CN103725622A - Transgenic pichia pastoris gene engineering bacteria and construction method and application thereof - Google Patents

Abstract

The invention relates to transgenic pichia pastoris gene engineering bacteria and a construction method and application thereof. I-type collagen can be applied to a biomedical material, but large-scale industrial production cannot be realized. The construction method for the transgenic pichia pastoris gene engineering bacteria comprises the steps of extracting a main RNA (ribonucleic acid) from a human placenta tissue, performing reverse transcription to obtain cDNA (deoxyribonucleic acid), and cloning an I-type collagen alpha1 chain gene by taking the cDNA as a template; modifying the I-type collagen alpha1 chain gene, and connecting the I-type collagen alpha1 chain gene with an expression carrier pPIC9K to construct a plasmid pPIC9K-Col1a1; performing enzyme linearization on the constructed plasmid pPIC9K-Col1a1, and introducing pichia pastoris SMD1168; converting and putting the human I-type collagen alpha1 chain gene into the pichia pastoris SMD1168 to obtain the transgenic pichia pastoris gene engineering bacteria. The engineering bacteria disclosed by the invention can efficiently and safely secrete an I-type collagen alpha1 chain protein outside cells and is higher in bioactivity; the protein can be mixed with other inorganic materials and is used as a biodegradable biomedical material for tissue defection, restoration and the like.

Description

A kind of transgenic Pichia yeast genetic engineering bacterium and construction process and application

Technical field

the present invention relates to a kind of genetic engineering bacterium, be specifically related to a kind of transgenic Pichia yeast genetic engineering bacterium and construction process and application.

Background technology

Collagen is Mammals in-vivo content the highest (account in body total protein content 25%), an effect class high molecular weight protein the most widely, and collagen plays an important role in the physiological behaviors such as cytodifferentiation, migration as the main component of extracellular matrix.Along with the development of organizational project science, and the continuous progress of regenerative medicine research, the application of collagen is further extensive.Recombined collagen is due to its quality product homogeneous, anosis toxicity hidden danger and anaphylaxis, and is easy to the features such as large-scale production, will substitute gradually the important materials that natural collagen becomes Tissue Engineering Study.

At present, realized the expression of triple helical collagen protein abroad, its expression system has gene expressive system of animals, plant expression system and microbial expression system.Microflora is for Restruction collagen protein and recombinant gelatins, the advantage that have low cost, quality product homogeneous, efficiently can amplify.Host Strains for recombinant expressed human collagen or gelatin has pichia spp, yeast saccharomyces cerevisiae, debaryomyces hansenii, intestinal bacteria and tyrothricin at present.But for collagen and gelatin, pichia spp is optimum production system.The recombinant bacterium of pichia spp can produce hydroxylated triple helical recombinant human collagen in born of the same parents can reach 1.5g/L.Can synthesize the hydroxylation collagen of the thermostability similar to natural collagen to recombinant collagen coexpression Protocollagen prolyl hydroxylase.The hydroxylation recombinant collagen fiber that purifying obtains is structurally identical with natural collagen.These quality can make the medical usage of recombinant collagen more attractive.Foreign study result shows, pichia spp secretion recombinant collagen or gelatin output reach 3-14g/L.As far back as the nineties in 20th century, Finland university is polygene coexpression precollagen and Protocollagen prolyl hydroxylase in yeast, has obtained restructuring triple helical collagen.U.S. Fibrogen company has also realized the triple-helix structure of collagen and has expressed and applied for patent, they modify collagen peptide chain Pro by coexpression hydroxylase, cytoclasis is extracted and collagen purification strand, creates in vitro self-assembly environment, and then forms triple helical collagen.

Natural collagen obtains does not recombinant expressedly have relevant research at home so far, but all concentrates in the research of expressing class people's collagen and gelatin fragments.Northwest University's model is the class people's collagen with escherichia coli expression designed, designed for sister-in-law, stable yield and up to 20g/L; China Australia Li Kang adopts Pichia anomala expression collagen protein fusogenic peptide also to obtain certain progress, and Institutes Of Technology Of Nanjing is also carrying out the research etc. of related fields.

Recombinant expressed due to natural triple helical collagen, technique is extremely complicated, and is difficult to realize its large-scale production, therefore recombinant expressed natural collagen strand and the gelatin fragments desirable selection of can yet be regarded as.Although secretion total length collagen strand has the research of related fields, all can not effectively overcome its easily shortcoming of degraded, and laboratory study is more, not large-scale production.

In order to give full play to the effect of people's type i collagen albumen in bio-medical material, realize the extensive commercial application of this albumen, first to realize a large amount of, the stable expression of this albumen, and can be secreted into outside born of the same parents.Due to the collagen product existing on market, be mostly the collagen that extracts from animal, thereby have viral hidden danger and the uneven first-class problem of quality product, limited its widespread use in bio-medical material.

Summary of the invention

The object of this invention is to provide a kind of transgenic Pichia yeast genetic engineering bacterium and construction process and application, can carry out efficiently and safely the exocytosis of type i collagen α 1 catenin and express.

The technical solution adopted in the present invention is:

A transgenic Pichia yeast genetic engineering bacterium, is characterized in that:

Described genetic engineering bacterium is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on August 5th, 2013, and deposit number is CGMCC No.7981.

Described genetic engineering bacterium is, after the people's type i collagen α 1 chain gene Col1a1 to cloning from human placenta transforms, to be connected with Expression vector pPIC9K carrier, imports the genetic engineering bacterium that in Pichia yeast SMD1168, structure forms.

