fatty acid derivative enzyme activity includes thioesterase activity, ester synthase activity, fatty aldehyde biosynthesis activity, fatty alcohol biosynthesis activity, ketone biosynthesis activity and / or hydrocarbon biosynthesis activity. In some embodiments, the recombinant microbial cell comprises a polynucleotide that encodes two or more polypeptides, each polypeptide having a fatty acid derivative enzyme activity.

  In various embodiments, the recombinant microbial cell comprises an odd chain fatty acid, an odd chain fatty ester, an odd chain wax ester, an odd chain fatty aldehyde, an odd chain fatty alcohol, an even chain alkane, an even chain alkene, an even chain internal olefin, an even number. A composition comprising a chain end olefin or an even chain ketone is produced.

  In various embodiments, the recombinant microbial cell comprises (i) a polynucleotide encoding a polypeptide having aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity, or ( ii) a polynucleotide encoding a polypeptide having (R) -citramalate synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity, or (iii) methylmalonyl-CoA mutase activity, methylmalonyl A polypeptide having CoA decarboxylase activity and / or methylmalonyl-CoA carboxyltransferase activity or (i) and (ii) or (i) and (iii) or (ii) (Iii) or a polynucleotide encoding a polypeptide selected from (i), (ii) and (iii) which has an enzymatic activity effective in producing increased amounts of propionyl-CoA in recombinant microbial cells. And wherein at least one polypeptide is foreign to the recombinant microbial cell or the expression of at least one polynucleotide is modulated in the recombinant microbial cell relative to the expression of the polynucleotide in the parental microbial cell. Has been.

  Fatty acid derivative compositions comprising odd chain fatty acid derivatives produced by the methods of the present invention can be recovered or isolated from recombinant microbial cell cultures. As used herein, the term “isolated” with respect to products such as fatty acid derivatives refers to products separated from cell components, cell culture media or chemical or synthetic precursors. The fatty acid derivatives produced by the methods described herein can be relatively immiscible in the fermentation broth as well as in the cytoplasm. Thus, fatty acid derivatives can be collected in either the intracellular or extracellular organic phase. Collecting the product in the organic phase can reduce the effect of fatty acid derivatives on cell function and allow the recombinant microbial cells to produce more product.

  In some embodiments, the fatty acid derivative composition (including odd chain fatty acid derivatives) produced by the methods of the invention is purified. As used herein, the term “purify”, “purified” or “purification” means removing or isolating a molecule from its environment, eg, by isolation or separation. “Substantially purified” molecules are at least about 60% (eg, at least about 70%, at least about 75%, at least about 85%, at least about 90%, at least about 95%) of their associated other components. , At least about 97%, at least about 99%). As used herein, these terms also refer to removing contaminants from a sample. For example, removal of contaminants can result in an increase in the proportion of fatty acid derivatives (eg, fatty acids or fatty alcohols or fatty esters or hydrocarbons) relative to other components in the sample. For example, when a fatty ester or fatty alcohol is produced in a recombinant microbial cell, the fatty ester or fatty alcohol can be purified by removal of the recombinant microbial cell protein. After purification, the proportion of fatty ester or fatty alcohol in the sample to other components increases.

  As used herein, the terms “purify”, “purified” and “purification” are relative terms that do not need to be completely pure. Thus, for example, when a fatty derivative composition is produced in a recombinant microbial cell, the purified fatty acid derivative composition may be other cellular components (eg, nucleic acids, polypeptides, lipids, carbohydrates or other hydrocarbons). Is a fatty acid derivative composition substantially separated from

  The fatty acid derivative composition (including odd chain fatty acid derivatives) can be present in the extracellular environment or can be isolated from the extracellular environment of recombinant microbial cells. In certain embodiments, the fatty acid derivative is secreted from the recombinant microbial cell. In other embodiments, the fatty acid derivative is transported to the extracellular environment. In yet other embodiments, the fatty acid derivative is passively transported to the extracellular environment. Fatty acid derivatives can be isolated from recombinant microbial cells using methods known in the art.

Fatty acid derivatives (including odd chain fatty acid derivatives produced by the method of the present invention) can be distinguished from petrochemical carbon-derived organic compounds based on double carbon isotope fingerprinting or ¹⁴ C dating . Furthermore, the specific source of biosourced carbon (eg, glucose versus glycerol) can be determined by a double carbon isotope fingerprinting method (see, eg, US Pat. No. 7,169,588).

  The ability to distinguish fatty acid derivatives produced by recombinant microbial cells from petroleum-based organic compounds is beneficial for tracking these materials for commercial purposes. For example, organic compounds or chemicals that contain both bio-based and petroleum-based carbon isotope profiles can be distinguished from organic compounds and chemicals made only from petroleum-based materials . Thus, materials prepared by the methods of the present invention can be tracked commercially based on unique carbon isotope profiles.

Fatty acid derivatives produced by recombinant microbial cells can be distinguished from petroleum-based organic compounds by comparing the stable carbon isotope ratio ( ¹³ C / ¹² C) in each fuel. The ¹³ C / ¹² C ratio in those given fatty acid derivatives produced by the method of the present invention is the result of the ¹³ C / ¹² C ratio in atmospheric carbon dioxide when the carbon dioxide is fixed. This also reflects the exact metabolic pathway. Regional variations also occur. Petroleum, _{C 3} plants (hardwoods), _{C 4} plants (grass), all marine carbonates ^show significant differences in 13 ^{C / 12} C and the corresponding [delta] ¹³ C values. In addition, C ₃ and C ₄ plant lipid substances are analyzed differently from substances obtained from carbohydrate components of the same plant as a result of metabolic pathways.

^The scale for measuring ¹³ C was originally defined with Pee Dee Belemnite (PDB) limestone set to zero, and the value is given in thousandths of deviation from this material. "[Delta] ¹³ C" values are expressed in parts per thousand deviations (per mil), abbreviated _^0/00, calculated as follows:
_{^{δ 13 C (0/00)}} = [(13 C / 12 C) _sample - ^{(13 C /} 12 ^{C) _Standard] / (13 C / 12 C} ) _standard × 1000

In some embodiments, the δ ¹³ C of the fatty acid derivative produced by the methods of the present invention has about −30 or more, about −28 or more, about −27 or more, about −20 or more, about −18 or more, about − 15 or more, about −13 or more, or about −10 or more. Alternatively, or in addition, the δ ¹³ C of the fatty acid derivative is about −4 or less, about −5 or less, about −8 or less, about −10 or less, about −13 or less, about −15 or less, about −18 or less, or about − 20 or less. Thus, the fatty acid derivative can have δ ¹³ C linked by any two of the above termini. For example, the δ ¹³ C of the fatty acid derivative is about −30 to about −15, about −27 to about −19, about −25 to about −21, about −15 to about −5, about −13 to about −7, or It can be from about −13 to about −10. In some embodiments, the δ ¹³ C of the fatty acid derivative may be about −10, −11, −12, or −12.3. In other embodiments, the δ ¹³ C of the fatty acid derivative is about −15.4 or greater. In yet other embodiments, the δ ¹³ C of the fatty acid derivative is from about −15.4 to about −10.9, or δ ¹³ C is from about −13.92 to about −13.84.

Fatty acid derivatives produced by recombinant microbial cells can also be distinguished from petroleum-based organic compounds by comparing the amount of ¹⁴ C in each compound. ^Since the nuclear half-life of ¹⁴ C is 5730 years, petroleum-based fuels containing “old” carbon can be distinguished from fatty acids or derivatives thereof containing “new” carbon (eg, Currie, “ Source Affirmation of Atmospheric Particulates ", Characterization of
Environmental Particles, J. Org. Buffle and H.C. P. van Leeuwen, Eds. , Vol. I of the IUPAC Environmental Analytical Chemistry Series, Lewis Publishers, Inc. , Pp. 3-74 (1992)).

As used herein, “modern carbon fraction” or “f _M ” refers to National Institute of Standards and Technology (NIST) Standards (SRM) 4990B, known as oxalic acid standards HOxI and HOxII, respectively. And have the same meaning as defined by 4990C. The basic definition relates to 0.95 times the ¹⁴ C / ¹² C isotope ratio of HOxI (see AD1950). This is almost equivalent to the pre-industrial forest with attenuation correction. In the biosphere living of the modern (plant material), _{f M} is about 1.1.

In some embodiments, the fatty acid derivative produced by the method of the present invention has an f _M ¹⁴ C of at least about 1, such as at least about 1.003, at least about 1.01, at least about 1.04, at least about 1.04. 1.111, at least about 1.18, or at least about 1.124. Alternatively, or in addition, the fatty acid derivative has an f _M ¹⁴ C of about 1.130 or less, about 1.124 or less, about 1.18 or less, about 1.111 or less, about 1.04 or less. Thus, the fatty acid derivative can have f _M ¹⁴ C joined by any two of the termini. For example, a fatty acid derivative is from about 1.003 to about 1.124 of _f ^{M 14} C, about 1.04 from about 1.18 _f ^{M 14} C _f ^{M 14} or about 1.111 to about 1.124, C can be included.

