CN109988243A

CN109988243A - III collagen type α of recombination human source, 1 chain and its application

Info

Publication number: CN109988243A
Application number: CN201910088754.XA
Authority: CN
Inventors: 梁亮; 王丽萍
Original assignee: Jiangsu Yuezhi Biology Medicine Co ltd
Current assignee: Jiangsu Yuezhi Biology Medicine Co ltd
Priority date: 2019-01-29
Filing date: 2019-01-29
Publication date: 2019-07-09
Also published as: CN110606896B; CN110606896A

Abstract

The invention discloses a kind of 1 chain of recombination human source type III collagen α and its applications, the nucleotide sequence of 1 chain of recombination human source type III collagen α is encoded as shown in SEQ ID NO:1,1 chain of recombination human source type III collagen α successively includes from aminoterminal: aminoterminal affinity purification label, source of people type III collagen maturation peptide chain and c-terminus affinity purification label.Recombination human source type III collagen according to an embodiment of the present invention, there is specific affinity purification label by all designing at the both ends of source of people type III collagen maturation peptide chain, be conducive to the purifying of full-length proteins, it can also be used for the identification of collagen, and the recombination human source type III collagen according to an embodiment of the present invention is using the mature peptide chain of type III collagen, the propetide at both ends is eliminated, expression quantity is much higher than the gene comprising propetide.

Description

III collagen type α of recombination human source, 1 chain and its application

Technical field

The present invention relates to gene engineering technology fields, more particularly it relates to a kind of recombination human source type III collagen egg White 1 chain of α and its application.

Background technique

Collagen is the main protein in all connective tissues including skin, bone, tendon and cartilage.For example, It forms big fibre bundle in skin, and each fibre bundle includes many single collagenous fibrils again, so that skin texture is strong It is strong and flexible.Content is very rich in human body for the collagen of three mature spirals, non-to a series of industry and medical application It is often valuable.Collagen has been widely used in clinical application field, is including soft tissue expander, wound and burn Reparation, orthopaedics and angiocarpy etc. be proved to safe and effective.

Human type III collagen's albumen (hCOL3A1) belongs to the collagen to form fiber, is distributed widely in skin, internal organ In the extensible connective tissue such as organ or vascular system.It is in human body wound healing, and collagenous fibres are formed and angiocarpy is normal Key effect is played in development.

There are mainly two types of the approach of kind for the acquisition of collagen, conventional method and heterologous protein including deriving from animal tissue Expression.Conventional method mainly handles the tissue of animal origin by acid, alkali or enzymatic isolation method, and what these methods obtained is length The mixing collagen peptide section that degree does not wait, makes troubles to purifying；Since the rejection that heterologous collagen is clinically shown is anti- It answers, limits it as the application in terms of biomedical material and pharmaceutical carrier.The host master that heterologous protein expression uses at present It to include mammalian cell, animal body, plant and microorganism, microbial expression has yield height, production compared to other technologies The advantages that period is short, culture is simple, at low cost, easy acquisition high density fermentation.Currently used for recombinant expression human collagen or bright The host strain of glue has Pichia pastoris, saccharomyces cerevisiae, Hansenula yeast, Escherichia coli and brevibacterium.Pichia pastoris fermentation expression yield High, culture medium is simply, expression is protein stabilized and is easy to purify, and modification such as glycosylates ability after albumen has.Using finishing red ferment Female heterogenous expression collagen has greater advantage.

In the prior art for industrial mostly gelatin, have no that collagen maturation peptide chain is mass produced.David R. Olsen's etc. research shows that without when peptide gene, expression quantity is respectively the 18 of procollagen before both ends in the gene of type i collagen Times, lack before N 4.6 times of peptide gene and lack peptide gene before C 3 times.And the recombinant expression source of people collagen for production, lead to Often does not add or only add affinity tag at one end, and the mature peptide chain given expression to is easier to degrade, through traditional non-specific purifying The purity of protein that method or the purifying of single affinity tag obtain is inadequate, it is difficult to remove Partial digestion product, be unable to satisfy to purity Demanding application.Obtaining collagen using microorganism in the prior art, there is also following shortcomings: expressing the DNA of collagen Sequence is the natural coding sequence (general to be obtained by reverse transcription method) in human genome, but microorganism and people are in gene Transcription, have in translation process different on the Preference of certain difference, especially codon, use people's collagen Natural DNA sequences encoding is expressed in microorganism, can be because of accurate translation efficiency caused by structure of codon preference, mRNA etc. Lowly.

Summary of the invention

The present invention is directed at least solve one of above-mentioned technical problem.

For this purpose, the present invention proposes a kind of 1 chain of recombination human source type III collagen α, recombination human source type III collagen α The purifying of 1 chain and identification are convenient.

The present invention also proposes a kind of application of 1 chain of recombination human source type III collagen α.

1 chain of recombination human source type III collagen α of embodiment according to a first aspect of the present invention, encodes the recombined human The nucleotide sequence of 1 chain of source type III collagen α is as shown in SEQ ID NO:1, the recombination human source type III collagen α 1 Chain successively includes from aminoterminal: aminoterminal affinity purification label, source of people type III collagen maturation peptide chain and c-terminus are affine pure Change label.

1 chain of recombination human source type III collagen α according to the above embodiment of the present invention can also have following add Technical characteristic

According to one embodiment of present invention, the aminoterminal affinity purification label is 6His label, the c-terminus parent It is Strep label with purification tag.

According to one embodiment of present invention, the source of people type III collagen maturation peptide chain include human III type collagen N-terminal peptide, People III Collagen Type VI is at helical region, human III type collagen C-terminal peptide, and the nucleotide sequence of the source of people type III collagen maturation peptide chain is such as Shown in SEQ ID NO:2.

According to one embodiment of present invention, the nucleotide sequence of the source of people type III collagen maturation peptide chain is by natural gum Its codon is adjusted to obtain by protogene sequence according to the frequency of use of host's codon.

According to one embodiment of present invention, the host is Pichia pastoris, described to be adjusted to the natural gum former base Because the rare codon optimization in sequence in Pichia pastoris is its preferred codons.

According to one embodiment of present invention, the amplification of the nucleotide sequence of the source of people type III collagen maturation peptide chain is drawn Object F (SEQ ID NO:3) and R (SEQ ID NO:4) is as follows:

F:CGGAATTCCATCATCATCATCATCATCAATACGACTCTTATGACGTGA, restriction enzyme site are EcoR I；

R:CGGAATTCTTACTTCTCGAATTGTGGGTGAGACCATCCATAATATGGTGCGAAT CCAC, restriction enzyme site EcoR I。

According to one embodiment of present invention, the N-terminal increase of the amplimer can express the nucleotide sequence of 6His, The end C is expanded after increasing the nucleotide sequence that can express Strep.

The application of 1 chain of recombination human source type III collagen α of embodiment according to a second aspect of the present invention, the recombined human Source type III collagen is applied to medical dressing, the mass fraction of the medical dressing each component are as follows: according to above-described embodiment The recombination human source type III collagen 0.1%~0.5%；Moisturizer 1%~10%；Carbomer 0.1%~1%；Three Ethanol amine 0.1%~10%；Remaining is purified water.

According to one embodiment of present invention, the recombination human source type III collagen is applied to collagen dressing patch, The collagen dressing patch is made of non-woven fabrics base material and the collagen dressing being located on the non-woven fabrics base material, described The mass fraction of collagen dressing each component are as follows: the recombination human source type III collagen according to above-described embodiment 0.1%~0.5%；Moisturizer 1%~10%；Thickener 0.1%~2%；Remaining is purified water.