A construction process for transgenic Pichia yeast genetic engineering bacterium, is characterized in that:

By following steps, realized:

Step 1: clone type i collagen α 1 chain gene Col1a1 from human placenta;

Step 2: the base that type i collagen α 1 chain gene Col1a1 is related to the XhoI restriction enzyme site transformation that suddenlys change;

Step 3: improved type i collagen α 1 chain gene Col1a1 is connected with Expression vector pPIC9K carrier, constructs expression plasmid pPIC9K-Col1a1;

Step 4: by after the expression plasmid pPIC9K-Col1a1 linearization for enzyme restriction building, import in Pichia yeast SMD1168;

Step 5: measure type i collagen α 1 chain gene Col1a1 conversion and entered in Pichia yeast SMD1168, thereby obtain transgenic Pichia yeast engineering.

The improved Col1a1 gene order that step 2 obtains is SEQ ID No.1.

The application of described a kind of transgenic Pichia yeast genetic engineering bacterium in the high efficient expression of type i collagen α 1 catenin.

Expressed type i collagen α 1 catenin Col1a1, its aminoacid sequence is SEQ ID No.2.

The present invention has the following advantages:

The present invention has successfully built transgenic Pichia yeast genetic engineering bacterium; experimental results show that this project bacterium can be at exocytosis people type i collagen α 1 catenin; and there is higher biological activity; the successful structure of this engineering bacteria has been realized a large amount of exocytosis of people's type i collagen α 1 chain and has been expressed; this albumen can mix with other inorganic materials; as biodegradable bio-medical material; for tissue defect and reparation etc., the large-scale successfully constructing as above-mentioned albumen of this project bacterium is applied to lay a good foundation in bio-medical material.

Accompanying drawing explanation

Fig. 1 is that the a-factor of structure is as the Col1a1 gene order of signal peptide.

Fig. 2 is the secretion expression carrier collection of illustrative plates of type i collagen α 1 catenin of structure.

Fig. 3 is the pcr amplification result of type i collagen α 1 chain gene.

Wherein swimming lane M is DNA Marker(Marker IV), 1 is type i collagen α 1 chain gene amplified production 3200bp.

Fig. 4 is the extraction qualification result electrophorogram of type i collagen α 1 chain gene recombinant secretor expression plasmid.

Wherein swimming lane M is DNA Marker (λ-hind III), the expression plasmid that 1-5 is different concns.

Fig. 5 is that the enzyme of restructuring Expression vector pPIC9K-Col1a1 is cut qualification result electrophorogram.

Wherein swimming lane M is DNA Marker(λ-hind III), 1 cuts result with Sal I enzyme for recombinant expression vector, 2 cut result for recombinant expression vector with BamH I enzyme, and 3 cut result for recombinant expression vector with Xho I and EcoR I enzyme, and 4 is Col1a1 gene in contrast.

Fig. 6 is the SDS-PAGE figure at the recombinant bacterium screening.

Wherein swimming lane M is molecular weight Marker, and S1-S3 is respectively the electrophorogram of getting supernatant 10 μ l on 1.0,2.0,4.0 mg/ml G418 resistance YPD flat boards after the recombinant bacterium abduction delivering screening.

Fig. 7 is the mass spectrum comparison result of the recombinant bacterium that screens.

Use Mascot 2.0 softwares, at SWISS-PROT and ncbi database, compare.

Fig. 8 is the protein immunoblot experiment of the recombinant bacterium that screens.

M is molecular weight Marker, 1 negative contrast (SMD1168), and 2 is recombinant bacterium supernatant liquor immunoblotting (SMD1168/pPIC9K-Col1a1).

Embodiment

Below in conjunction with embodiment, the present invention will be described in detail.

Experimental technique in following embodiment, if no special instructions, is ordinary method.

The percentage composition of following embodiment if no special instructions, is quality percentage composition.

Pichia yeast expression system is a kind of efficient eukaryotic expression system that development in recent years is got up, its expression amount is high, good stability, cost are relatively low, can secrete to born of the same parents, be convenient to the advantages such as suitability for industrialized production, thereby can be used for the industrialization fermentative production of collagen protein or gelatin.

Transgenic Pichia yeast engineering strain involved in the present invention, is by after people's type i collagen α 1 chain gene transformation, importing Pichia yeast after being connected with expression vector ( pichia sp.) build the transgenic engineered bacteria forming in SMD1168, on August 5th, 2013, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, deposit number is CGMCC No.7981.

Be below concrete building process:

1, amplimer is synthetic:

According to from the NCBI(U.S. state-run biotechnology information center) the cloning site design pcr amplification primer of acquired people's type i collagen α 1 chain and shuttle vector pPIC9K:

(1) long 44 the base N-Xho I of upstream primer P1:

CG CTCGAGAAAAGAGAGGCTGAAGCTCAGCTGTCTTATGGCTAT

(underscore place is restriction endonuclease Xho I site);

(2) long 35 the base C-EcoR I of downstream primer P2:

CCG GAATTCTTAAGCCCGGTAGTAGCGGCCACCAT

(underscore place is restriction endonuclease EcoR I site).

Primer is synthetic by Shanghai Ying Jun Bioisystech Co., Ltd, and purifying mode is PAGE.