  All references cited in this specification, including publications, patent applications, and patents, are incorporated herein by reference, with each reference indicated to be incorporated individually and specifically by reference. Incorporated herein by reference to the same extent as

  The use of the terms “a” and “an” and “the” and similar designations in the context of describing the present invention (especially in the context of the following claims) and unless otherwise indicated herein. Or unless otherwise clearly contradicted by context, it shall cover both singular and plural. The terms “comprising”, “having”, “including” and “including” are to be interpreted as open-ended terms unless specifically stated otherwise (ie, , Including "). Unless otherwise indicated herein, the description of a range of values herein is merely used as a simplified way of referring to each individual value contained within the range, and each individual value Are incorporated herein as if individually described herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any examples or exemplary phrases used herein (eg, “eg”, “such as”, “for example”) merely make the present invention more useful. It is for clarity and is not intended to limit the scope of the invention unless specifically claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

  Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Modifications to those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects those skilled in the art to use such modifications as appropriate, and the inventor specifically intends the invention to be implemented in ways other than those described herein. Yes. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Medium composition Che-9 medium: further NH ₄ Cl (further 1 g / L), bis-Tris buffer (0.2 M), Triton X-100 (0.1% v / v) and trace minerals (FeCl ₃ .6H) _{2 O 27mg / L, ZnCl.4H 2} O 2mg / L, CaCl 2 .6H 2 O 2mg / L, Na 2 MoO 4 .2H 2 O 2mg / L, CuSO 4 .5H 2 O 1.9mg / L, H M9 supplemented with ₃ BO ₃ 0.5 mg / L, concentrated HCl 100 mL / L).
2NBT: Che-9 supplemented with glucose 20 g / L (2% w / v).
4NBT: Che-9 supplemented with glucose 40 g / L (4% w / v).

Bacterial strains and plasmids Kori MG1655 ΔfadE (“D1” strain)
This example describes the construction of recombinant microbial cells with attenuated fatty acid degrading enzyme expression. An E. coli encoding acyl coenzyme A dehydrogenase (GenBank accession number AAC73325) involved in fatty acid degradation. The E. coli fadE gene (also known as yafH) is described in Datsenko, K. et al. A. et al. (Proc. Natl. Acad. Sci. USA 97: 6640-6645 (2000)), using the Red system described above and making the following modifications. It was deleted from the E. coli strain MG1655.

The following two primers were used to create a deletion of fadE.
Del-fadE-F 5 'AAAAACAGGCA ACAATGTGAG CTTTGTTGTAATTAT ATTGTAA ACATTT GATTCCGGGGATCCGTCGACC (SEQ ID NO: 82); and Del-fade-R 5'

Del-fadE-F and Del-fadE-R primers were used to amplify a kanamycin resistance (Km ^R ) cassette from plasmid pKD13 by PCR (Datsenko et al., Supra). This PCR product is then used to express Red recombinase (Datsenko et al., Supra) and electrocompetent E. coli containing plasmid pKD46 that has been induced with arabinose for 3-4 hours. E. coli MG1655 cells were transformed. After growth for 3 hours at 37 ° C. in SOC medium, the cells were seeded on Luria agar plates containing 50 μg / mL kanamycin. Resistant colonies were identified and isolated after overnight incubation at 37 ° C. E. By PCR amplification using primers fadE-L2 and fadE-R1 designed to be adjacent to the coli fadE gene, disruption of the fadE gene was confirmed in some of the colonies. fadE-L2 5′-CGGGCAGGTGCTCATGACCAGGAC (SEQ ID NO: 84); and fadE-R1 5′-CGCGCGGTGACCGGCAGCCCTG (SEQ ID NO: 85)

After confirming the fadE deletion, using a single colony, pCP20 plasmids were removed Km ^R marker used (Datsenko et al., supra). The MG1655 E. fedE gene was deleted and the Km ^R marker was removed. The strain E. coli is E. coli. It was designated as E. coli MG1655 ΔfadE or “D1” strain.

E. Kori MG1655 ΔfadE_ΔtonA (“DV2” strain)
This example describes the construction of recombinant microbial cells with attenuated fatty acid degrading enzyme expression and outer membrane protein receptor expression. An E. coli encoding ferrichrome outer membrane transporter (GenBank accession number NP — 414692) that also acts as a bacteriophage receptor. The tonA (also known as fhuA) gene of E. coli MG1655 was obtained from Datsenko et al. Using the Red system according to the above, the following modifications were made and deleted from the D1 strain (described above).

The primers used to create the tonA deletion were as follows: Del-tonA-F 5'-ATCATTCTCGTTTACGTTACATTCACTTTATACATCAGAGATATACAC
CAATGATCTCGGGGATCCGTCGACC (SEQ ID NO: 86); and Del-tonA-R 5'-GCACCGGAAATCCGTGCCCCAAAAGAGAAAATTAGAAACGGAAG
GTTGCGGG TTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 87)

Del-ton A-F and Del-ton A-R primers were used to amplify a kanamycin resistance (Km ^R ) cassette from plasmid pKD13 by PCR. The PCR product obtained in this way was electrocompetent E. coli containing pKD46 that had already been induced with arabinose for 3-4 hours. E. coli MG1655 D1 cells (Datsenko
et al. , Above) was used to transform. After growth for 3 hours at 37 ° C. in SOC medium, the cells were seeded on Luria agar plates containing 50 μg / mL kanamycin. Resistant colonies were identified and isolated after overnight incubation at 37 ° C. E. The disruption of the tonA gene was confirmed in some of the colonies by PCR amplification using primers adjacent to the coli tonA gene: tonA-verF and tonA-verR.
tonA-verF 5′-CAACAGCAACCCTGCTCCAGCAA (SEQ ID NO: 88); and tonA-verR 5′-AAGCTGGAGCAGCAAAGCGTT (SEQ ID NO: 89)

After confirming the tonA deletion, using a single colony, pCP20 plasmids were removed Km ^R marker used (Datsenko et al., supra). MG1655 obtained by deleting the fadE and tonA genes. E. coli strain It was referred to as the E. coli MG1655 ΔfadE ΔtonA or “DV2” strain.

E. Coli MG1655 ΔfadE_ΔtonA lacI: tesA ("DV2 'tesA" strain)
This example describes the construction of a recombinant microbial cell comprising a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity. E. The tesA polynucleotide sequence encoding coliacyl-CoA thioesterase I (EC 3.1.1.5, 3.1.2.-; eg, GenBank accession number AAC73596; SEQ ID NO: 64) is used to remove the leader sequence. Thus, the 25 amino acids of the resulting 'tesA gene product were cleaved and the original amino acid at position 26, alanine, was replaced with methionine, which was replaced with the first amino acid of the' TesA polypeptide sequence. (SEQ ID NO: 65; Cho et al., J. Biol. Chem., 270: 4216-4219 (1995)).

Integration cassette containing operably linked 'tesA coding sequence P _Trc promoter and kanamycin resistance gene, primers lacI Forward: GGCTGGCTGGCATAAATATCTC (SEQ ID NO: 90) and lacZ Reverse: GCGTTAAAGTTGTTCTGCTTCATCAGCAGGATATCCTGCACCATCGTCTGGATTTTGAACTTTTGCTTTGCCACGGAAC (SEQ ID NO: 91)
PCR amplified from the plasmid _pACYC-P Trc _-tesA using (Example 1, below), and electroporated into DV2 strain was incorporated into the chromosome by using the Red recombinase expressed from plasmid pKD46 (Datsenko et al .,the above). Transformants were selected on LB plates supplemented with kanamycin. Correct integration was assessed using diagnostic PCR.

pDG2 Expression Vector The pDG2 expression vector was the plasmid that served as the basis for many of the constructs described below. The pCDFDuet-1 vector (Novagen / EMD Biosciences) has a CloDF13 replicon, a lacI gene and a streptomycin / spectinomycin resistance gene (aadA). To construct the pDG2 plasmid, the C-terminal part of the plsX gene containing an internal promoter for the downstream fabH gene (Podkovylov and Larson, Nucl. Acids Res.
(1996) 24 (9): 1747-1752 (1996)) with primers 5'-TGAATTCCATGGCGCAACTCACTCTTCTTTTTAGTCCG-3 '(SEQ ID NO: 92) and 5'-CAGTACCTCGAGTCTCTCTATACATGCGCCT CAGTACAC-3' (SEQ ID NO: 93)
Using E. Amplified from E. coli MG1655 genomic DNA. These primers introduced NcoI and XhoI restriction sites and an internal NdeI site near the ends.

  Both the plsX insert (containing the EcfabH promoter) and the pCDFDuet-1 vector were digested with the restriction enzymes NcoI and XhoI. The digested vector was treated with Antarctic Phosphatase. The insert was ligated into the vector and transformed into competent E. coli. E. coli cells were transformed. Clones were screened by DNA sequencing. The pDG2 plasmid sequence is referred to herein as SEQ ID NO: 73.