According to one embodiment of present invention, the skin that the recombination human source type III collagen is applied to micro-shaping sticks Film protective agent, the mass fraction of the skin and mucosa protecting group each component are as follows: the recombination human source according to above-described embodiment Type III collagen 0.1%~1%；Sodium Hyaluronate 0.1%~1%；Moisturizer 0~40%；Remaining is purified water.

According to one embodiment of present invention, the recombination human source type III collagen is applied to external use skin care, described The mass fraction of external use skin care each component are as follows: the recombination human source type III collagen 0.01% according to above-described embodiment ~0.1%；Moisturizer 1%~5%；Butanediol 1%~5%；Sodium Hyaluronate 0.01%~0.1%；Carbomer 0.1%~ 1%；Glycine betaine 1%~5%；Silk peptide 0.01%~0.1%；Beta glucan 0.1%~1%；Jojoba ester 0.01%~ 0.1%；Dipotassium glycyrrhizinate 0.1%~0.5%；Triethanolamine 0.1%~1%；Remaining is purified water.

According to one embodiment of present invention, the recombination human source type III collagen is applied to importing property skin care item, institute State the mass fraction of importing property skin care item each component are as follows: the recombination human source type III collagen according to above-described embodiment 0.1%~0.5%；Moisturizer 1%~10%；Sodium Hyaluronate 0.1%~0.5%；Micromolecule hyaluronic acid sodium 0.01%~ 0.05%；Sodium chloride 0.8%~1%；Argireline 0.0005%~0.002%；Remaining is purified water.

1 chain of recombination human source type III collagen α according to an embodiment of the present invention at least has following technical effect that

(1) at the both ends of collagen, design has 1 chain of recombination human source type III collagen α according to an embodiment of the present invention Different specific affinity purification labels, is conducive to the purifying of full-length proteins, it can also be used to the identification of collagen；

(2) 1 chain of recombination human source type III collagen α according to an embodiment of the present invention is using type III collagen Mature peptide chain, eliminates the propetide at both ends, and expression quantity is much higher than the gene comprising propetide；

(3) 1 chain of recombination human source type III collagen α according to an embodiment of the present invention is according to Pichia pastoris codon preference Property, codon optimization has been carried out to type III glue protogene, has eliminated rare codon and hairpin structure in Pichia pastoris, has been led to Synonymous conversion is crossed, the secondary structure of mRNA is optimized, codon is avoided and utilizes translation efficiency caused by limitation low, make it more Suitable for being expressed in Pichia pastoris.

Additional aspect and advantage of the invention will be set forth in part in the description, and will partially become from the following description Obviously, or practice through the invention is recognized.

Detailed description of the invention

Above-mentioned and/or additional aspect of the invention and advantage will become from the description of the embodiment in conjunction with the following figures Obviously and it is readily appreciated that, in which:

Fig. 1 be according to the recombination human source type III collagen of the embodiment of the present invention during the preparation process used by carrier The constructing technology route map of pPIC9K-His-COL3-Strep；

Fig. 2 is that recombination Pichia yeast engineering expresses recombination human source type III collagen according to an embodiment of the present invention SDS-PAGE analysis chart；

Fig. 3 is to detect figure according to the Western Blot of the recombination human source type III collagen of the embodiment of the present invention；Fig. 3 a Scheme for the WB of anti-Srtep-tag II antibody, Fig. 3 b is that the WB of anti-His antibody schemes；

Fig. 4 a and Fig. 4 b are the mass spectrometry results figure of band at 116KDa in Fig. 2.

Specific embodiment

The embodiment of the present invention is described below in detail, examples of the embodiments are shown in the accompanying drawings.Below with reference to The embodiment of attached drawing description is exemplary, and for explaining only the invention, and is not considered as limiting the invention.

1 chain of recombination human source type III collagen α according to an embodiment of the present invention is described first below.

Encode the nucleotide sequence such as SEQ of 1 chain of recombination human source type III collagen α according to an embodiment of the present invention Shown in ID NO:1,1 chain of recombination human source type III collagen α successively includes from aminoterminal: aminoterminal affinity purification mark Label, source of people type III collagen maturation peptide chain and c-terminus affinity purification label.

In other words, the recombination human source type III collagen according to an embodiment of the present invention is one kind in source of people type III glue On the basis of former maturation peptide chain, the collagen of affinity purification label is respectively provided in amino acid and c-terminus.Pass through as a result, All designing at the both ends of source of people type III collagen maturation peptide chain has specific affinity purification label, is conducive to the pure of full-length proteins Change, it can also be used to the identification of collagen, and the recombination human source type III collagen according to an embodiment of the present invention is adopted It is the mature peptide chain of type III collagen, eliminates the propetide at both ends, expression quantity is much higher than the gene comprising propetide.

Optionally, according to one embodiment of present invention, the aminoterminal affinity purification label is 6His label, the carboxylic Cardinal extremity affinity purification label is Strep label.Using the double affinity tags purifying in both ends, can obtain it is single, completely without degradation Type III collagen maturation peptide chain, be applicable to the field that field of medicaments etc. requires product uniformity.Both sequence labels Very little does not influence the biological function of collagen；Two kinds of labels can be used as the specificity of the detection of type III collagen, identification simultaneously Flag sequence.

In certain specific embodiments of the invention, the source of people type III collagen maturation peptide chain includes human III type collagen N-terminal peptide, human III type collagen are at helical region, human III type collagen C-terminal peptide, the nucleotide of the source of people type III collagen maturation peptide chain Sequence is as shown in SEQ ID NO:2.Preferably, the nucleotide sequence of the source of people type III collagen maturation peptide chain is by natural collagen Its codon is adjusted to obtain by gene order according to the frequency of use of host's codon.Further, the host is complete Red yeast, it is described to be adjusted to the rare codon optimization in the natural collagen gene order in Pichia pastoris to be its preference Codon.

That is, source of people type III collagen maturation peptide chain according to an embodiment of the present invention is mainly by human III type collagen N-terminal Peptide, human III type collagen are formed at helical region, human III type collagen C-terminal peptide, and nucleotide sequence is as shown in SEQ ID NO:2.It should Gene is the gene after optimization, and the gene order of the type III collagen maturation peptide chain of optimization is by the password in natural collagen gene Son is adjusted by host's codon usage frequency, does not change the amino acid sequence of natural collagen；Pass through the method for de novo formation The sequence is synthesized, expressing host used is Pichia pastoris.

The human III type collagen maturation peptide chain that the present invention expresses has complete protein sequence, comprising having cell adherence Active peptide fragment and other have the sequence of bioactivity, can make its complete biological function；Carry out Expression product using Pichia pastoris Collagen, endotoxin-free, and a variety of posttranslational modifications can be carried out to collagen, have more with the collagen of its production Good biological function.

The recombination engineering and protein preparation method of expression said gene is detailed below.

Step 1: building recombinant expression carrier

Firstly, providing a kind of gene order of source of people type III collagen maturation peptide chain optimized.Wherein, of the invention Optimize its corresponding gene order under the premise of not changing collagen original amino acid sequence, optimization processing is basis Pichia pastoris preferred codons carry out, by collagen gene sequence in Pichia pastoris rare codon agg, cgt, Ggg, ggc, gca etc. are optimized for its preferred codons aga, ggt, gct etc., it is made to be more conducive to express in Pichia pastoris.Its base Because sequence is as shown in SEQ ID NO.2.