2, the pcr amplification of goal gene Col1a1:

Take human placenta as material, extract total RNA, reverse transcription is cDNA, then take cDNA as template, take N-Xho I and C-EcoR I to carry out pcr amplification as primer, and reaction system is 20 microlitres, and reactive component is: 5 * Prime STAR Buffer, 5 μ l; DNTP 2 μ l; 1 μ l cDNA template; N-XhoI 1 μ l; C-EcoRI 1 μ l; PrimeSTAR HS archaeal dna polymerase 1 μ l; Sterilizing distilled water 9 μ l.Its reaction parameter is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s; 65 ℃ of annealing 30s; 72 ℃ are extended 3min, 30 circulations; 72 ℃ are extended 10min again.1% agarose gel electrophoresis detects PCR result, and as shown in Figure 3, it is people's type i collagen α 1 chain gene that result shows to be cloned into goal gene Col1a1(to electrophoresis result), order-checking, the sequence alignment result of announcing in its sequence and NCBI is 100%.

3, the transformation of goal gene Col1a1:

The above-mentioned goal gene Col1a1 being cloned into of take is template, take P1 and P3 as primer, carries out pcr amplification, and its amplified production is x1; Take goal gene Col1a1 equally as template, take P2 and P4 as primer, carry out pcr amplification, its amplified production is x2; And then with x1, x2 is template, take P1 and P2 as primer, carry out overlapping PCR, obtaining PCR product is x3, it is cut to glue and reclaim.

The product x3 that the above-mentioned pcr amplification of take reclaims is template, take P1 and P5 as primer, carries out pcr amplification, and its amplified production is y1; Take product x3 equally as template, take P2 and P6 as primer, carry out pcr amplification, its amplified production is y2; And then with y1, y2 is template, take P1 and P2 as primer, carry out overlapping PCR, obtaining PCR product is y3, it is cut to glue and reclaim, and obtains improved gene C ol1a1.

The above-mentioned primer sequence relating to is as follows:

Primer P3:AATCCTCG cgCACCCTGAGGCCCAGGAG

Primer P4:CTCAGGGTGC gcGAGGATTGCCCGGAACAGCT

Primer P5:TTCACCTCG cgCTCCTCGCTTTCCCTCTCCAG

Primer P6:AAAGCGAGGAGC gcGAGGTGAACCCGGACCCACT

(underscore place is related mutating alkali yl)

Improved Col1a1 gene order is SEQ ID No.1, and concrete sequence is referring to the sequence 1 in specification sheets Nucleotide and aminoacid sequence table.Wherein, the 273rd is mutating alkali yl with 930.

4, PCR product reclaims and is cloned into T carrier through glue:

According to the Tian Gen biochemical technology PCR of company limited product glue, reclaim test kit specification sheets and reclaim improved gene C ol1a1, the product cloning reclaiming obtains recombinant vectors pMD18-T-Col1a1 in T carrier pMD18-T (TaKaRa company) carrier, by this recombinant vectors CaCl ₂in method conversion and escherichia coli DH5a, screening recon, carries out double digestion electrophoresis to hickie recon, shows that improved gene C ol1a1 is successfully connected with pMD18-T carrier, and be successfully transformed in escherichia coli DH5a through identifying.

5, the structure of shuttle expression plasmid:

Extract recombinant vectors pMD18-T-Col1a1, with Xho I and EcoR I double digestion, obtain object fragment Col1a1, same double digestion Expression vector pPIC9K, and the fragment of two double digestions is above cut to glue and reclaim, by the Col1a1 gene fragment being recovered to and plasmid expression vector pPIC9K under the effect of T4DNA ligase enzyme, at 16 ℃, connect and spend the night, by spending the night, connect the connection product C aCl obtaining ₂method transforms and enters escherichia coli DH5a, on the LB flat board of the kalamycin resistance of 50mg/ml, screen positive recombinant, and carry out double digestion checking, enzyme is cut product through 1% agarose gel electrophoresis, under ultraviolet imager, result as shown in Figure 5, has shown successfully to build the expression vector that be connected product of Col1a1 gene with pPIC9K, and called after pPIC9K-Col1a1, and be transformed in escherichia coli DH5a.

6, electricity transforms Pichia yeast SMD1168:

(1) Pichia yeast SMD1168 electricity turns competent preparation:

The mono-colony inoculation of picking Pichia yeast SMD1168 in 10ml YPD liquid nutrient medium (1% yeast extract, 2% peptone, 2% glucose, water surplus), under 30 ℃ of conditions, 200rpm on shaking table, incubated overnight; The 0.5ml Pichia yeast SMD1168 of inoculation incubated overnight is in fresh 100ml YPD substratum (1% yeast extracts, 2% peptone, 2% glucose, water surplus), and 30 ℃, 200rpm incubated overnight, is cultured to OD ₆₀₀=1.3-1.5; Under the centrifugal action of 1500g, 4 ℃ of centrifugal yeast cell 6min, then with the resuspended thalline of aseptic double-distilled water of 0 ℃ of 100ml; Recentrifuge yeast thalline under the same terms, then with the resuspended yeast cell of 50ml aseptic double-distilled water; Recentrifuge somatic cells under the same terms, with the sorbyl alcohol re-suspended cell of the 1M of 25ml precooling; Last under identical condition centrifugal somatic cells, with the sorbyl alcohol of the 1M of 200 μ l precoolings, mix after somatic cells, be placed in stand-by on ice.