FabH expression plasmid The pDG6 plasmid expressing subtilis FabH1 was constructed using the pDG2 plasmid. The fabH1 coding sequence comprises primers 5′-CCTTGGGGCATATGAAAGCTG-3 ′ (SEQ ID NO: 94) and 5′-TTTAGTCATCTCGAGTGCACCTCACCTT-3 ′ (SEQ ID NO: 95).
Was amplified from Bacillus subtilis strain 168. These primers introduced NdeI and XhoI restriction sites at the ends of the amplification products.

  Both the fabH1 insert and the pDG2 vector were digested with the restriction enzymes NdeI and XhoI. The digested vector was treated with Antarctic Phosphatase. The insert was ligated into the vector and transformed into competent E. coli. E. coli cells were transformed. Clones were screened by DNA sequencing. The pDG6 plasmid sequence is referred to herein as SEQ ID NO: 74, and is B. pylori under the control of the EcfabH promoter. A subtilis FabH1 polypeptide (SEQ ID NO: 2) is expressed.

  Other plasmids based on pDG2 were prepared using a strategy similar to that used for the pDG6 plasmid. Plasmid pDG7 is A Bacillus subtilis fabH2 coding sequence that expresses a subtilis FabH2 polypeptide (SEQ ID NO: 3) is included. Plasmid pDG8 is S. pylori. It contains the Streptomyces coelicolor fabH coding sequence that expresses the Coericolor FabH polypeptide (SEQ ID NO: 4).

_pACYC-P Trc -tesA and _pACYC-P Trc2 _-tesA plasmid plasmid _{pACYC-P Trc ^is,} lacI _{^q, P Trc} promoter and pTrcHis2A (Invitrogen, Carlsbad, CAA) primer terminator region pTrc_F TTTCGCGAGGCCGGCCCCGCCAACACCCGCTGACG (SEQ ID NO: 96) and pTrc_R AAGGACGTCTTTAATTAATCAGGAGAGCGTTTCACCGACAA (SEQ ID NO: 97)
Was constructed by PCR amplification using

The PCR product was then digested with AatII and NruI and inserted into plasmid pACYC177 (Rose, RE, Nucleic Acids Res., 16: 356 (1988)) digested with AatII and ScaI. The nucleotide sequence of the pACYC-P _Trc vector is SEQ ID NO: 75 herein.

To generate the _{pACYC-P Trc2} plasmid, introducing the single point mutation in the _{P Trc} promoter _{pACYC-P Trc} plasmid was generated mutant promoter _{PT rc2} and _{pACYC-P Trc2} plasmid. The wild type _PTrc promoter sequence is referred to herein as SEQ ID NO: 76, and the _PTrc2 mutant promoter is referred to herein as SEQ ID NO: 77.

E. The nucleotide sequence encoding coliacyl-CoA thioesterase I (TesA, EC 3.1.1.5, 3.1.2.-; eg, GenBank accession number AAC73596. SEQ ID NO: 64) is used to remove the leader sequence. Thus, the 25 amino acids of the resulting 'tesA gene product are cleaved and the original amino acid at position 26, alanine, is replaced with methionine, which becomes the first amino acid of the' TesA polypeptide. (SEQ ID NO: 65; Cho et al., J. Biol. Chem., 270: 4216-4219 (1995)). DNA encoding the 'TesA polypeptide was inserted into the NcoI and EcoRI sites of _{pACYC-P Trc} vector and _{pACYC-P Trc2} vector, respectively to generate the _{pACYC-P Trc} -'tesA and _{pACYC-P Trc2} -'tesA plasmid. The correct insertion of the 'tesA sequence into the plasmid was confirmed by restriction digestion.

pOP80 plasmid The pOP80 plasmid was cloned into the cloning vectors pCL1920 (GenBank AB236930; Lerner CG and Inouye M., Nucleic Acids Res. 18: 4631 with the restriction enzymes AflII and SfoI.
(1990)). Three types of DNA fragments were generated by this digestion. The 3737 bp fragment was gel purified using a gel purification kit (Qiagen, Inc., Valencia, CA). In parallel, DNA sequence fragment containing the _{P Trc} promoter and lacI region of commercially available plasmid pTrcHis2 (Invitrogen, Carlsbad, CA) with primers LF302 (5'-atatgacgtcGGCATCCGCTTACAGACA-3 ' , SEQ ID NO: 98) and LF303 (5' -AattcttaagTCAGGAGAGCCGTTCACCGACAA-3 ', SEQ ID NO: 99) was used for PCR amplification and introduction of ZraI and AflII enzyme recognition sites, respectively. After amplification, the PCR product was purified using a PCR purification kit (Qiagen, Inc. Valencia, CA) and digested with ZraI and AflII according to the recommendations of the supplier (New England BioLabs Inc., Ipswich, Mass.). . After digestion, the PCR product was gel purified, ligated with 3737Bp DNA sequence fragment derived from _pCL1920, to generate the expression vector pOP80 containing _{P Trc} promoter.

L. Monocytogenes fabH1 and fabH2 plasmids (pTB.079 and pTB.081)
The genomic DNA of Listeria monocytogenes Li23 (ATCC 19114D-5) was used as a template for amplifying the fabH gene using the following primers. TREE044 (fabH_forward) GAGGAATAAAACCCATGAACGCAGGAATTTTAGGATAGTAG (SEQ ID NO: 100); Primer 61 (fabH_reverse) CCCAAGCTTCGAATTCTTACTTACCCCAACGAATGATAGTAG (SEQ ID NO: 101)

Next, (vector based pCL1920 with the phage lambda _{P L} promoter, SEQ ID NO: 78) The PCR product pDS80 cloned into NcoI / EcoRI site of transformation competent E. E. coli cells were transformed. Individual colonies were picked to verify the sequence of the cloned insert. Wild type L. The nucleic acid sequence of monocytogenes fabH encodes the wild type LmFabH1 protein (SEQ ID NO: 7), and the plasmid expressing this sequence is pTB. 079.

  Mutant L. The monocytogenes fabH gene was found to contain a T-to-G change at position 928, and in the expressed protein a tryptophan (W) to glycine (G) change at amino acid position 310, ie a W310G variant occured. Mutant L. encoding the FabHW310G variant The monocytogenes fabH gene (SEQ ID NO: 8) is referred to as LmFabH2, and the plasmid expressing this sequence is pTB. It was called 081.

FabOP expression plasmid based on pOP80 Each gene was PCR amplified from the indicated templates and primers (Table 6). E. The natural sequence type of each gene was used except for PffabH (SEQ ID NO: 150) using the colicodon optimized sequence. The genes PffabH (opt), DpfabH1 and DpfabH2 were synthesized by DNA2.0 (Menlo Park, CA). The cloning vector was also PCR amplified with primers PTrc_vector_F and PTrc_vector_R (Table 7) using plasmid OP80 as template. The different fabH genes were then cloned into the PCR amplified OP80 vector backbone using InFusion cloning (Clontech, Mountain View CA). The standard protocol outlined by the manufacturer was followed. All constructs were verified by sequencing.

E. for the production of odd chain fatty acids by route (A). The following examples serve to increase the metabolic flux through the intermediate threonine and α-ketobutyric acid through the pathway (A) of FIG. 2 to propionyl-CoA, and in these recombinant cells odd-chain acyl- Recombinant E. coli expressing a foreign gene encoding an enzyme that causes increased production of ACP and odd-chain fatty acid derivatives and / or overexpressing an endogenous gene. Describes the construction of E. coli strains.

  This example also demonstrates the effect on attenuation of endogenous gene expression and the replacement of endogenous gene with exogenous gene on oc-FA production. In this example, β-ketoacyl-ACP synthase is Endogenous E. coding The expression of the coli fabH gene is attenuated by gene deletion, and β-ketoacyl-ACP synthase activity is expressed in exogenous B. cerevisiae. Supplied by expression of the subtilis fabH1 gene.

DV2 P _L thrA ^* BC
Chromosomal genes involved in threonine biosynthesis is in the control of a strong chromosomal integration lambda P _L promoter, recombinant E. One of the genes mutated A strain of E. coli was constructed.

In order to introduce one mutation into the native aspartokinase I (thrA) gene, Two parts of the gene were amplified from E. coli MG1655 DNA. The first part was amplified using primers TREE026 and TREE028, while the second part was amplified using TREE029 and TREE030 (Table 6). The primers used to amplify the two components then contained overlapping sequences that were used to “stitch” the individual compartments together. Two PCR products were combined with one PCR reaction and primers TREE026 and TREE030 to amplify the entire thrA gene. Primers TREE028 and TREE029 were designed to create a mutation at codon 345 of native thrA, resulting in the S345F variant of aspartokinase I (SEQ ID NO: 21). This mutation has been shown to eliminate feedback inhibition of the enzyme by threonine in the host strain (Ogawa-Miyata, Y., et al., Biosci. Biotechnol. Biochem. 65: 1149-1154 (2001); Lee J. -H., Et al., J. Bacteriol 185: 5442-5451 (2003)). The modified version of this gene was called “thrA ^* ”.