Then, said gene sequence is obtained by the side of gene chemical synthesis.Design the nucleosides of source of people type III collagen maturation peptide chain The amplimer F (SEQ ID NO:3) and R (SEQ ID NO:4) of acid sequence are as follows:

The N-terminal increase of the amplimer can express the nucleotide sequence of 6His, and C-terminal increase can express Strep's It is expanded after nucleotide sequence.The type III collagen maturation peptide chain optimized using the gene order of de novo formation as template amplification Gene, product length 3262bp.By amplified production His-3A1-Strep and carrier pPIC9K respectively through EcoR I single endonuclease digestion, Plasmid is through alkaline phosphatase treatment, with Solution I connection reagent (being purchased from Dalian TaKaRa company) connection building expression matter Grain pPIC9K-His-3A1-Strep.

Step 2: building gene recombined Pichia pastoris engineering bacteria

Recombinant expression plasmid pPIC9K-His-3A1-Strep restriction enzyme Sal I is linearized, and electricity is transferred to In Pichia pastoris competent cell, with histidine defect phenotypic marker and the high copy positive recombinant of G418 resistance marker screening, obtain To recombinant yeast pichia pastoris engineering bacteria.

Step 3: preparation and reorganization source of people type III collagen

Pichia yeast engineering 16h-~18h is cultivated based on 30 DEG C, 220rpm with BMGY culture, until OD600 reaches 2~6； 1500g~3000g is centrifuged 5min at room temperature, collects thallus, and thallus is resuspended with BMMY culture medium, makes OD600 1~2, in 30 DEG C, 220rpm cultivate 3 days；Every methanol that adds for 24 hours into culture medium is to final concentration of 1%；After fermentation, it is collected by centrifugation Clearly, Ni-NTA resin adsorption recombination human source type III collagen is used under the conditions of non denatured, penetrates out impurity, elutes recombined human Source type III collagen collects eluent；Strep-Tactin resin adsorption recombination human source type III collagen, penetrates out Impurity elutes recombination human source type III collagen, collects eluent, eluent is by ultrafiltration system desalination, concentration, concentrate It is freeze-dried to obtain recombination human source type III collagen.

The present invention has carried out codon optimization to type III glue protogene according to Pichia pastoris codon preference as a result, Rare codon and the hairpin structure in Pichia pastoris are eliminated, by synonymous conversion, optimizes the secondary structure of mRNA, avoids Codon is low using translation efficiency caused by limiting, and makes it be more suitable for expressing in Pichia pastoris.

To sum up, to provide a kind of both ends equal for the recombination human source type III collagen according to an embodiment of the present invention Type III collagen maturation peptide chain with affinity purification label, solves purification difficult caused by catabolite in the prior art and asks Topic facilitates purifying to obtain overall length, source of people type III collagen maturation peptide fragment without protein degradation.And according to amino acid sequence The translation effect of collagen in recombination yeast can be improved in the codon usage frequency optimization gene sequence of column and Pichia pastoris Rate.

The application of the recombination human source type III collagen according to an embodiment of the present invention is detailed below.

The recombination human source type III collagen according to an embodiment of the present invention can be applied to multiple fields, such as cure With auxiliary material, the collagen dressing patch for micro-shaping, skin and mucosa protective agent, cosmetics and importing property beauty product etc..

Specifically, when the recombination human source type III collagen is applied to medical dressing, the medical dressing each component Mass fraction are as follows: recombination human source type III collagen 0.1%~0.5%；Moisturizer 1%~10%；Carbomer 0.1%~ 1%；Triethanolamine 0-1%~10%；Remaining is purified water.Wherein, moisturizer can be glycerol.

When the recombination human source type III collagen is applied to collagen dressing patch, the collagen dressing patch It is made of non-woven fabrics base material and the collagen dressing being located on the non-woven fabrics base material, the collagen dressing each component Mass fraction are as follows: recombination human source type III collagen 0.1%~0.5%；Moisturizer 1%~10%；Thickener 0.1%~ 2%；Remaining is purified water.Wherein, moisturizer can be glycerol, and thickener can be xanthan gum.

When the recombination human source type III collagen is applied to the skin and mucosa protective agent of micro-shaping, the skin is glutinous The mass fraction of film protecting group each component are as follows: recombination human source type III collagen 0.1%~1%；Sodium Hyaluronate 0.1%~ 1%；Moisturizer 0~40%；Remaining is purified water.Wherein, moisturizer can be glycerol.After obtained preparation solution sterilizing, nothing Bacterium is filling.

When the recombination human source type III collagen is applied to prepare cosmetics, such as when external use skin care, the external application The mass fraction of skin care item each component are as follows: recombination human source type III collagen 0.01%~0.1%；Moisturizer 1%~5%； Butanediol 1%~5%；Sodium Hyaluronate 0.01%~0.1%；Carbomer 0.1%~1%；Glycine betaine 1%~5%；Silk peptide 0.01%~0.1%；β-glucan 0.1%~1%；Jojoba ester 0.01%~0.1%；Dipotassium glycyrrhizinate 0.1%~ 0.5%；Triethanolamine 0.1%~1%；Remaining is purified water.Wherein, moisturizer can be glycerol.

When the recombination human source type III collagen be applied to import property beauty product, such as import property skin care item when, institute State the mass fraction of importing property skin care item each component are as follows: recombination human source type III collagen 0.1%~0.5%；Moisturizer 1% ~10%；Sodium Hyaluronate 0.1%~0.5%；Micromolecule hyaluronic acid sodium 0.01%~0.05%；Sodium chloride 0.8%~ 1%；Argireline 0.0005%~0.002%；Remaining is purified water.Wherein, moisturizer can be glycerol.

The recombination human source type III collagen according to an embodiment of the present invention can be applied to multiple fields as a result, by There is complete protein sequence in the human III type collagen maturation peptide chain that the present invention expresses, comprising with cell adhesion activity Peptide fragment and other have the sequence of bioactivity, can make its complete biological function, therefore, use the recombination human source type III glue The Related product of former albumen also has corresponding biological function.

Describe combined with specific embodiments below the recombination human source type III collagen of the invention preparation process and Using.

One, the Pichia pastoris Pichia pastoris SMD1168 bacterial strain selected by the present invention, Expression vector pPIC9K are equal Purchased from Invitrogen company, the U.S..

Two, culture medium prescription is as follows:

1) YPD complete medium:

Yeast extract 10g/L, peptone 20g/L, glucose 20g/L (solid medium contains 2% agar)；

2) MD culture medium (Selective agar medium):

With 100mL, 121 DEG C of agarose 2g (20g/L) sterilizing 20 minutes is added into 80mL water, is down to 60 DEG C to temperature 10 × YNB 10mL (13.4g/L) is added on the super-clean bench later, 10 × glucose 10mL (20g/L), 500 × biotin 0.2mL(4×10^-4g/L)；

3) BMGY culture medium (yeast growth medium):

It is completely dissolved 10g yeast extract, 20g peptone, 3g K₂HPO₄, 11.8g KH₂PO₄, constant volume to 890mL.121 DEG C steam high-voltage sterilizing 20min is cooled to after 60 DEG C and 10 × YNB 100mL (13.4g/L) is added on the super-clean bench, and 500 × biotin 1mL (4 × 10^-4G/L), glycerol 10mL；

4) BMMY culture medium (yeast induced medium):

It is completely dissolved 10g yeast extract, 20g peptone, 3g K₂HPO₄, 11.8g KH₂PO₄, constant volume to 895mL.121 DEG C steam high-voltage sterilizing 20min is cooled to after 60 DEG C and 10 × YNB 100mL (13.4g/L) is added on the super-clean bench, and 500 × biotin 1mL (4 × 10^-4G/L), methanol 5mL.

Embodiment 1

The overall length of genetic recombination source of people type III collagen is 1082 amino acid, and aminoterminal is 6His label, carboxyl End is Strep label, and the amino acid sequence of the genetic recombination source of people type III collagen is as shown in SEQ ID NO.1.