(2) linearizing of expression plasmid carrier and electricity transform Pichia yeast SMD1168:

A large amount of recombinant expression vector pPIC9K-Col1a1 that extract, carry out linearization for enzyme restriction with Sal I to it, and electrophoresis detection result as shown in Figure 5.

Get the above-mentioned pichia spp bacterium competence cell of 100 μ l, add the linearizing recombinant expression plasmid of 10 μ l, and join in the 2mm of ice bath electricity revolving cup; The electric revolving cup that adds linearization plasmid is continued, at ice bath 5min on ice, to put into afterwards electroporation Electro Cell Manipulator 630(Harvard apparatus), electricity is set, and to turn condition be 1.5kV, 25 μ F, 200 Ω, approximately 8.1 ms finish.Electricity adds the sorbyl alcohol of 1ml ice bath in electric revolving cup after turning end immediately, the mixed solution in electric revolving cup is moved in the centrifuge tube of sterilizing to standing cultivation 1h at 30 ℃; Finally get the bacterium liquid of 100 μ l and coat on MD flat board, cultivate 2-5 days for 30 ℃, until there is single bacterium colony to occur.

7, screening positive transformant:

Positive colony growing on picking MD flat board, take N-XhoI and C-EcoRI carries out bacterium colony PCR checking as primer.Its concrete operation step is: single bacterium colony chosen in 50 μ l sterilizing distilled waters, and 100 ℃ of heating 5min, the centrifugal 5min of 12000rpm room temperature, the template using its supernatant liquor as PCR is carried out PCR checking.PCR reaction system is 50 μ l, and its reactive component is: 10 * Taq buffer, 5 μ l; DNTP 4 μ l; Each 1 μ l of upstream and downstream primer; Template 2 μ l, Taq polysaccharase 1 μ l, sterilizing distilled water 36 μ l.Pcr amplification condition is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s; 65 ℃ of annealing 30s; 72 ℃ are extended 3min, 30 circulations; 72 ℃ are extended 10min again.Whether amplified production detects its size with 1.0% agarose gel electrophoresis and matches with actual.

8, the abduction delivering of genetic engineering bacterium COL1A1 albumen:

(1) single bacterium colony of picking positive colony joins (1% yeast extract, 2% peptone and 2% glucose) in 10ml YPD liquid nutrient medium, and 30 ℃, 200rpm overnight incubation activates;

(2) with 1% inoculum size, be inoculated in BMGY liquid nutrient medium (1% yeast extract, 2% peptone, 100 mM potassiumphosphates, pH 6.0,1.34% yeast basis nitrogenous source substratum, 4 * 10 of 100ml ^-5% vitamin H, 1% glycerine, water surplus) in, 30 ℃, 200rpm is cultured to OD ₆₀₀=6.0;

(3) under 1500g centrifugal action, 4 ℃ of centrifugal 6min collect thalline, and are suspended in 200ml BMMY liquid nutrient medium (1% yeast extract, 2% peptone, 100 mM potassiumphosphates, pH 6.0,1.34% yeast basis nitrogenous source substratum, 4 * 10 ^-5% vitamin H, 1% methyl alcohol, water surplus) in, making its initial concentration is OD ₆₀₀=1.0, at 30 ℃, under 200rpm condition, cultivate;

(4) every 24h, adding methyl alcohol to final concentration is 1% to carry out abduction delivering;

(5) induction 72h, gets nutrient solution centrifugal 2min under 12000rpm condition, gets supernatant liquor and in-20 ℃ of preservations.

9, the evaluation of genetically engineered COL1A1 albumen and sequencing:

(1) protein immunoblot (Western blotting), its step is as follows:

A, glue and loading:

(a) preparation 12%SDS-PAGE separation gel, mixes between two clean sheet glass that rear injection edge strip thickness is 2mm, adds skim Virahol on it, standing to solidifying under room temperature.

(b), after the complete polymerization of glue to be separated, the water layer inclining on it, with thieving paper exhaustion residual liquid, inserts application of sample comb, slowly adds 5% concentrated glue, makes it be full of the space between application of sample comb, standing under room temperature.Treat the complete polymerization of glue.

(c) gel is fixed on electrophoresis apparatus, upper and lower groove adds electrophoretic buffer.

(d) carefully take out application of sample comb, make well vertical, with electrophoretic buffer, rinse well for several times.

(e) get respectively 10 μ 1 culture supernatant protein sample and protein molecular weight marker, by 4:1 volume ratio, add 5 * sample buffer, after 1 * sample buffer trim loading volume (cumulative volume 20 μ 1), in boiling water bath, boil 5min and make protein denaturation.

(6) sample of handling well is added in the loading hole of separation gel according to predetermined order.

B, electrophoresis:

(a) connect the power supply of gel-electrophoretic apparatus, initial voltage 70V.(approximately 30 minutes)

(b) leading edge of tetrabromophenol sulfonphthalein dyestuff improves voltage to 120V after entering separation gel upper limb, continues the lower edge of electrophoresis separation gel until tetrabromophenol sulfonphthalein is swum out.(approximately 60 minutes)

C, transferring film

(a) from sheet glass, take out gel, be soaked in transfering buffering liquid.

(b) get the nitrocellulose filter onesize with glue, with 95% alcohol immersion, after 5 seconds, be soaked in transfering buffering liquid more than 5 minutes stand-by.

(c) in shifting folder, place in order in advance through sponge, three metafiltration paper, nitrocellulose filter, gel, three metafiltration paper, the sponge of transfering buffering liquid immersion, there is no bubble between guaranteeing every layer.