P _L promoter, using primers Km_trc_overF and TREE027 (Table 8), the plasmid as a template PDS80 (vector was based pCL1920 with the phage lambda _{P L} promoter; SEQ ID NO: 78) was amplified using. This fragment was then ligated into the kanamycin resistance cassette adjacent to the FRT site and amplified from plasmid pKD13 using primers TREE025 and Km_trc_overR (Table 8). The PCR product obtained containing KmFRT cassette and _{P L} promoter by connecting the thrA ^* PCR products. Using primers TREE025 and TREE030, it was amplified whole _KmFRT-P L -thrA ^* mutagenesis cassette. These primers also contain about 50 bp homologous to the integration site at the 5 ′ end, the entire thrA gene homologous to the 3 ′ end, and a cassette that is part of an operon containing the thrA, thrB and thrC genes. Target to the natural thrA site of E. coli. This mutagenesis cassette was transformed into the parent strain E. coli containing the helper plasmid pKD46 expressing Red recombinase. electroporation into E. coli DV2 (Example 1) (Datsenko et al., supra). Clones containing chromosomal integration were selected in the presence of kanamycin and verified by diagnostic PCR. The kanamycin marker was then removed by expression of the pCP20 plasmid (Datsenko et al., Supra). Proper integration and marker removal was verified by PCR and sequencing. The strains obtained mutant thrA ^* gene and the endogenous thrB and thrC gene is overexpressed by chromosomal integration lambda _{P L} promoter, DV2
It was referred to as P _L thrA ^* BC.

DV2 P _L thrA ^* BC P _L tdcB
Natural E. coli Coli catabolic threonine deaminase (tdcB) gene (also known as threonine down ammonia lyase) incorporates additional copies of the gene into lacZ locus, it is overexpressed by placing under the control of a strong chromosomal integration lambda P _L promoter It was.

  Catabolic threonine deaminase catalyzes the degradation of threonine to α-ketobutyric acid, the first reaction in the threonine degradation / isoleucine production pathway. The catalyzed reaction is believed to be responsible for first the elimination of water (thus this enzyme was initially classified as a threonine dehydrase) and then the product isomerization and hydrolysis by C-N bond cleavage. . Increased expression of this gene has been shown to dramatically increase isoleucine levels in heterologous organisms (Guillouet S. et al., Appl. Environ. Microbiol. 65: 3100-3107 (1999)). Furthermore, threonine deaminase is relatively resistant to the isoleucine feedback mechanism (Guilleuet et al., Supra).

E. E. coli MG1655 genomic DNA was amplified using primers TREE020 and TREE021 (Table 8) to obtain the native tdcB gene. At the same time, primers Kan / Chlor1 and Kan / Chlor4 (Table 8) were used to amplify the FRT-kanamycin resistance cassette for use in integration selection / screening as previously described. E. as a mold. Using E. coli MG1655 genomic DNA, primers EG238 and TREE018 (Table 8) were used to amplify the 3 ′ region homologous to the lacZ integration site, while primers TREE022 and TREE023 (Table 8) were homologous to the lacZ site. Used to amplify the 5 'region. Plasmid PDS80; a (phage lambda _{P L} promoter vector that is based on pCL1920 having SEQ ID NO: 78) was used as a template to amplify a fragment containing the _{P L} promoter by using primers TREE017 and TREE018 (Table 8) . Each of these fragments was designed to overlap in corresponding adjacent compartments and stitched together using SOEing PCR technology. The resulting P _L tdcB mutagenesis cassette (approximately 4.3 kb) contained approximately 700 bp homologous to the 5 ′ end integration site and 750 bp homologous to the 3 ′ end integration site. The P _L tdcB mutagenesis cassette is a host strain E. coli containing a helper plasmid, pKD46. electroporated into E. coli DV2 P _L thrA ^* BC (above) (Datsenko et al., supra). Clones containing chromosomal integration were selected in the presence of kanamycin and verified by PCR and sequencing analysis. The kanamycin marker was then removed using the pCP22 plasmid (Datsenko et al., Supra). The resulting strain was designated DV2P _L thrA ^* BC P _L tdcB. This strain is designated as E. coli. The plasmid pACYC- _ptrc2- 'tesA (Example 1) expressing a truncated form of _colitesA was transformed.

  This strain is also B. It was transformed with the plasmid pDG6 (Example 1) expressing the subtilis FabH1 enzyme. Fermentation experiments were performed and the titers of FFA fractions produced as free fatty acids (FFA), odd chain fatty acids (oc-FA) and oc-FA were measured as shown in Example 5 and Table 11. Alternatively, this strain is for example B.I. PDG7 expressing Subtilis FabH2, pDG8 expressing Streptomyces coelicolor FabH, pTB. Expressing Listeria monocytogenes FabH. 079, pTB.expressing Listeria monocytogenes FabHW310G mutant. It can be transformed with plasmids expressing various FabH polypeptides, such as 081 or the FabH plasmid described in Example 5 and Tables 12A-12C. Fermentation experiments are performed to measure the titer of FFA fractions produced as free fatty acids (FFA), odd chain fatty acids (oc-FA) and oc-FA.

^{_{DV2 P L -thrA * BC P T5}} -BsfabH1
B. A recombinant E. subtilis fabH1 gene integrated into the chromosome and placed under the transcriptional control of a strong constitutive T5 promoter. A strain of E. coli was constructed.

First, a PCR product was generated for chromosomal integration of the loxPcat integration cassette containing the chloramphenicol resistance gene, the T5 promoter (P _T5 ) and the BsfabH1 coding sequence at the site of the fadE deletion signature of DV2P _L thrA ^* BC. . Individual components of the integration cassette were first PCR amplified. The loxP-cat-loxP P _T5 component was amplified from plasmid p100.38 (SEQ ID NO: 79) using primers TREE133 and TREE135 (Table 9). The BsfabH1 gene was amplified from a plasmid with the BsfabH1 gene using primers TREE134 and TREE136. Primers TREE133 and TREE136 contain 5 'and 3' 50 bp of homologous sequence for integration. The primers used to amplify the components then contain overlapping sequences that were used to “join” the individual compartments together. PCR products _{loxPcat-P T5} and BsfabH1 are brought together both compartments in one PCR reaction, joined together by the use of primers TREE133 and TREE136, final _loxPcat-P T5 -BsfabH1 integration cassette Was amplified.

The loxP-cat-P _T5- BsfabH1 cassette was incorporated using the Red recombinase system (Datsenko, et al., supra). The loxP-cat-P _T5 -BsfabH1 PCR product was used to transform electrocompetent DV2 P _L -thrA ^* BC cells containing plasmid pKD46 that had already been induced with arabinose at 30 ° C. for 3-4 hours. After growth for 3 hours at 37 ° C. in SOC medium, cells were seeded on Luria agar plates containing 17 μg / mL chloramphenicol and incubated overnight at 37 ° C. Appropriate integration of loxP-cat-P _T5- BsfabH1 in chloramphenicol resistant colonies was screened by PCR. Integration was confirmed using primers fadE-L2 and fadE-R2 (Table 9) adjacent to the chromosomal integration site. Verifying integration, the chloramphenicol marker gene was removed by expressing a Cre recombinase that promotes recombination between the two loxP sites adjacent to the chloramphenicol resistance gene. cre plasmid pJW168 with recombinase gene, was transformed into ^{_{DV2 P L -thrA * BC loxP-}} cat-P T5 -BsfabH1 strain marker Palmeros et al. Removal according to the method described by (Gene 247: 255-264 (2000)). The resulting ^{_{DV2 P L -thrA * BC P T5}} -BsFabH1 strain was verified by sequencing.

^{_{DV2 P L -thrA * BC P T5}} -BsfabH1 ΔEcfabH
Recombinant E. coli expression of the endogenous gene (in this case, the E. coli fabH gene) is attenuated by deletion of that gene. A strain of E. coli was constructed.

E. FabH gene of E. coli was removed using the Red recombinase system from ^{_{DV2 P L -thrA * BC P T5}} -BsFabH1 (Datsenko et al., Supra). The kanamycin resistance cassette was amplified from plasmid pKD13 by PCR using primers TREE137 and TREE138 (Table 9). Then, using the PCR product, and the electro-competent ^{_{DV2 P L -thrA * BC P T5}} -BsfabH1 cells containing the plasmid pKD46 was transformed. EcfabH deletion and kanamycin marker removal were performed according to the method described by Wanner and Datsenko, supra. EcfabH deletion was confirmed using primers TREE139 and TREE140. The strain without the marker is DV2
It was referred to as P _L -thrA ^* BC P _T5- BsFabH1 ΔEcfabH.