The preparation method is as follows:

1, recombinant expression carrier (as shown in Figure 1) is constructed

1.1 synthesis optimizing genes

According to the gene order NM_000090.3 of the Genebank type III collagen logged in, made according to Pichia pastoris codon The low codon of utilization rate is eliminated come optimization gene codon with frequency, while eliminating EcoR in sequence using synonymous conversion method The restriction enzyme sites such as I (GAATTC), Not I (GCGGCCGC), eliminate 2 GGTAAG splice sites and 4 GGTGAT montages Site, the type III glue protogene sequence after optimization are shown in SEQ ID NO.2, and the type III glue protogene sequence after optimization is by Nanjing Jin Sirui Biotechnology Co., Ltd is artificial synthesized.

1.2 amplification His-3A1-Strep genes

Primer Primer 5.0 is utilized according to design of primers principle according to the gene order of the type III collagen of optimization Software design PCR amplification primer, and the gene of 6His and Strep label is added on two primers respectively, 5 ' ends add EcoR I restriction enzyme site.Primer is synthesized by Shanghai biotechnology Services Co., Ltd.

F:CGGAATTCCATCATCATCATCATCATCAATACGACTCTTATGACGTGA (SEQ ID NO.3)

R:CGGAATTCTTACTTCTCGAATTGTGGGTGAGACCATCCATAATATGGTGCGAAT CCAC (SEQ ID NO.4)

With above-mentioned primer amplification target gene, the high fidelity enzyme that PCR is used is 2 × Master of Q5 Mix of NEB.Wherein, PCR condition is 98 DEG C of initial denaturations, 2min, a thermal cycle；98 DEG C of thermal denaturation 10s, 55 DEG C of annealing 30s, 72 DEG C of extension 90s, 40 A thermal cycle；72 DEG C of extension 2min.

1.3 PCR product single endonuclease digestions

With the PCR product in EcolR I single endonuclease digestion digestion step 1.2, target fragment His-3A1-Strep, reaction are recycled System is following (restriction endonuclease and buffer used are purchased from Dalian TaKaRa company)

3 μ g of PCR product

10 × H buffer, 5 μ L

EcolR I 10U

Sterile water is to 50 μ L

1.4 plasmid pPIC9K single endonuclease digestions

With Eco1R I single endonuclease digestion digested plasmid pPIC9K, linearized vector, the following (restriction endonuclease used of reaction system are recycled And buffer is purchased from Dalian TaKaRa company)

5 μ g of plasmid pPIC9K

10 × H buffer, 10 μ L

EcolR I 50U

Sterile water is to 100 μ L

1.5 is pure by step 1.3 and the resulting target fragment of step 1.4 step and carrier segments, PCR product purification kit Change, which is purchased from Dalian TaKaRa company, and concrete operations are carried out by kit specification.

The 1.6 carrier pPIC9K recycled by step 1.5 step are handled through CIAP, remove 5 '-ends of vector DNA fragment The phosphate group at end.Reaction system is following, and (kit used is purchased from Dalian TaKaRa company, and concrete operations are said by kit Bright book carries out)

20 μ L of plasmid pPIC9K carrier segments

10×Alkaline Phosphatase Buffer 5μL

CIAP(30U/μL)1μL

Sterile water is to 50 μ L

1.7 carriers that will be obtained after the target fragment His-3A1-Strep that step 1.5 recycling obtains and step 1.6 processing PPIC9K is attached reaction with Solution I connection reagent (being purchased from Dalian TaKaRa company), and target fragment is properly inserted To in containing secretion signal α-factor excretion vector reading frame, reaction system is as follows:

2 μ L of plasmid pPIC9K linearized fragment

His-3A1-Strep 3μL

5 μ L of Solution I connection reagent

Recombinant expression carrier pPIC9K-His-3A1-Strep is obtained, building schematic diagram is as shown in Figure 1.

Connection product conversion is entered into competent E.coli DH5 α, in positive gram of the screening of LB resistant panel containing Amp It is grand, bacterium colony PCR verifying is carried out using primers F and 3 ' AOX1 of universal primer, the segment for having size to be 3381bp is positive gram It is grand.After extracting plasmid enzyme restriction identification correctly, recombinant plasmid is subjected to sequencing identification.

2, recombinant yeast pichia pastoris engineering bacteria is constructed

The linearisation of 2.1 Expression vector pPIC9K-His-3A1-Strep

It is carried out being digested overnight in 37 DEG C with restriction enzyme Sal I, reaction system is as follows:

10 μ g of plasmid pPIC9K-His-3A1-Strep

10 × H buffer, 5 μ L

Sal I 50U

Sterile water is to 200 μ L

Then it detects whether to cut completely through with 0.7% agarose gel electrophoresis, after cutting completely through, be purified with PCR product Kit handles digested liquid, recycles linearization plasmid, makes fixing fabric structure in 10 μ L or so.

2.2 prepare Pichia pastoris SMD1168 competent cell

1) picking yeast SMD1168 single colonie is seeded in the test tube of the YPD fluid nutrient medium containing 5mL, 30 DEG C, 220rpm shaken cultivation is stayed overnight；

2) overnight culture of 50 μ L is taken to be seeded in the 500mL triangular flask containing the fresh YPD fluid nutrient medium of 50mL, 30 DEG C, 220rpm shaken cultivation stay overnight, until OD600 value reaches 1.1~1.3；

3) by culture in 4 DEG C, 1500 × g is centrifuged 5min, and thallus is resuspended with the aseptic double-distilled water that 50mL ice is pre-chilled；

4) it is centrifuged by step 3), thallus is resuspended with the aseptic double-distilled water that 25mL ice is pre-chilled；

5) it is centrifuged by step 3), thallus is resuspended in the sorbitol solution for the 1M being pre-chilled with 20mL ice；

6) it is centrifuged by step 3), thallus is resuspended in the sorbitol solution for the 1M being pre-chilled with 0.3mL ice, and final volume is about 0.5mL；

7) it is a to be distributed into every 80 μ L, is saved backup in -70 DEG C.

The electrotransformation of 2.3 Pichia pastoris

1) the electric revolving cup of a 0.2cm is placed in ice and 10min is pre-chilled；

2) pPIC9K-His- of the linearisation of about 10 μ L will be added in freshly prepared Pichia pastoris competent cell 3A1-Strep plasmid, mixes gently, and goes in the electric revolving cup of 0.2cm ice pre-cooling, continues at and 5min is pre-chilled on ice；

3) it shocks by electricity, voltage 1.5kV；25 μ F of capacitor；200 Ω of resistance；The electric shock time is 5~10mSec；

4) electric shock terminates, and is rapidly added the sorbitol solution of the 1M of lmL ice pre-cooling, gently piping and druming mixes, and goes to 1.5mL In centrifuge tube, 30 DEG C of incubation 1h；

5) bacteria suspension being coated on MD plate, the every 100 μ μ of L~200 L is coated with one flat plate, it is stored at room temperature 10min, in 30 DEG C of inversions are cultivated 2-5 days, until there is single colonie appearance.