(d) transfer is folded up into transfer groove, film at negative pole, connects cooling circulating water, 90V voltage stabilizing transferase 12 hour at positive pole, glue.

D, dyeing

(a) nitrocellulose is immersed to ponceau and use in liquid, jolting dyeing 5-10min.

(b) after protein band occurs, with deionized water, wash away the ponceau background color on nitrocellulose membrane.

(c) according to the position of protein molecular weight Marker indication, cut the nitrocellulose filter at object band place.

E, sealing

Nitrocellulose filter is immersed to 5% skim-milk, and room temperature is shaken 2 hours.

F, wash film and hybridization

(a) with TBST, wash film, wash 3 times, each 10min.

(b) first antibody sealing: monoclonal antibody, with TBST 1:200 dilution, adds envelope to have in the hybridization bag of nitrocellulose filter by 0.1ml/cm2, removes all bubbles, and 4 ℃ of joltings are spent the night.

(c) with TBST, wash film, wash 3 times, each 10min.

(d) second antibody sealing: the goat anti-rabbit igg antibody (1:2000) of horseradish peroxidase (HRP) mark, by 0.1 ml/cm2, add envelope to have in the hybridization bag of nitrocellulose filter, remove all bubbles, under room temperature, shake 60 minutes.

(e) with TBST, wash film, wash 3 times, each 10min.

G, chemoluminescence and exposure

(a) two kinds of reagent in chemical luminescence reagent kit are respectively got to 0.5ml, in the ratio of 1:1, mix, in darkroom, shake and hatch 1 minute with nitrocellulose filter.

(b) with filter paper, be stained with the liquid on dry film, with preservative film, wrap, with sensitive film, in compressing tablet box, expose approximately 1 minute.

(c) sensitive film after exposure developed for approximately 30 seconds in developing solution, and in stop bath, photographic fixing is 1 minute, and water dries after rinsing.

(d) according to exposure status, adjust the time shutter, repeat compressing tablet, developing and fixing, select satisfied film.

(e) repeat to test three times.

(2) mass spectroscopy:

A, SDS-PAGE are separated

By purified protein samples carry out SDS-PAGE (Coomassie brilliant blue (R-250) dyeing, decolouring, with blade respectively by target protein band with 1mm ³volume is cut into micelle, with the 25mmol/L NH containing 50% acetonitrile ₄hCO ₃solution makes it decolouring completely, and micro-heating makes micelle complete drying.

B, enzyme are cut pre-treatment

In dry micelle, add the 25mmol/L NH containing 1.5mg/ml dithiothreitol (DTT) (DTT) ₄hCO ₃, 56 ℃ of water-bath 1hr, abandon DTT, add the 25mmol/L NH containing 10mg/ml iodo-acid amide (IAA) ₄hCO ₃, 37 ℃, darkroom, 1hr, abandons IAA, 100mmol/L NH ₄hCO ₃washing several, dried overnight.

C, pancreatin enzyme are cut

Dry micelle adds trypsin solution 5-10 μ L and the 200 μ L 100mmol/L NH of 1g/L ₄hCO ₃, after fully moistening and the dry micelle of covering, then supplement 200 μ L 100mmol/L NH ₄hCO ₃, 37 ℃ of insulation 24 h, take out jog once in a while.

D, mixed peptide extract

Fully slightly centrifugal collection supernatant after enzymolysis, adds 200 μ L 0.2% trifluoroacetic acids in precipitation micelle again, 40 ℃ of insulation 1hr, slightly centrifugal collection supernatant, merges supernatant, lyophilize, 150 μ L 0.2% trifluoroacetic acids dissolve and mix, and for HPLC-ESI-MS/MS, carry out identification and analysis.

The aminoacid sequence of genetically engineered COL1A1 albumen is SEQ ID No.2, and concrete sequence is referring to the sequence 2 in specification sheets Nucleotide and aminoacid sequence table.

It is cited that content of the present invention is not limited to embodiment, and the conversion of any equivalence that those of ordinary skills take technical solution of the present invention by reading specification sheets of the present invention, is claim of the present invention and contains.

SEQUENCE LISTING

<110> Xi'an giant's biological gene technical concern company limited

<120> transgenic Pichia yeast genetic engineering bacterium and construction process and application