^{_{DV2 P L -thrA * BC P L}} -tdcB P T5 -BsfabH1 ΔEcfabH
Recombinant E. coli containing a chromosomal integration gene that overexpresses the enzyme of step (D) of the pathway (A) shown in FIG. 2 and the oc-FA biosynthesis pathway shown in FIG. A strain of E. coli was constructed. The P _L -tdcB mutagenesis cassette (prepared as described above) was DV2 P _L -thrA ^* BC
Incorporated into the P _T5 -BsfabH1 ΔEcfabH Ltd., to produce a ^{_{DV2 P L -thrA * BC P L}} -tdcB P T5 BsfabH1 ΔEcfabF stock. In this strain, the incorporated E. coli strain. Coli thrA ^* BC gene and integrated E. coli. Coli tdcB gene is under the control of either a strong lambda P _L promoter, incorporated B. The subtilis fabH1 gene is under the control of the strong T5 promoter and is endogenous E. coli. The coli fabH gene was deleted. Fermentation experiments were performed and the results are shown in Table 11.

E. for the production of odd chain fatty acids by route (B). The following examples serve to increase the metabolic flux through the intermediate citramalic acid and α-ketobutyric acid through the pathway (B) of FIG. 2 to propionyl-CoA, and the odd-chain acyl in these recombinant cells Recombinant E. coli expressing a foreign gene encoding an enzyme that causes increased production of ACP and odd-chain fatty acid derivatives and / or overexpressing an endogenous gene. Describes the construction of E. coli strains.

DV2P _Trc- cimA3.7 leuBCD
E. overexpressing the endogenous leuBCD gene and the exogenous cimA3.7 gene In order to prepare E. coli strains, endogenous chromosome E. coli is used. Coli leuA and KmFRT cassette between leuB _gene, to produce a PCR product for the chromosomal integration of _{P Trc} promoter and CimA3.7. Natural leuABCD operon by the incorporation is destroyed, a strong IPTG inducible promoter in cimA3.7 and leuBCD Within _operon, placed under the control of _{P Trc.}

  The DNA encoding CimA3.7 was synthesized by Genet AG (Regensburg, Germany). The DNA was cloned into the SfiI site of plasmid pMK-RQ (kanR) (Geneart AG, Regensburg, Germany). Adjacent to the coding sequence, a 5'KpnI restriction site was introduced directly upstream of the ATG start codon and a 3'SacI restriction site immediately downstream of the TAA stop codon, respectively. The cimA3.7 cloning vector was verified by sequencing.

Individual components of the integration cassette were PCR amplified as follows. The KmFRT component was amplified from plasmid pKD13 using primers TREE146 and Km_trc_overR (Table 10). P _Trc promoter was amplified from pOP80 using primers Km_trc_overF and TREE033 (Example 1).

The cimA3.7 coding sequence was amplified from the previously described cimA3.7 cloning vector using primers TREE032 and TREE035. In order to form a 3 ′ homologous sequence for integration, The natural leuBC gene of E. coli Amplified using coligenomic DNA and primers TREE034 and TREE104. The forward primer TREE146 used to amplify the KmFRT cassette contained 5'50 bp of homologous sequence for integration. Each primer used to amplify the components contained overlapping sequences that were used to “join” the individual compartments together. First, KmFRT and _{P Trc} are joined together by combining the both compartments at one of the PCR reactions, to amplify the _{KmFRT-P Trc} product using primers TREE146 and TREE033. Then, joining and cimA3.7 the _{KmFRT-P Trc} using primers TREE146 and _TREE035, were generated KmFRT-P Trc -cimA3.7. The final section, LeuBC is joined to _KmFRT-P Trc _-cimA3.7 using primers TREE146 and TREE104, final integration _cassette: generating the KmFRT-P Trc -cimA3.7 leuBC.

The KmFRT-P _Trc -cimA3.7 leuBC cassette was obtained from E. coli using the Red recombinase system. Incorporated into the coli genome (Datsenko, et al., Supra). _KmFRT-P using Trc -cimA3.7 leuBC PCR products, already electro-competent E. coli containing plasmid pKD46 induced for 3-4 hours at 30 ° C. with arabinose E. coli MG1655DV2 cells were transformed. After growing for 3 hours at 37 ° C. in SOC medium, cells were seeded on Luria agar plates containing 50 μg / mL kanamycin and incubated overnight at 37 ° C. Suitable incorporation of _KmFRT-P Trc _-cimA3.7 kanamycin-resistant colonies were screened by PCR. Integration was confirmed using primers TREE151 and TREE106 adjacent to the chromosomal integration site. Upon verification of integration, the kanamycin marker gene was found in Datsenko et al. Removed by the method described above. Removal of embedded success and kanamycin marker gene _P Trc _-cimA3.7 in the final strain DV2 _P Trc cimA3.7 leuBCD were verified by sequencing.

This strain is designated as E. coli. Transformed with plasmid _{pACYC-p trc2 -tesA} expressing truncated coli tesA, in some cases, B. It was transformed with pDG6 expressing subtilis fabH1. Table 11 lists the titers of FFA fractions that were subjected to fermentation experiments and were produced as free fatty acids (FFA), odd chain fatty acids (oc-FA) and oc-FA.

E. for the production of odd chain fatty acids by the combination of pathways (A) and (B). The following examples serve to increase the metabolic flow through the general intermediate α-ketobutyric acid through the combination of pathways (A) and (B) in FIG. 2 to propionyl-CoA, Recombinant E. coli expressing a foreign gene encoding an enzyme that also causes increased production of oc-acyl-ACP and odd-chain fatty acids in the cell and / or overexpressing an endogenous gene. Describes the construction of E. coli strains.

^{_{DV2 P L -thrA * BC P Trc}} -cimA3.7_leuBCD P T5 -BsfabH1 ΔEcfabH ( "G1" strains)
To initiate the combination of path shown in FIG. 2 (A) and _(B), incorporating P Trc -cimA3.7_leuBCD cassette (Example 5) in ^{_{DV2 P L -thrA * BC P T5}} -BsfabH1 ΔEcfabH strain (Embodiment example 4), DV2 _P also referred to as strain _{^{G1 L -thrA * BC P Trc -cimA3.7_leuBCD}} P T5 -BsfabH1
A ΔEcfabH strain was generated. This strain overexpresses a polypeptide having (R) -citramalate synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity according to pathway (B) of the oc-FA pathway, and oc- A polypeptide having aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity and threonine synthase activity by the pathway (A) of the FA pathway (FIG. 2) was overexpressed.

^{_{DV2 P L -thrA * BC P L}} -tdcB P Trc -cimA3.7_leuBCD P T5 -BsfabH1 ΔEcfabH ( Ltd. "G2")
To create a strain engineered to overexpress a polypeptide having an activity corresponding to the combination of pathways (A) and (B) of the oc-FA pathway, a P _L -tdcB cassette (Example 4) was used as a strain. incorporated into G1, to generate a strain G2 and also referred ^{_{DV2 P L -thrA * BC P L}} -tdcB P Trc -cimA3.7_leuBCD P T5 -BsfabH1 ΔEcfabH strain. In this strain, the incorporated E. coli strain. Coli thrA ^* BC gene and integrated E. coli. Coli tdcB gene (aspartokinase activity corresponding to the path (A), homoserine dehydrogenase activity, homoserine kinase activity, which encodes a polypeptide having a threonine synthase activity and threonine deaminase activity) a strong lambda P _L promoter It was placed under control and overexpressed. The exogenous cimA3.7 gene and natural E. coli The E. coli leuBCD gene (encoding a polypeptide having (R) -citramalic acid synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity corresponding to pathway (B)) is also E. coli. It was integrated under the control of the strong IPTG-inducible promoter _{PTrc in} the E. coli chromosome and thus also overexpressed. An integrated B. cerevisiae encoding a branched-chain beta-ketoacyl-ACP synthase corresponding to part (D) of the oc-FA pathway (FIG. 1B). The subtilis fabH1 gene was placed under the control of the strong T5 promoter. Endogenous E. The coli fabH gene was deleted from this strain.

Evaluation of Odd-Chain Fatty Acid Production The following examples show propionyl-CoA via either the threonine-dependent pathway (route (A) in FIG. 2) or the citramalic acid pathway (route (B) in FIG. 2). E. coli engineered to express an exogenous gene encoding an enzyme that increases metabolic flux through a common α-ketobutyric acid intermediate to produce and / or overexpress an endogenous gene. The production | generation of the linear odd-chain fatty acid in a coli strain is shown. Propionyl-CoA, which serves as a “primer” molecule for the production of odd-chain fatty acids, is then condensed with malonyl-ACP by the action of β-ketoacyl-ACP synthase III (FabH) to produce odd-chain fatty acids and oc-FA derivatives. Odd chain β-ketoacyl-ACP intermediates that enter the fatty acid synthesis cycle to form. Thus, this example also demonstrates the effect of exogenous FabH enzyme on odd chain fatty acid production.