The screening of 2.4 multicopies insertion recon

1) 2mL aseptic double-distilled water is added in the MD planar surface that growth has transformant, it is then light with sterile triangle spreader The His+ transformant of planar surface gently is scraped, and is transferred in 50mL centrifuge tube；

2) dilution of 20mL aseptic double-distilled water is added, its OD600 value (10D600=5 × 10 is measured after mixing⁷cells/mL)；

3) 10 are taken⁸A cell is coated on the YPD plate containing 0.5mg/mLG418, is inverted, 30 DEG C of 3~4d of culture；

4) 200 μ L YPD fluid nutrient mediums are added in every hole in sterile 96 orifice plate；

5) it is respectively connected on the YPD plate containing 0.5mg/mL G418 with sterile toothpick into 96 orifice plates of step 4) The transformant of acquisition mixes, in 30 DEG C of culture 48h；

6) after 48h, one piece of new sterile 96 orifice plate is taken, 190 μ L YPD fluid nutrient mediums are added in every hole.In corresponding aperture 10 μ L, first piece of 96 resulting culture of orifice plate is added, for 24 hours in 30 DEG C of cultures；

7) after for 24 hours, then one piece of new sterile 96 orifice plate is taken, 190 μ L YPD fluid nutrient mediums are added in every hole.In corresponding aperture Middle addition 10 μ L, second piece of 96 resulting culture of orifice plate, for 24 hours in 30 DEG C of cultures；

8) after for 24 hours, 1 μ L is taken out from 96 orifice plate of third block and is put respectively containing 1.0mg/mL and 4mg/mL G418's On YPD plate, continue to cultivate 96h~120h in 30 DEG C.If Pichia pastoris transformant can give birth on the plate of the G418 containing high concentration It is long, illustrate the target gene that the transformant contains multicopy, that is, there are multiple pPIC9K-His-3A1-Strep segments to enter ferment It is integrated on the chromosome of yeast in parent and by homologous recombination.By the recombination ferment for the high copy that this step is screened Mother will be more likely to realize the high efficient expression of destination protein.

The PCR of 2.5 recons is identified

Select recon single colonie inoculation YPD fluid nutrient medium, 30 DEG C, 220rpm be incubated overnight, take 1ml bacterium solution extract base Because of group, pastoris genomic dna extracts kit is purchased from Beijing Suo Laibao Science and Technology Ltd, and concrete operation step refers to reagent Box specification.

Using genomic DNA as template, 5 ' AOX1,3 ' AOX1 universal primers are that amplimer carries out PCR, and enzyme used is Ex Taq is purchased from Dalian TaKaRa company.Wherein, PCR condition is 98 DEG C of initial denaturations, 2min, a thermal cycle；98 DEG C of thermal changes 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 4min of property, 25 thermal cycles；72 DEG C of extension 2min.Amplified production is there are two band, and one 2.2kb is the AOX1 gene of SMD1168 genome itself, and another 3968bp is purpose gene.

The inducing expression of 2.6 recombination yeasts

1) respectively picking individual colonies, be placed in the 100mL triangular flask equipped with 10mL BMGY culture medium, in 28-30 DEG C, It is 2-6 (16-18h) that 220rpm, which is cultivated to OD600,

2) 1500~3000g is centrifuged 5min at room temperature, collects thallus, and thallus is resuspended with BMMY culture medium, makes OD600 1 Left and right.

3) the resulting bacterium solution of step 2) is placed in the shaking flask of 250mL, is sealed, is placed in double gauze or garrha 28-30 DEG C, continued growth 3 days on the shaking table of 220rpm.

4) every to add 100% methanol into culture medium for 24 hours to final concentration of 1.0%.

5) it temporally puts and takes bacteria liquid sample respectively, sampling amount 1ml is placed in 1.5mL EP pipe, and maximum (top) speed is centrifuged 2- 3min collects supernatant.Analyze the expression quantity and the best harvest time of bacterium solution of destination protein.Time point generally takes: 12h, for 24 hours, 36h, 48h, 60h and 72h.

6) sample to be tested is saved backup in -80 DEG C.

The identification of 2.7 recombination human source type III collagens

1) supernatant collected in step 2.6 is subjected to SDS-PAGE detection, as a result as shown in Figure 2.

2) destination protein N-terminal has 6His label, and C-terminal has Srtep-tag II label, respectively to be purchased from Nanjing Jin Siruisheng The anti-Srtep-tag II antibody (A01736) of object Science and Technology Ltd., the anti-His of Santa Cruz Bioisystech Co., Ltd are anti- Body (sc-8036) is detected, and as a result (3a is that the WB of anti-Srtep-tagII antibody schemes, and 3b is anti-His antibody as shown in Figure 3 WB figure) band of 120kDa or so can identify that provable its is with the bis- labels of 6His, Srtep-tagII by two kinds of antibody Complete recombiant protein.

3) band on step 1) SDS-PAGE at 116KDa is cut off, through Nano-LC-ESI-MS/MS Identification of Fusion Protein, The band is 1 chain of source of people type III collagen α, as a result as shown in figures 4 a and 4b.Fig. 4 a is characterized source of people in peptide fragment and database The sequence comparison of 1 chain of type III collagen α, the result shows that the band at 116KDa contains there are two types of major protein in Fig. 4 b, And have in 110 peptide fragments detecting in record 1 38 for 1 chain feature peptide fragment of source of people type III collagen α, people's III type in the band 1 chain relative abundance of collagen α is 94.8%, is confirmed as 1 chain of source of people type III collagen α.

Wherein, it verifies correct recombinant yeast pichia pastoris engineering bacteria and has been preserved in China Committee for Culture Collection of Microorganisms Common micro-organisms center, deposit number CGMCC NO.17148, preservation date: on January 10th, 2019, address: court, Beijing The institute 3 of positive area's North Star West Road 1, classification naming: pichia pastoris yeast Pichia pastoris.

3, genetic recombination source of people type III collagen is prepared

1) after fermentation by step 2.6 method, 3000g is centrifuged 20min at 4 DEG C, collects supernatant.

2) purified water of 10 times of volume is added in supernatant, then arrives the 20% of original volume after dialysis is concentrated by ultrafiltration.

3) it takes and 100 μ L1 × Ni-NTA combination buffers is added in 1mL concentrate, 4 DEG C are sufficiently mixed.

4) 20 μ L 50%Ni-NTA HisBands resin suspensions are added softly to mix, in conjunction with 30min.

5) 15000 × g is centrifuged 10 seconds precipitated resins, abandons supernatant.

6) resin being rinsed with 100 μ L 1 × Ni-NTA wash buffers, 15000 × g is centrifuged 10 seconds, supernatant is carefully sucked, It repeats primary.

7) destination protein is eluted with 200 μ L 1 × Ni-NTA elution buffers, 15000 × g is centrifuged 10 seconds, carefully by supernatant It is transferred in clean tubule, is repeated twice.

8) supernatant is collected, 4 DEG C of dialysed overnights of Strep combination buffer are used.

9) it takes above-mentioned dialyzate that 100 μ L Strep-Tactin resin suspensions are added softly to mix, in conjunction with 30min.

10) 15000 × g is centrifuged 10 seconds precipitated resins, abandons supernatant.

11) resin is rinsed with 200 μ L 1 × Strep-Tactin wash buffers, 15000 × g is centrifuged 10 seconds, careful to inhale Supernatant is removed, is repeated primary.

12) destination protein is eluted with 200 μ L 1 × Strep-Tactin elution buffers, 15000 × g is centrifuged 10 seconds, small Supernatant is transferred in clean tubule by the heart, is repeated twice.

13) by obtained eluent through desalination, concentration, recombination human source is made through vacuum freeze drying in obtained concentrate III collagen type.

14) it takes concentrate to pour into glass culture dish, is put into freeze overnight in -20 DEG C of refrigerators, be then transferred to and pre- be cooled to -45 DEG C freeze drier in, open vacuum pump, maintain 48h.

15) after being lyophilized, vent valve is carefully opened, until inside and outside air pressure balance.Beaker is taken out, white sponge is obtained Recombination human source type III collagen.

2 collagen external use skin care preparation example of embodiment

By following quality proportioning, dissolve each raw material with water, and stir the transparent guarantor of a colorless and odorless Wet facial treatment essence liquid.