<130> 2013

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 3171

<212> DNA

The improved Col1a1 gene order of <213>

<400> 1

cagctgtctt atggctatga tgagaaatca accggaggaa tttccgtgcc tggccccatg 60

ggtccctctg gtcctcgtgg tctccctggc ccccctggtg cacctggtcc ccaaggcttc 120

caaggtcccc ctggtgagcc tggcgagcct ggagcttcag gtcccatggg tccccgaggt 180

cccccaggtc cccctggaaa gaatggagat gatggggaag ctggaaaacc tggtcgtcct 240

ggtgagcgtg ggcctcctgg gcctcagggt gcccgaggat tgcccggaac agctggcctc 300

cctggaatga agggacacag aggtttcagt ggtttggatg gtgccaaggg agatgctggt 360

cctgctggtc ctaagggtga gcctggcagc cctggtgaaa atggagctcc tggtcagatg 420

ggcccccgtg gcctgcctgg tgagagaggt cgccctggag cccctggccc tgctggtgct 480

cgtggaaatg atggtgctac tggtgctgcc gggccccctg gtcccaccgg ccccgctggt 540

cctcctggct tccctggtgc tgttggtgct aagggtgaag ctggtcccca agggccccga 600

ggctctgaag gtccccaggg tgtgcgtggt gagcctggcc cccctggccc tgctggtgct 660

gctggccctg ctggaaaccc tggtgctgat ggacagcctg gtgctaaagg tgccaatggt 720

gctcctggta ttgctggtgc tcctggcttc cctggtgccc gaggcccctc tggaccccag 780

ggccccggcg gccctcctgg tcccaagggt aacagcggtg aacctggtgc tcctggcagc 840

aaaggagaca ctggtgctaa gggagagcct ggccctgttg gtgttcaagg accccctggc 900

cctgctggag aggaaggaaa gcgaggagcc cgaggtgaac ccggacccac tggcctgccc 960

ggaccccctg gcgagcgtgg tggacctggt agccgtggtt tccctggcgc agatggtgtt 1020

gctggtccca agggtcccgc tggtgaacgt ggttctcctg gccctgctgg ccccaaagga 1080

tctcctggtg aagctggtcg tcccggtgaa gctggtctgc ctggtgccaa gggtctgact 1140

ggaagccctg gcagccctgg tcctgatggc aaaactggcc cccctggtcc cgccggtcaa 1200

gatggtcgcc ccggaccccc aggcccacct ggtgcccgtg gtcaggctgg tgtgatggga 1260

ttccctggac ctaaaggtgc tgctggagag cccggcaagg ctggagagcg aggtgttccc 1320

ggaccccctg gcgctgtcgg tcctgctggc aaagatggag aggctggagc tcagggaccc 1380

cctggccctg ctggtcccgc tggcgagaga ggtgaacaag gccctgctgg ctcccccgga 1440

ttccagggtc tccctggtcc tgctggtcct ccaggtgaag caggcaaacc tggtgaacag 1500

ggtgttcctg gagaccttgg cgcccctggc ccctctggag caagaggcga gagaggtttc 1560

cctggcgagc gtggtgtgca aggtccccct ggtcctgctg gtccccgagg ggccaacggt 1620

gctcccggca acgatggtgc taagggtgat gctggtgccc ctggagctcc cggtagccag 1680

ggcgcccctg gccttcaggg aatgcctggt gaacgtggtg cagctggtct tccagggcct 1740

aagggtgaca gaggtgatgc tggtcccaaa ggtgctgatg gctctcctgg caaagatggc 1800

gtccgtggtc tgactggccc cattggtcct cctggccctg ctggtgcccc tggtgacaag 1860

ggtgaaagtg gtcccagcgg ccctgctggt cccactggag ctcgtggtgc ccccggagac 1920

cgtggtgagc ctggtccccc cggccctgct ggctttgctg gcccccctgg tgctgacggc 1980

caacctggtg ctaaaggcga acctggtgat gctggtgcta aaggcgatgc tggtccccct 2040

ggccctgccg gacccgctgg accccctggc cccattggta atgttggtgc tcctggagcc 2100

aaaggtgctc gcggcagcgc tggtccccct ggtgctactg gtttccctgg tgctgctggc 2160

cgagtcggtc ctcctggccc ctctggaaat gctggacccc ctggccctcc tggtcctgct 2220

ggcaaagaag gcggcaaagg tccccgtggt gagactggcc ctgctggacg tcctggtgaa 2280

gttggtcccc ctggtccccc tggccctgct ggcgagaaag gatcccctgg tgctgatggt 2340

cctgctggtg ctcctggtac tcccgggcct caaggtattg ctggacagcg tggtgtggtc 2400

ggcctgcctg gtcagagagg agagagaggc ttccctggtc ttcctggccc ctctggtgaa 2460

cctggcaaac aaggtccctc tggagcaagt ggtgaacgtg gtccccctgg tcccatgggc 2520

ccccctggat tggctggacc ccctggtgaa tctggacgtg agggggctcc tggtgccgaa 2580

ggttcccctg gacgagacgg ttctcctggc gccaagggtg accgtggtga gaccggcccc 2640

gctggacccc ctggtgctcc tggtgctcct ggtgcccctg gccccgttgg ccctgctggc 2700

aagagtggtg atcgtggtga gactggtcct gctggtcccg ccggtcctgt cggccctgtt 2760

ggcgcccgtg gccccgccgg accccaaggc ccccgtggtg acaagggtga gacaggcgaa 2820

cagggcgaca gaggcataaa gggtcaccgt ggcttctctg gcctccaggg tccccctggc 2880

cctcctggct ctcctggtga acaaggtccc tctggagcct ctggtcctgc tggtccccga 2940

ggtccccctg gctctgctgg tgctcctggc aaagatggac tcaacggtct ccctggcccc 3000

attgggcccc ctggtcctcg cggtcgcact ggtgatgctg gtcctgttgg tccccccggc 3060