  In the first set of experiments, free fatty acid (FFA) production of the strain was evaluated by performing 96 deep well plate fermentations using the 4N-BT protocol. Scraping from a single colony or glycerol stock was used to inoculate 300 μL of LB + antibiotic (s). The LB seed culture was grown at 37 ° C. for 6-8 hours with shaking at 250 rpm until cloudy. 20 μL of LB culture was used to inoculate 400 μL of 2N-BT. These were grown overnight at 32 ° C. with shaking at 250 rpm. The next morning, 20 μL of 2N-BT culture was transferred to 400 μL of 4N-BT. 4N-BT cultures were grown for 6 hours at 32 ° C. with shaking at 250 rpm, at which time the cells were induced with 1 mM IPTG. After induction, cultures were further grown for 16-18 hours before being extracted and analyzed for FFA production. 40 μL of HCl 1M followed by 400 μL of butyl acetate spiked with C24 alkane internal standard 500 mg / L was added to each well. Cells were extracted by vortexing at 2000 rpm for 15 minutes. Extracts were derivatized with an equal volume of N, O-bis (trimethylsilyl) trifluoroacetamide (BSTFA) and then analyzed by GC / MS.

  The odd chain fatty acids produced in these experiments are generally the main oc-FAs that contain C13: 0, C15: 0, C17: 0 and C17: 1 fatty acids, with C15: 0 being produced.

Comparison of strains 1 and 2 in Table 11 shows that microbial cells overexpress genes involved in threonine biosynthesis and degradation, increase metabolic flux through the pathway intermediate α-ketobutyric acid, and generate odd chains by the cells. It is shown to significantly increase the proportion of long fatty acids. The parental DV2 strain produced straight chain fatty acids and the production of odd chain length fatty acids was negligible, but the thrA ^* BC and tdcB genes (aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine The DV2 strain overexpressing (encoding a polypeptide having synthase activity and threonine deaminase activity) produces a significantly higher amount and a significantly higher proportion of odd chain length fatty acids, about 18% (by weight) of the linear fatty acids produced. Was an odd chain length fatty acid.

  Strains 2 and 3 show an effect on oc-FA production by containing exogenous β-ketoacyl ACP synthase with high specificity for propionyl-CoA. Strain 2 is a natural (endogenous) E. coli strain. The coli fabH gene was contained. B. By introducing a plasmid expressing the subtilis fabH1 gene, oc-FA production was significantly increased from about 18% (strain 2) to about 37% (strain 3) of the linear fatty acids produced.

  The striking effect on oc-FA production is that of endogenous E. coli. The coli fabH gene has been deleted; This was observed when the subtilis fabH1 gene was integrated into the chromosome. In strain 4, the proportion of oc-FA increased to 72% of the linear fatty acids produced.

  Strains 5 and 6 also increase the proportion of odd chain length fatty acids produced by increasing the metabolic flux through α-ketobutyric acid, this time through pathways involved in citramalic acid biosynthesis and degradation. It shows that. The DV2 strain is engineered to overexpress the ciA3.7 and leuBCD genes (encoding polypeptides having (R) -citramalate synthase activity, isopropylmalate isomerase activity and β-isopropylmalate dehydrogenase activity) About 4% of the linear fatty acids produced have an odd chain length and plasmid expression Inclusion of subtilis fabH1 increased to about 13%.

Strains 7 and 9 show the effect of a combination of threonine and citramalic acid pathways on oc-FA production. In strain G1, in which the thrA ^* BC, ciA3.7 and leuBCD genes are overexpressed, endogenous E. The coli fabH gene has been deleted; The subtilis fabH1 gene was integrated into the chromosome, and about 26% of the linear fatty acids produced were odd chain fatty acids. In strain G2 overexpressing the thrA ^* BC, tdcB, cimA3.7 and leuBCD genes, endogenous E. The coli fabH gene has been deleted; The subtilis fabH1 gene was integrated into the chromosome, and approximately 90% of the linear fatty acids produced were odd chain fatty acids. The strains G1 / Tn7-tesA and G / Tn7-tesA (strains 8 and 10 respectively) in which the tesA gene is integrated at the Tn7 attachment site of the chromosome are the strains G1 and G2 (strain 7 and respectively And the amount and proportion of oc-FA almost equivalent to those in 9).

In the second set of experiments, the role of propionyl-CoA production and the effect of FabH enzyme on oc-FA production was investigated. In this experiment, the exogenous fabH coding sequence was cloned into the pOP80 expression vector (Example 1) and expression was controlled by the strong _PTrc promoter. The fabH expression construct (or pOP80 vector only in strains lacking exogenous fabH) was transformed into the following strains along with the 'tesA plasmid pACYC-PTrc2-tesA:
-DV2
-DV2 cimA3.7_leuBCD (increase in propionyl-CoA via the citramalic acid pathway (B) in Figure 2)
-DV2 thrA ^* BCtdcB (increase of propionyl-CoA via the thr-dependent pathway (A) of FIG. 2)

  Scraping from a single colony or frozen glycerol stock was used to inoculate 300 μL of LB + antibiotic (s). The LB seed culture was grown at 37 ° C. for 6-8 hours with shaking at 250 rpm until cloudy. 20 μL of LB culture was used to inoculate 400 μL of 2N-BT medium. These were grown overnight at 32 ° C. with shaking at 250 rpm for at least 14 hours. The next morning, 20 μL of 2N-BT culture was transferred to 400 μL of 4N-BT. 4N-BT cultures were grown for 6 hours at 32 ° C. with shaking at 250 rpm, at which time the cells were induced with 1 mM IPTG. After induction, the culture was further grown for 20-22 hours before being extracted and analyzed for free fatty acid (FFA) production. 40 μL HCl 1M followed by 400 μL butyl acetate was added to each well. Cells were extracted by vortexing at 2000 rpm for 15 minutes. Extracts were derivatized with an equal volume of N, O-bis (trimethylsilyl) trifluoroacetamide (BSTFA) and then analyzed by GC (GC-FID) coupled with a flame ionization detector.

  The ratios of odd chain fatty acids to total free fatty acids produced by strains expressing various fabH genes are listed in Tables 12A-C below. The odd chain fatty acid ratios generated in the control DV2 strain are listed in Table 12A, while either the citramalic acid pathway (route (B) in FIG. 2) or the threonine-dependent pathway (route (A) in FIG. 2). Odd chain fatty acid ratios in strains engineered for increased metabolic flux to propionyl-CoA are shown in Tables 12B and 12C, respectively.

All of the strains listed in Tables 12A-12C are endogenous E. coli. The coli fabH gene was expressed. Strains 2-10 each further contained a plasmid-expressed exogenous fabH gene. Endogenous E. Deletion of the coli fabH gene and exogenous B. coli. The chromosomal integration of the subtilis fabH1 gene results in endogenous E. coli. E. coli habH and plasmid expression exogenous It was shown in Table 11 (above) (Table 11, strain 4) that higher and higher proportions of oc-FA are produced compared to the strain containing Subtilis fabH1 (Table 11, strain 3). Nevertheless, the results shown in Tables 12A-12C show that (a) a strain in which all of the tested fabH expressing strains were engineered for high α-ketobutyric acid and propionyl-CoA levels, DV2cimA3.7 leuBCD (Table 12B) and DV2thrA ^* BC tdcB (Table 12C) showed significant linear oc-fatty acid production, but not much oc-fatty acid production was observed in the DV2 control strain (Table 12A), so propionyl- CoA is a precursor necessary for the production of recombinant linear odd-chain fatty acids in bacteria, (b) recombinant linear oc-fatty acid production contains members of branched and / or odd-chain fatty acids It has been shown to occur in the presence of various heterologous FabH enzymes isolated from organisms. Such FabH enzymes can use propionyl-CoA molecules in the priming reaction of fatty acid biosynthesis to impart odd-chain fatty acid biosynthesis capability to recombinant microorganisms.

  In conclusion, this example shows that microorganisms that normally produce even chain fatty acids are odd by increasing the metabolic flux through propionyl-CoA and expressing the β-ketoacyl synthase (FabH) enzyme that utilizes propionyl-CoA. It shows that it can be manipulated to produce chain fatty acids. Example 6 (below) shows an alternative pathway that can be manipulated to increase metabolic flow through propionyl-CoA. Recombinant microorganisms engineered to produce odd chain fatty acids can be further modified to produce odd chain fatty acid derivatives such as odd chain fatty alcohols (Example 7) and even chain alkanes (Example 8). it can.