Recombination human source type III collagen 0.1% prepared by example 1, the embodiment of the present invention 1；Glycerol 1%；Butanediol 1%； Sodium Hyaluronate 0.1%；Carbomer 0.5%；Glycine betaine 1%；Silk peptide 0.05%；Beta glucan 0.2%；Jojoba ester 0.1%；Dipotassium glycyrrhizinate 0.3%；Triethanolamine 0.1%；Remaining is purified water.

Recombination human source type III collagen 0.01% prepared by example 2, the embodiment of the present invention 1；Glycerol 5%；Butanediol 5%； Sodium Hyaluronate 0.01%；Carbomer 0.1%；Glycine betaine 5%；Silk peptide 0.01%；Beta glucan 0.1%；Jojoba ester 0.01%；Dipotassium glycyrrhizinate 0.1%；Triethanolamine 1%；Remaining is purified water.

Recombination human source type III collagen 0.1% prepared by example 3, the embodiment of the present invention 1；Glycerol 3%；Butanediol 3%； Sodium Hyaluronate 0.05%；Carbomer 1%；Glycine betaine 3%；Silk peptide 0.1%；Beta glucan 1%；Jojoba ester 0.05%；It is sweet Oxalic acid dipotassium 0.5%；Triethanolamine 0.5%；Remaining is purified water.

Application method: after morning and evening face cleaning, being applied directly to face, gently pats to fully absorbing.

3 collagen gel dressing preparation example of embodiment

Example 1, the collagen gel using purified water as solvent, component further include recombination human source type III collagen, Gelling agent, moisturizer；The gelling agent is carbomer；The moisturizer is glycerol；The quality proportioning of each component are as follows: recombined human Source type III collagen 0.1%, glycerol 5%, carbomer 0.4%, triethanolamine 5%, remaining is purified water.

Preparation step is as follows:

1. weighing 50.0g glycerol, 4.0g carbomer is added, stirs 1h；

2. weighing recombination human source type III collagen 1.0g, dissolved with 100mL purified water；

3. by step, 2. resulting material is all transferred to step 1. in resulting material, and supplying purified water to gross mass is 990.0g stirring 1h；

4. the triethanolamine stirring 1h of 10.0g is added, after preparation solution irradiation sterilization obtained, sterile filling is to get collagen Protein gel casting product.

Example 2, the collagen gel using purified water as solvent, component further include recombination human source type III collagen, Gelling agent, moisturizer；The gelling agent is carbomer；The moisturizer is glycerol；The quality proportioning of each component are as follows: recombined human Source type III collagen 0.5%, glycerol 1%, carbomer 0.1%, triethanolamine 0.1%, remaining is purified water.

Preparation step is as follows:

1. weighing 10.0g glycerol, 1.0g carbomer is added, stirs 1h；

2. weighing recombination human source type III collagen 5.0g, dissolved with 100mL purified water；

4. the triethanolamine stirring 1h of 0.2g is added, after preparation solution irradiation sterilization obtained, sterile filling is to get collagen egg White gel casting product.

Example 3, the collagen gel using purified water as solvent, component further include recombination human source type III collagen, Gelling agent, moisturizer；The gelling agent is carbomer；The moisturizer is glycerol；The quality proportioning of each component are as follows: recombined human Source type III collagen 0.1%, glycerol 10%, carbomer 1%, triethanolamine 10%, remaining is purified water.

Preparation step is as follows:

1. weighing 100.0g glycerol, 10.0g carbomer is added, stirs 1h；

4. the triethanolamine stirring 1h of 20.0g is added, after preparation solution irradiation sterilization obtained, sterile filling is to get collagen Protein gel casting product.

4 Collagen dressing preparation example of embodiment

Recombination human source type III collagen prepares the Application Example of Collagen dressing product:

The Collagen dressing is by recombination human source type III collagen, moisturizer, medical thickener and nonwoven fabric base Material composition；The moisturizer is glycerol；The thickener is xanthan gum.

Example 1, the quality proportioning of each component are as follows: recombination human source type III collagen 0.5%；Glycerol 1%；Xanthan gum 1%； Remaining is purified water.

Preparation step is as follows:

1. accurately weighing each component, it is dissolved in purified water, is sufficiently stirred, mixes；

2. being filled in the medical aluminium foil bag containing non-woven fabrics base material by 25mL, irradiation sterilization processing is sealed to get collagen egg White sticking dressing product.

Example 2, the quality proportioning of each component are as follows: recombination human source type III collagen 0.1%；Glycerol 10%；Xanthan gum 2%； Remaining is purified water.

Preparation step is as follows:

Example 3, the quality proportioning of each component are as follows: recombination human source type III collagen 0.1%；Glycerol 5%；Xanthan gum 1%； Remaining is purified water.

Preparation step is as follows:

5 collagen-base skin and mucosa protective agent dressing preparation example of embodiment

Example 1, skin and mucosa protective agent are made of the raw material of following quality proportioning: recombination human source type III collagen 1%, Sodium Hyaluronate 0.5%, glycerol 10%, remaining is purified water；After obtained preparation solution sterilizing, sterile filling.

Preparation step is as follows:

1. weighing 100.0g glycerol, it is dissolved in 200mL purified water, recombination human source type III collagen 10g and transparent is added Matter acid sodium 5g, is sufficiently stirred dissolution；

2. purified water is added to 1000g, 1h is stirred；

3. after irradiation sterilization, sterile filling is to get collagen-base skin and mucosa protective agent dressing, after being applied to micro-shaping Skin and mucosa protection etc..

Example 2, skin and mucosa protective agent are made of the raw material of following quality proportioning: recombination human source type III collagen 0.1%, Sodium Hyaluronate 1%, glycerol 40%, remaining is purified water；After obtained preparation solution sterilizing, sterile filling.

Preparation step is as follows:

1. weighing 400.0g glycerol, it is dissolved in 200mL purified water, recombination human source type III collagen 1g and transparent is added Matter acid sodium 10g, is sufficiently stirred dissolution；

2. purified water is added to 1000g, 1h is stirred；

Example 3, skin and mucosa protective agent are made of the raw material of following quality proportioning: recombination human source type III collagen 1%, Sodium Hyaluronate 0.1%, remaining is purified water；After obtained preparation solution sterilizing, sterile filling.

Preparation step is as follows:

1. weighing 200mL purified water, recombination human source type III collagen 10g and Sodium Hyaluronate 1g is added, is sufficiently stirred Dissolution；

2. purified water is added to 1000g, 1h is stirred；

Dressing provided in this embodiment has good moisture-keeping function, can promote fibroblastic movement and hyperplasia, presses down Its differentiation is made, scar hyperplasia caused by collagen over-deposit is inhibited.Have to the skin and mucosas surface of a wound such as burn, scald, scratch and covers Lid, promoting healing, lubrication, moisturizing, the effect for inhibiting scar.

6 collagen of embodiment importing property beauty product preparation example

Application Example of the recombination human source type III collagen in high-grade minimally invasive beauty product:

For the importing product water laser accunputure of minimally invasive beauty, solution passes through nothing by dissolving each raw material as solvent using purified water Bacterium method is prepared, and the steps include:

Example 1,1. according to following quality proportioning, accurately weigh each component, and mixing, constant volume is sufficiently stirred；Wherein recombined human Source type III collagen 0.5%, glycerol 3%, Sodium Hyaluronate 0.3%, micromolecule hyaluronic acid sodium 0.03%, sodium chloride 0.9%, Argireline 0.01 ‰.

2. with 0.22um filtering with microporous membrane degerming；

3. under aseptic condition, being dispensed into disposable sterilized injector, every filling 3ml, and carry out aseptic packaging.