cctcctggac ctcctggtcc ccctggtcct cccagcgctg gtttcgactt cagcttcctg 3120

ccccagccac ctcaagagaa ggctcacgat ggtggccgct actaccgggc t 3171

<210> 2

<211> 1057

<212> PRT

The aminoacid sequence of <213> type i collagen α 1 catenin Col1a1

<400> 2

Gln Leu Ser Tyr Gly Tyr Asp Glu Lys Ser Thr Gly Gly Ile Ser

5 10 15

Val Pro Gly Pro Met Gly Pro Ser Gly Pro Arg Gly Leu Pro Gly

20 25 30

Pro Pro Gly Ala Pro Gly Pro Gln Gly Phe Gln Gly Pro Pro Gly

35 40 45

Glu Pro Gly Glu Pro Gly Ala Ser Gly Pro Met Gly Pro Arg Gly

50 55 60

Pro Pro Gly Pro Pro Gly Lys Asn Gly Asp Asp Gly Glu Ala Gly

65 70 75

Lys Pro Gly Arg Pro Gly Glu Arg Gly Pro Pro Gly Pro Gln Gly

80 85 90

Ala Arg Gly Leu Pro Gly Thr Ala Gly Leu Pro Gly Met Lys Gly

95 100 105

His Arg Gly Phe Ser Gly Leu Asp Gly Ala Lys Gly Asp Ala Gly

110 115 120

Pro Ala Gly Pro Lys Gly Glu Pro Gly Ser Pro Gly Glu Asn Gly

125 130 135

Ala Pro Gly Gln Met Gly Pro Arg Gly Leu Pro Gly Glu Arg Gly

140 145 150

Arg Pro Gly Ala Pro Gly Pro Ala Gly Ala Arg Gly Asn Asp Gly

155 160 165

Ala Thr Gly Ala Ala Gly Pro Pro Gly Pro Thr Gly Pro Ala Gly

170 175 180

Pro Pro Gly Phe Pro Gly Ala Val Gly Ala Lys Gly Glu Ala Gly

185 190 195

Pro Gln Gly Pro Arg Gly Ser Glu Gly Pro Gln Gly Val Arg Gly

200 205 210

Glu Pro Gly Pro Pro Gly Pro Ala Gly Ala Ala Gly Pro Ala Gly

215 220 225

Asn Pro Gly Ala Asp Gly Gln Pro Gly Ala Lys Gly Ala Asn Gly

230 235 240

Ala Pro Gly Ile Ala Gly Ala Pro Gly Phe Pro Gly Ala Arg Gly

245 250 255

Pro Ser Gly Pro Gln Gly Pro Gly Gly Pro Pro Gly Pro Lys Gly

260 265 270

Asn Ser Gly Glu Pro Gly Ala Pro Gly Ser Lys Gly Asp Thr Gly

275 280 285

Ala Lys Gly Glu Pro Gly Pro Val Gly Val Gln Gly Pro Pro Gly

290 295 300

Pro Ala Gly Glu Glu Gly Lys Arg Gly Ala Arg Gly Glu Pro Gly

305 310 315

Pro Thr Gly Leu Pro Gly Pro Pro Gly Glu Arg Gly Gly Pro Gly

320 325 330

Ser Arg Gly Phe Pro Gly Ala Asp Gly Val Ala Gly Pro Lys Gly

335 340 345

Pro Ala Gly Glu Arg Gly Ser Pro Gly Pro Ala Gly Pro Lys Gly

350 355 360

Ser Pro Gly Glu Ala Gly Arg Pro Gly Glu Ala Gly Leu Pro Gly

365 370 375

Ala Lys Gly Leu Thr Gly Ser Pro Gly Ser Pro Gly Pro Asp Gly

380 385 390

Lys Thr Gly Pro Pro Gly Pro Ala Gly Gln Asp Gly Arg Pro Gly

395 400 405

Pro Pro Gly Pro Pro Gly Ala Arg Gly Gln Ala Gly Val Met Gly

410 415 420

Phe Pro Gly Pro Lys Gly Ala Ala Gly Glu Pro Gly Lys Ala Gly

425 430 435

Glu Arg Gly Val Pro Gly Pro Pro Gly Ala Val Gly Pro Ala Gly

440 445 450

Lys Asp Gly Glu Ala Gly Ala Gln Gly Pro Pro Gly Pro Ala Gly

455 460 465

Pro Ala Gly Glu Arg Gly Glu Gln Gly Pro Ala Gly Ser Pro Gly

470 475 480

Phe Gln Gly Leu Pro Gly Pro Ala Gly Pro Pro Gly Glu Ala Gly

485 490 495

Lys Pro Gly Glu Gln Gly Val Pro Gly Asp Leu Gly Ala Pro Gly

500 505 510

Pro Ser Gly Ala Arg Gly Glu Arg Gly Phe Pro Gly Glu Arg Gly

515 520 525

Val Gln Gly Pro Pro Gly Pro Ala Gly Pro Arg Gly Ala Asn Gly

530 535 540

Ala Pro Gly Asn Asp Gly Ala Lys Gly Asp Ala Gly Ala Pro Gly

545 550 555

Ala Pro Gly Ser Gln Gly Ala Pro Gly Leu Gln Gly Met Pro Gly

560 565 570

Glu Arg Gly Ala Ala Gly Leu Pro Gly Pro Lys Gly Asp Arg Gly

575 580 585

Asp Ala Gly Pro Lys Gly Ala Asp Gly Ser Pro Gly Lys Asp Gly

590 595 600

Val Arg Gly Leu Thr Gly Pro Ile Gly Pro Pro Gly Pro Ala Gly

605 610 615

Ala Pro Gly Asp Lys Gly Glu Ser Gly Pro Ser Gly Pro Ala Gly

620 625 630

Pro Thr Gly Ala Arg Gly Ala Pro Gly Asp Arg Gly Glu Pro Gly

635 640 645

Pro Pro Gly Pro Ala Gly Phe Ala Gly Pro Pro Gly Ala Asp Gly

650 655 660

Gln Pro Gly Ala Lys Gly Glu Pro Gly Asp Ala Gly Ala Lys Gly

665 670 675

Asp Ala Gly Pro Pro Gly Pro Ala Gly Pro Ala Gly Pro Pro Gly

680 685 690

Pro Ile Gly Asn Val Gly Ala Pro Gly Ala Lys Gly Ala Arg Gly

695 700 705

Ser Ala Gly Pro Pro Gly Ala Thr Gly Phe Pro Gly Ala Ala Gly

710 715 720