E. for the production of odd chain fatty acids by route (C). The following examples serve to increase metabolic flow through the intermediate methylmalonyl-CoA to produce propionyl-CoA by the pathway (C) of FIG. 3, and odd-chain acyl- Recombinant E. coli expressing a foreign gene encoding an enzyme that causes increased production of ACP and odd-chain fatty acid derivatives and / or overexpressing an endogenous gene. Describes the construction of E. coli strains. In particular, this example overexpresses endogenous methylmalonyl-CoA mutase (scpA / sbm) and methylmalonyl-CoA decarboxylase (scpB / ygfG) genes in the plasmid, and chromosomal propionyl-CoA: succinyl-CoA transferase ( scpC / ygfH) and ScpB / ygfG genes have been deleted. It describes about the production | generation of the odd chain fatty acid in a coli strain.

E. E. coli strain DV2, plasmid pDG6 (expressing B. subtilis FabH1) and plasmid pACYC-p _Trc2- tesA (expressing truncated 'TesA polypeptide) were prepared as described in Example 1.

The plasmid _pACYC-P Trc _-sbm-ygfG
Plasmid _pACYC-P Trc _-sbm-ygfG encodes a methylmalonyl -CoA mutase E. E. coli encoding E. coli sbm and methylmalonyl-CoA decarboxylase PACYC-P _Trc plasmid (Example 1) overexpressing coli ygfG. sequence of _pACYC-P Trc _-sbm-ygfG is SEQ ID NO: 80 herein.

sDF4 strain The sDF4 strain is an E. coli strain in which the chromosomal scpB and scpC genes are deleted, the natural frd promoter is replaced with the trc promoter, and the 'tesA gene is incorporated into the Tn7 attachment site of the chromosome. This is strain E. coli DV2.

To incorporate the 'tesA gene, _{pACYC-P Trc} -'tesA plasmid (Example 1) following primers:
IFF: 5′-GGGTCAATACGCGCCGCCCAATCTGCGCGGCAGAGCG (SEQ ID NO: 140)
IFR: 5′-TGGCCGCGCCTCTAGGGCATTACGCTGACTTGACGGGG (SEQ ID NO: 141)
It was first prepared _{P Trc -'tesA} integration cassette by amplifying using.

Integration cassette is inserted into the NotI and AvrII restriction sites PGRG25 (GenBank accession number _DQ460223), lacIq, Tn7 end to the left and right _{P Trc -'tesA} cassette were generated adjacent Tn7tes plasmid (SEQ ID NO: 81).

To prepare the sDF4 strain, McKenzie et al. , BMC Microbiology 6:39 (2006) using the protocol described by E. coli, Tn7tes. Electroporation into E. coli strain DV2 (Example 1). After electroporation, ampicillin resistant cells were selected by growing overnight at 32 ° C. in LB medium containing 0.1% glucose and 100 μg / mL carbenicillin. Following this, overnight growth of cells at 32 ° C. on LB and arabinose 0.1% plates was used to select plasmids containing the Tn7 gene transfer fraction. Single colonies were picked, streaked on fresh LB media plates with and without ampicillin and grown overnight at 42 ° C. to recover the Tn7tes plasmid. Therefore, _lacIq, located a _{P Trc -'tesA} between pstS and glmS gene E. It was integrated into the attTn7 site of the coli chromosome. The integration of these genes was confirmed by PCR and sequencing. The resulting strain was called DV2Tn7-tesA.

In order to delete the scpBC gene from DV2Tn7-tesA, the following two primers were used.
ScpBC-KOfwd 5'-GCTCCAGTGAATTTATCCCAGACCGCAATATTTTTGATTAAAGGA ATTTTTTATGCTCTGGGGATCCTGTCGCTGAGTCGCTGGCTGCG

ScpBC-KOfwd and ScpBC-KOrc primers were used to amplify a kanamycin resistance (Km ^R ) cassette from plasmid pKD13 by PCR (Datsenko et al., Supra). The PCR product was then used to generate electrocompetent E. coli containing plasmid pKD46 expressing Red recombinase that was already induced with arabinose for 3-4 hours. E. coli DV2 Tn7-tesA cells (Datsenko et al., Supra) were transformed. After growth for 3 hours at 37 ° C. in SOC medium, the cells were seeded on Luria agar plates containing 50 μg / mL kanamycin. Resistant colonies were identified and isolated after incubation overnight at 37 ° C. The disruption of the scpBC gene is the following primer designed to flank the chromosomal scpBC gene: ScpBC check-60 fwd 5'-CGGGTTCTGAACTTGTAGCG (SEQ ID NO: 144)
ScpBC check +60 rc 5′-CCAACTTCGAAGCAATGATTGATG (SEQ ID NO: 145)
Was confirmed by PCR amplification.

After confirming the scpBC deletion, Pick a single colony was used to remove the Km ^R marker using pCP20 plasmid (Datsenko et al., supra). Datsenko et al. The native fumarate reductase (frd) promoter was replaced with the PTrc promoter using a modification of the procedure (above). The obtained E.I. The coli DV2 ΔscpBC :: FRT, ΔPfrd :: FRT-PTrc, attTn7 :: PTrc-'tesA strain was referred to as “sDF4”.

  The strains were transformed with plasmids as shown below, and fatty acid production was evaluated using the 96 deep well plate fermentation procedure described in Example 5, and 4N-BT cultures since ScpA is a B-12 dependent enzyme. The medium was supplemented with cobalamin.

  In microbial cells overexpressing genes involved in the production of propionyl-CoA via the intermediate succinyl-CoA and methylmalonyl-CoA, the proportion of odd chain length fatty acids produced by the cells increased. The production of odd chain length fatty acids in the DV2 strain (strain 1 in Table 13) was negligible. In the sDF4 strain overexpressing the coli sbm and ygfG genes (encoding a polypeptide having methylmalonyl-CoA mutase activity and methylmalonyl-CoA decarboxylase activity), the amount of odd-chain fatty acids produced increased.

  Strains 2 and 3 in Table 13 show the effect on oc-FA production by including exogenous β-ketoacyl ACP synthase with high specificity for propionyl-CoA. Strain 2 is a natural E. coli strain. The coli fabH gene was contained. B. By introducing a plasmid expressing the subtilis fabH1 gene, oc-FA production was further increased from about 4% of the fatty acids produced in strain 2 to about 16% of the fatty acids produced in strain 3.

E. Production of odd-chain fatty alcohols in E. coli The following shows the production of odd-chain fatty alcohols by the previously described strains that also expressed a polypeptide having acyl-ACP reductase (AAR) activity in this example. AAR activity converted the oc-acyl-ACP intermediate to oc-fatty aldehyde, which reacted with endogenous aldehyde reductase to form oc-fatty alcohol.

Stock ^{_{DV2, DV2 P L -thrA * BC}} P L -tdcB P T5 -BsfabH1
ΔEcfabH and G1 (prepared as described in Examples 1, 2 and 4 respectively) were transformed with either plasmid pLS9185 or pDS171s. Plasmid pLS9185 expressed Synechococcus elongatas fatty acyl-ACP reductase (AAR; GenBank accession number YP — 400611). Plasmid pDS171s is S. pylori. Elongatas AAR, acyl carrier protein (ACP) and Bacillus subtilis (Sfp; GenBank accession number 63 YP_0042) Expressed. These strains were evaluated for fatty alcohol production using the 96 deep well plate fermentation procedure described in Example 5.

Compared to the control strain DV2, strains DV2 thrA ^* BC tdcB BsfabH1 ΔEcfabH and G1 are both significantly more potent when transformed with plasmids expressing AAR or plasmids expressing AAR, cACP and Sfp (Table 14). A number and proportion of odd chain fatty alcohols were produced. The proportion of fatty alcohols produced as odd-chain fatty alcohols largely reflects the proportions observed when assessing fatty acid production in these strains (Table 11), where AAR is an odd-numbered chain of similar overall chain length or It was suggested that even-chain acyl-ACP is not selective.

E. Production of even chain alkanes in E. coli The following example demonstrates the production of even chain alkanes by a strain expressing a polypeptide having acyl-ACP reductase (AAR) activity and a polypeptide having aldehyde decarbonylase (ADC) activity. . AAR activity converted the oc-acyl-ACP intermediate to oc-fatty aldehyde, and ADC activity decarbonylated the oc-fatty aldehyde to form an even chain (ec-) alkane.

Strains DV2, DV2 thrA ^* BC tdcB BsfabH1 ΔEcfabH and G1 (prepared as described in Examples 1, 2 and 4 respectively) were transformed with plasmids pLS9185 and pLS9181. Plasmid pLS9185 expressed Synechococcus elongatas fatty acyl-ACP reductase (AAR; GenBank accession number YP — 400611). Plasmid pLS9181 expressed Nostock punctuformaldehyde decarbonylase (ADC; GenBank accession number YP — 001865325). Strains transformed with both plasmids were analyzed for alkane production using the 96 deep well plate fermentation procedure described in Example 5 above, but supplemented with 25 μM MnSO ₄ (final concentration) upon induction.