4. being used in use, directly taking out cooperation and importing instrument.

Example 2,1. according to following quality proportioning, accurately weigh each component, and mixing, constant volume is sufficiently stirred；Wherein recombined human Source type III collagen 0.1%, glycerol 1%, Sodium Hyaluronate 0.5%, micromolecule hyaluronic acid sodium 0.05%, sodium chloride 0.8%, Argireline 0.005 ‰.

2. with 0.22um filtering with microporous membrane degerming；

4. being used in use, directly taking out cooperation and importing instrument.

Example 3,1. according to following quality proportioning, accurately weigh each component, and mixing, constant volume is sufficiently stirred；Wherein recombined human Source type III collagen 0.3%, glycerol 10%, Sodium Hyaluronate 0.1%, micromolecule hyaluronic acid sodium 0.01%, sodium chloride 1%, Argireline 0.02 ‰.

2. with 0.22um filtering with microporous membrane degerming；

4. being used in use, directly taking out cooperation and importing instrument.

In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show The description of example " or " some examples " etc. means specific features, structure, material or spy described in conjunction with this embodiment or example Point is included at least one embodiment or example of the invention.In the present specification, schematic expression of the above terms are not Centainly refer to identical embodiment or example.Moreover, particular features, structures, materials, or characteristics described can be any One or more embodiment or examples in can be combined in any suitable manner.

Although an embodiment of the present invention has been shown and described, it will be understood by those skilled in the art that: not A variety of change, modification, replacement and modification can be carried out to these embodiments in the case where being detached from the principle of the present invention and objective, The scope of the present invention is defined by the claims and their equivalents.

<110>Jiangsu Yue Zhi biological medicine Co., Ltd

<120>III collagen type α of recombination human source, 1 chain and its application

<130> 1

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1082

<212> PRT

<213>mankind (Homo sapiens)