Arg Val Gly Pro Pro Gly Pro Ser Gly Asn Ala Gly Pro Pro Gly

725 730 735

Pro Pro Gly Pro Ala Gly Lys Glu Gly Gly Lys Gly Pro Arg Gly

740 745 750

Glu Thr Gly Pro Ala Gly Arg Pro Gly Glu Val Gly Pro Pro Gly

755 760 765

Pro Pro Gly Pro Ala Gly Glu Lys Gly Ser Pro Gly Ala Asp Gly

770 775 780

Pro Ala Gly Ala Pro Gly Thr Pro Gly Pro Gln Gly Ile Ala Gly

785 790 795

Gln Arg Gly Val Val Gly Leu Pro Gly Gln Arg Gly Glu Arg Gly

800 805 810

Phe Pro Gly Leu Pro Gly Pro Ser Gly Glu Pro Gly Lys Gln Gly

815 820 825

Pro Ser Gly Ala Ser Gly Glu Arg Gly Pro Pro Gly Pro Met Gly

830 835 840

Pro Pro Gly Leu Ala Gly Pro Pro Gly Glu Ser Gly Arg Glu Gly

845 850 855

Ala Pro Gly Ala Glu Gly Ser Pro Gly Arg Asp Gly Ser Pro Gly

860 865 870

Ala Lys Gly Asp Arg Gly Glu Thr Gly Pro Ala Gly Pro Pro Gly

875 880 885

Ala Pro Gly Ala Pro Gly Ala Pro Gly Pro Val Gly Pro Ala Gly

890 895 900

Lys Ser Gly Asp Arg Gly Glu Thr Gly Pro Ala Gly Pro Ala Gly

905 910 915

Pro Val Gly Pro Val Gly Ala Arg Gly Pro Ala Gly Pro Gln Gly

920 925 930

Pro Arg Gly Asp Lys Gly Glu Thr Gly Glu Gln Gly Asp Arg Gly

935 940 945

Ile Lys Gly His Arg Gly Phe Ser Gly Leu Gln Gly Pro Pro Gly

950 955 960

Pro Pro Gly Ser Pro Gly Glu Gln Gly Pro Ser Gly Ala Ser Gly

965 970 975

Pro Ala Gly Pro Arg Gly Pro Pro Gly Ser Ala Gly Ala Pro Gly

980 985 990

Lys Asp Gly Leu Asn Gly Leu Pro Gly Pro Ile Gly Pro Pro Gly

995 1000 1005

Pro Arg Gly Arg Thr Gly Asp Ala Gly Pro Val Gly Pro Pro Gly

1010 1015 1020

Pro Pro Gly Pro Pro Gly Pro Pro Gly Pro Pro Ser Ala Gly Phe

1025 1030 1035

Asp Phe Ser Phe Leu Pro Gln Pro Pro Gln Glu Lys Ala His Asp

1040 1045 1050

Gly Gly Arg Tyr Tyr Arg Ala

1055

Claims (6)

1. a transgenic Pichia yeast genetic engineering bacterium, is characterized in that:

Described genetic engineering bacterium is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on August 5th, 2013, and deposit number is CGMCC No.7981.

2. a kind of transgenic Pichia yeast genetic engineering bacterium according to claim 1, is characterized in that:

Described genetic engineering bacterium is, after the people's type i collagen α 1 chain gene Col1a1 to cloning from human placenta transforms, to be connected with Expression vector pPIC9K carrier, imports the genetic engineering bacterium that in Pichia yeast SMD1168, structure forms.

3. a construction process for transgenic Pichia yeast genetic engineering bacterium, is characterized in that:

By following steps, realized:

Step 1: clone type i collagen α 1 chain gene Col1a1 from human placenta;

Step 2: the base that type i collagen α 1 chain gene Col1a1 is related to the XhoI restriction enzyme site transformation that suddenlys change;

Step 3: improved type i collagen α 1 chain gene Col1a1 is connected with Expression vector pPIC9K carrier, constructs expression plasmid pPIC9K-Col1a1;

Step 4: by after the expression plasmid pPIC9K-Col1a1 linearization for enzyme restriction building, import in Pichia yeast SMD1168;

Step 5: measure type i collagen α 1 chain gene Col1a1 conversion and entered in Pichia yeast SMD1168, thereby obtain transgenic Pichia yeast engineering.

4. the construction process of a kind of transgenic Pichia yeast genetic engineering bacterium according to claim 3, is characterized in that:

The improved Col1a1 gene order that step 2 obtains is SEQ ID No.1.

5. the application of a kind of transgenic Pichia yeast genetic engineering bacterium according to claim 1 in the high efficient expression of type i collagen α 1 catenin.

6. the application of a kind of transgenic Pichia yeast genetic engineering bacterium according to claim 5 in the high efficient expression of type i collagen α 1 catenin, is characterized in that:

Expressed type i collagen α 1 catenin Col1a1, its aminoacid sequence is SEQ ID No.2.

Images