Compared to the control strain DV2, both DV2 thrA ^* BC tdcB BsfabH1 ΔEcfabH and G1 produce significantly higher titers and proportions of even chain alkanes when transformed with plasmids expressing AAR and ADC (Table 15). did. The proportion of alkanes produced as even chain alkanes largely reflects the proportion of odd chain products produced when assessing fatty acid production (Table 11) and fatty alcohol production (Table 14) of these strains. Suggests that, like AAR, there is no selectivity between odd or even chain substrates of similar overall chain length.

  While the invention has been described in conjunction with detailed descriptions thereof, the foregoing description is illustrative of the invention and is not to be construed as limiting the scope, but as defined by the appended claims. I want you to understand. Other aspects, advantages, and modifications are within the scope of the following claims.

Knothe G. , Fuel Process Technol. 86: 1059-1070 (2005)

Claims (20)

(A) Recombinant microorganisms relative to the amount of propionyl-CoA produced in parental microbial cells that lack or have a reduced amount of effective enzymatic activity to produce increased amounts of propionyl-CoA. A polynucleotide encoding a polypeptide having said enzymatic activity effective to produce increased amounts of propionyl-CoA in a cell, wherein said polypeptide is foreign to recombinant microbial cells, or said polynucleotide A polynucleotide wherein the expression of the nucleotide is modulated in the recombinant microbial cell compared to the expression of the polynucleotide in the parental microbial cell;
A set comprising (b) a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, and (c) a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity A replaceable microbial cell,
Fatty acid derivative composition comprising odd-chain fatty acid derivatives when recombinant microbial cells are cultured under conditions effective to express the polynucleotides according to (a), (b) and (c) in the presence of a carbon source Produce things,
A recombinant microbial cell, wherein at least 10% of the fatty acid derivatives in the fatty acid derivative composition are odd chain fatty acid derivatives.   The recombinant microbial cell according to claim 1, wherein at least 20% of the fatty acid derivatives in the fatty acid derivative composition are odd-chain fatty acid derivatives.   The recombinant microbial cell according to claim 1, wherein the odd-chain fatty acid derivative is produced at least 100 mg / L.   2. The recombinant microbial cell of claim 1, wherein the expression of at least one polynucleotide according to (a) is modulated by overexpression of the polynucleotide in the recombinant microbial cell. A polynucleotide according to (a),
(I) one or more polynucleotides encoding a polypeptide having aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(Ii) one or more polynucleotides encoding a polypeptide having (R) -citramalate synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity; and (iii) methylmalonyl- One or more polynucleotides encoding a polypeptide having CoA mutase activity, methylmalonyl-CoA decarboxylase activity and methylmalonyl-CoA carboxytransferase activity;
2. The recombinant microbial cell of claim 1 selected from the group consisting of:   6. The recombinant microbial cell of claim 5, comprising one or more polynucleotides according to (i) and one or more polynucleotides according to (ii).   Polypeptides with β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate are foreign to recombinant microbial cells and have β-ketoacyl-ACP synthase activity endogenous to recombinant microbial cells The recombinant microbial cell according to claim 1, wherein the expression of the polypeptide is attenuated.   The fatty acid derivative enzyme activity comprises thioesterase activity, the recombinant microbial cell produces a fatty acid composition comprising odd chain fatty acids, and at least 10% of the fatty acids in the composition are odd chain fatty acids. Recombinant microbial cells.   The fatty acid derivative enzyme activity comprises an ester synthase activity and the recombinant microbial cell produces a fatty ester composition comprising an odd chain fatty ester, wherein at least 10% of the fatty esters in the composition are odd chain fatty esters. Item 2. The recombinant microbial cell according to Item 1.   The fatty acid derivative enzyme activity comprises a fatty aldehyde biosynthetic activity and the recombinant microbial cell produces a fatty aldehyde composition comprising an odd chain fatty aldehyde, wherein at least 10% of the fatty aldehydes in the composition are odd chain fatty aldehydes; The recombinant microbial cell according to claim 1.   The fatty acid derivative enzyme activity comprises fatty alcohol biosynthetic activity and the recombinant microbial cell produces a fatty alcohol composition comprising an odd chain fatty alcohol, wherein at least 10% of the fatty alcohol in the composition is an odd chain fatty alcohol; The recombinant microbial cell according to claim 1.   The fatty acid derivative enzyme activity comprises a hydrocarbon biosynthetic activity and the recombinant microbial cell produces a hydrocarbon composition comprising even chain hydrocarbons, wherein at least 10% of the hydrocarbons in the composition are even chain hydrocarbons; The recombinant microbial cell according to claim 1. A cell culture comprising the recombinant microbial cell of claim 1. A method for producing a fatty acid derivative composition comprising an odd-chain fatty acid derivative,
Obtaining a recombinant microbial cell according to claim 1;
Recombinant under conditions effective to express a polynucleotide according to (a), (b) and (c) in a culture medium containing a carbon source and produce a fatty acid derivative composition comprising an odd chain fatty acid derivative Culturing microbial cells, wherein at least 10% of the fatty acid derivatives in the composition are odd chain fatty acid derivatives, and optionally recovering the odd chain fatty acid derivative composition from the culture medium;
Including methods. Recombinant microbial cells
(1) a polypeptide having thioesterase activity;
(2) a polypeptide having decarboxylase activity;
(3) a polypeptide having carboxylate reductase activity;
(4) a polypeptide having alcohol dehydrogenase activity (EC 1.1.1.1);
(5) a polypeptide having aldehyde decarbonylase activity (EC 4.11.99.5);
(6) a polypeptide having acyl-CoA-reductase activity (EC 1.2.1.50);
(7) a polypeptide having acyl-ACP reductase activity;
(8) a polypeptide having ester synthase activity (EC 3.1.1.67);
(9) a polypeptide having OleA activity; and (10) a polypeptide having OleCD or OleBCD activity;
Expressing one or more polynucleotides encoding a polypeptide having a fatty acid derivative enzyme activity selected from the group consisting of:
A recombinant microbial cell is one of an odd chain fatty acid, an odd chain fatty ester, an odd chain fatty aldehyde, an odd chain fatty alcohol, an even chain alkane, an even chain alkene, an even chain terminal olefin, an even chain internal olefin or even an even chain ketone 15. The method of claim 14, wherein a composition comprising or a plurality is produced. A method of making a recombinant microbial cell that produces a higher titer or a higher proportion of odd chain fatty acid derivatives than that produced by a parent microbial cell, comprising:
Obtaining a parental microbial cell comprising a polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate and a polynucleotide encoding a polypeptide having fatty acid derivative enzyme activity, and the same Manipulating the parental microbial cell to obtain a recombinant microbial cell that produces or is capable of producing a larger amount of propionyl-CoA than the amount of propionyl-CoA produced by the parental microbial cell when cultured under conditions Including,
Potency or percentage of odd-chain fatty acid derivatives produced by parental microbial cells cultured under the same conditions when the recombinant microbial cells are cultured under conditions effective to express the polynucleotide in the presence of a carbon source To produce higher titers or higher proportions of odd chain fatty acid derivatives. The process of manipulating the parent microbial cells
(A) a polypeptide having aspartokinase activity, homoserine dehydrogenase activity, homoserine kinase activity, threonine synthase activity and threonine deaminase activity;
(B) a polypeptide having (R) -citramalate synthase activity, isopropylmalate isomerase activity and beta-isopropylmalate dehydrogenase activity; and (c) methylmalonyl-CoA mutase activity, methylmalonyl-CoA decarboxylase A polypeptide having either activity or methylmalonyl-CoA carboxytransferase activity and optionally methylmalonyl-CoA epimerase activity,
Engineering a parental microbial cell to express a polynucleotide encoding a polypeptide selected from the group consisting of:
At least one polypeptide according to (a), (b) or (c) is foreign to the parent microbial cell, or at least one polynucleotide according to (a), (b) or (c) 17. The method of claim 16, wherein the expression of is modulated in the recombinant microbial cell as compared to the expression of the polynucleotide in the parental microbial cell.   A recombinant microbial cell has been engineered to express an exogenous polynucleotide encoding a polypeptide having β-ketoacyl-ACP synthase activity utilizing propionyl-CoA as a substrate, and β-ketoacyl-ACP synthase 17. The method of claim 16, wherein the expression of an endogenous polynucleotide encoding a polypeptide having activity is attenuated. A method for increasing the potency or proportion of odd-chain fatty acid derivatives produced by microbial cells, comprising:
Can obtain or produce a larger amount of propionyl-CoA than the amount of propionyl-CoA produced by the parental microbial cells when obtained under parental microbial cells producing fatty acid derivatives Manipulating parent microbial cells to obtain recombinant microbial cells;
When recombinant microbial cells are cultured under conditions effective to produce propionyl-CoA and fatty acid derivatives in the recombinant microbial cells in the presence of a carbon source, they are produced by parental microbial cells cultured under the same conditions. A method of producing a higher titer or ratio of odd chain fatty acid derivatives relative to the potency or ratio of odd chain fatty acid derivatives.   A fatty acid derivative composition produced by the method of claim 14.

Images