<400> 1

His His His His His His Gln Tyr Asp Ser Tyr Asp Val Lys Ser Gly

1 5 10 15

Val Ala Val Gly Gly Leu Ala Gly Tyr Pro Gly Pro Ala Gly Pro Pro

20 25 30

Gly Pro Pro Gly Pro Pro Gly Thr Ser Gly His Pro Gly Ser Pro Gly

35 40 45

Ser Pro Gly Tyr Gln Gly Pro Pro Gly Glu Pro Gly Gln Ala Gly Pro

50 55 60

Ser Gly Pro Pro Gly Pro Pro Gly Ala Ile Gly Pro Ser Gly Pro Ala

65 70 75 80

Gly Lys Asp Gly Glu Ser Gly Arg Pro Gly Arg Pro Gly Glu Arg Gly

85 90 95

Leu Pro Gly Pro Pro Gly Ile Lys Gly Pro Ala Gly Ile Pro Gly Phe

100 105 110

Pro Gly Met Lys Gly His Arg Gly Phe Asp Gly Arg Asn Gly Glu Lys

115 120 125

Gly Glu Thr Gly Ala Pro Gly Leu Lys Gly Glu Asn Gly Leu Pro Gly

130 135 140

Glu Asn Gly Ala Pro Gly Pro Met Gly Pro Arg Gly Ala Pro Gly Glu

145 150 155 160

Arg Gly Arg Pro Gly Leu Pro Gly Ala Ala Gly Ala Arg Gly Asn Asp

165 170 175

Gly Ala Arg Gly Ser Asp Gly Gln Pro Gly Pro Pro Gly Pro Pro Gly

180 185 190

Thr Ala Gly Phe Pro Gly Ser Pro Gly Ala Lys Gly Glu Val Gly Pro

195 200 205

Ala Gly Ser Pro Gly Ser Asn Gly Ala Pro Gly Gln Arg Gly Glu Pro

210 215 220

Gly Pro Gln Gly His Ala Gly Ala Gln Gly Pro Pro Gly Pro Pro Gly

225 230 235 240

Ile Asn Gly Ser Pro Gly Gly Lys Gly Glu Met Gly Pro Ala Gly Ile

245 250 255

Pro Gly Ala Pro Gly Leu Met Gly Ala Arg Gly Pro Pro Gly Pro Ala

260 265 270

Gly Ala Asn Gly Ala Pro Gly Leu Arg Gly Gly Ala Gly Glu Pro Gly

275 280 285

Lys Asn Gly Ala Lys Gly Glu Pro Gly Pro Arg Gly Glu Arg Gly Glu

290 295 300

Ala Gly Ile Pro Gly Val Pro Gly Ala Lys Gly Glu Asp Gly Lys Asp

305 310 315 320

Gly Ser Pro Gly Glu Pro Gly Ala Asn Gly Leu Pro Gly Ala Ala Gly

325 330 335

Glu Arg Gly Ala Pro Gly Phe Arg Gly Pro Ala Gly Pro Asn Gly Ile

340 345 350

Pro Gly Glu Lys Gly Pro Ala Gly Glu Arg Gly Ala Pro Gly Pro Ala

355 360 365

Gly Pro Arg Gly Ala Ala Gly Glu Pro Gly Arg Asp Gly Val Pro Gly

370 375 380

Gly Pro Gly Met Arg Gly Met Pro Gly Ser Pro Gly Gly Pro Gly Ser

385 390 395 400

Asp Gly Lys Pro Gly Pro Pro Gly Ser Gln Gly Glu Ser Gly Arg Pro

405 410 415

Gly Pro Pro Gly Pro Ser Gly Pro Arg Gly Gln Pro Gly Val Met Gly

420 425 430

Phe Pro Gly Pro Lys Gly Asn Asp Gly Ala Pro Gly Lys Asn Gly Glu

435 440 445

Arg Gly Gly Pro Gly Gly Pro Gly Pro Gln Gly Pro Pro Gly Lys Asn

450 455 460

Gly Glu Thr Gly Pro Gln Gly Pro Pro Gly Pro Thr Gly Pro Gly Gly

465 470 475 480

Asp Lys Gly Asp Thr Gly Pro Pro Gly Pro Gln Gly Leu Gln Gly Leu

485 490 495

Pro Gly Thr Gly Gly Pro Pro Gly Glu Asn Gly Lys Pro Gly Glu Pro

500 505 510

Gly Pro Lys Gly Asp Ala Gly Ala Pro Gly Ala Pro Gly Gly Lys Gly

515 520 525

Asp Ala Gly Ala Pro Gly Glu Arg Gly Pro Pro Gly Leu Ala Gly Ala

530 535 540

Pro Gly Leu Arg Gly Gly Ala Gly Pro Pro Gly Pro Glu Gly Gly Lys

545 550 555 560

Gly Ala Ala Gly Pro Pro Gly Pro Pro Gly Ala Ala Gly Thr Pro Gly

565 570 575

Leu Gln Gly Met Pro Gly Glu Arg Gly Gly Leu Gly Ser Pro Gly Pro

580 585 590

Lys Gly Asp Lys Gly Glu Pro Gly Gly Pro Gly Ala Asp Gly Val Pro

595 600 605

Gly Lys Asp Gly Pro Arg Gly Pro Thr Gly Pro Ile Gly Pro Pro Gly

610 615 620

Pro Ala Gly Gln Pro Gly Asp Lys Gly Glu Gly Gly Ala Pro Gly Leu

625 630 635 640

Pro Gly Ile Ala Gly Pro Arg Gly Ser Pro Gly Glu Arg Gly Glu Thr

645 650 655

Gly Pro Pro Gly Pro Ala Gly Phe Pro Gly Ala Pro Gly Gln Asn Gly

660 665 670

Glu Pro Gly Gly Lys Gly Glu Arg Gly Ala Pro Gly Glu Lys Gly Glu

675 680 685

Gly Gly Pro Pro Gly Val Ala Gly Pro Pro Gly Gly Ser Gly Pro Ala

690 695 700

Gly Pro Pro Gly Pro Gln Gly Val Lys Gly Glu Arg Gly Ser Pro Gly

705 710 715 720

Gly Pro Gly Ala Ala Gly Phe Pro Gly Ala Arg Gly Leu Pro Gly Pro

725 730 735

Pro Gly Ser Asn Gly Asn Pro Gly Pro Pro Gly Pro Ser Gly Ser Pro

740 745 750

Gly Lys Asp Gly Pro Pro Gly Pro Ala Gly Asn Thr Gly Ala Pro Gly

755 760 765

Ser Pro Gly Val Ser Gly Pro Lys Gly Asp Ala Gly Gln Pro Gly Glu

770 775 780

Lys Gly Ser Pro Gly Ala Gln Gly Pro Pro Gly Ala Pro Gly Pro Leu

785 790 795 800

Gly Ile Ala Gly Ile Thr Gly Ala Arg Gly Leu Ala Gly Pro Pro Gly

805 810 815

Met Pro Gly Pro Arg Gly Ser Pro Gly Pro Gln Gly Val Lys Gly Glu

820 825 830

Ser Gly Lys Pro Gly Ala Asn Gly Leu Ser Gly Glu Arg Gly Pro Pro

835 840 845

Gly Pro Gln Gly Leu Pro Gly Leu Ala Gly Thr Ala Gly Glu Pro Gly

850 855 860

Arg Asp Gly Asn Pro Gly Ser Asp Gly Leu Pro Gly Arg Asp Gly Ser

865 870 875 880

Pro Gly Gly Lys Gly Asp Arg Gly Glu Asn Gly Ser Pro Gly Ala Pro

885 890 895

Gly Ala Pro Gly His Pro Gly Pro Pro Gly Pro Val Gly Pro Ala Gly

900 905 910

Lys Ser Gly Asp Arg Gly Glu Ser Gly Pro Ala Gly Pro Ala Gly Ala

915 920 925

Pro Gly Pro Ala Gly Ser Arg Gly Ala Pro Gly Pro Gln Gly Pro Arg

930 935 940

Gly Asp Lys Gly Glu Thr Gly Glu Arg Gly Ala Ala Gly Ile Lys Gly

945 950 955 960

His Arg Gly Phe Pro Gly Asn Pro Gly Ala Pro Gly Ser Pro Gly Pro

965 970 975

Ala Gly Gln Gln Gly Ala Ile Gly Ser Pro Gly Pro Ala Gly Pro Arg

980 985 990

Gly Pro Val Gly Pro Ser Gly Pro Pro Gly Lys Asp Gly Thr Ser Gly

995 1000 1005

His Pro Gly Pro Ile Gly Pro Pro Gly Pro Arg Gly Asn Arg Gly

1010 1015 1020

Glu Arg Gly Ser Glu Gly Ser Pro Gly His Pro Gly Gln Pro Gly

1025 1030 1035

Pro Pro Gly Pro Pro Gly Ala Pro Gly Pro Cys Cys Gly Gly Val

1040 1045 1050

Gly Ala Ala Ala Ile Ala Gly Ile Gly Gly Glu Lys Ala Gly Gly

1055 1060 1065

Phe Ala Pro Tyr Tyr Gly Trp Ser His Pro Gln Phe Glu Lys

1070 1075 1080

<210> 2

<211> 3204

<212> DNA

<213>artificial sequence

<400> 2

caatacgact cttatgacgt gaagtcagga gtggcagtag gtggtcttgc aggttatccc 60

ggtccagcag gtcccccagg tcctccagga ccacctggaa ccagtggaca ccctggatca 120

ccaggaagtc caggatacca gggtcctcca ggagaacctg gtcaggcagg accttccggt 180

cctccaggac cccctggtgc aatcggacca tcaggtcctg caggaaagga cggagagagt 240

ggtagacccg gaagacccgg agaaagaggt ttgcctggac ccccaggtat aaaaggacct 300

gcaggtatac ctggattccc aggaatgaaa ggacacagag gatttgatgg tagaaacgga 360

gagaaaggag aaacaggagc cccaggatta aagggagaga acggtttacc aggtgaaaac 420

ggagcacctg gacctatggg acccagaggt gcaccaggag agagaggaag accaggactg 480

cccggtgctg ccggagcaag aggaaatgat ggagccagag gttctgatgg acagccaggt 540

cctcctggtc cacctggtac tgcaggattc cctggttccc caggtgcaaa gggagaagtt 600

ggaccagcag gtagtccagg ttccaatggt gcaccaggac aaagaggaga gcccggaccc 660

cagggacacg caggtgcaca gggtccccct ggtcccccag gtatcaatgg aagtcccgga 720

ggtaaaggtg agatgggtcc agcaggaatc ccaggagcac ccggattaat gggtgctaga 780

ggtccacccg gacctgcagg agcaaatggt gcacctggat tgagaggtgg agctggagag 840

cccggaaaga acggtgccaa aggtgaacct ggaccaagag gtgaaagagg agaggccggt 900

atcccaggag tgcctggtgc taaaggtgag gatggaaaag acggttcacc tggagaacca 960

ggagcaaacg gactgccagg agctgccgga gagagaggtg caccaggttt tagaggtcct 1020

gccggaccaa acggtatccc aggagagaaa ggaccagctg gagaaagagg agcccctgga 1080

ccagcaggtc caagaggagc tgcaggtgag ccaggtagag atggagtgcc aggaggtccc 1140

ggtatgagag gaatgccagg ttcacctgga ggaccaggat cagatggtaa acccggtcca 1200

cctggttcac agggagaatc tggaagaccc ggtccacctg gtcctagtgg accaagagga 1260

cagcccggtg ttatgggttt cccaggtcca aagggtaacg atggtgcacc tggtaaaaat 1320

ggagagagag gtggtcccgg aggacccgga ccccagggac ctcctggaaa gaatggtgaa 1380

acaggacctc aaggtcctcc aggtcctaca ggaccaggag gagataaggg agatactggt 1440

ccacctggac cacaaggatt acagggtttg cccggaactg gaggaccacc aggagagaac 1500

ggaaagccag gagagccagg tccaaagggt gacgctggag ccccaggagc cccaggagga 1560

aagggagacg caggtgcccc aggagagaga ggtcctcctg gattagccgg tgcccccgga 1620

ctgagaggag gtgctggacc acctggacct gagggaggaa agggtgccgc aggacctcca 1680

ggtccccctg gagctgctgg tacacctggt ctgcagggta tgcctggtga aagaggtgga 1740

ctgggttccc ccggacctaa gggagacaag ggagaacctg gaggtcccgg tgctgatgga 1800

gtgcctggta aagacggacc tagaggacca accggaccaa tcggaccacc tggtccagcc 1860

ggtcagccag gtgacaaggg agagggtgga gccccaggac tgccaggtat cgccggtcca 1920

agaggttctc ccggtgagag aggagagact ggtccaccag gacctgcagg tttcccagga 1980

gcacctggtc aaaacggaga accaggtgga aaaggtgaga gaggagcccc cggagaaaag 2040

ggagagggag gacctcccgg agtcgcagga cccccaggtg gttcaggtcc cgcaggtcct 2100

ccaggacccc agggagtgaa aggtgaaaga ggttccccag gaggtccagg tgctgccggt 2160

ttccctggtg caagaggatt acccggaccc cctggaagta acggtaaccc aggtccacca 2220

ggtccctctg gatctcccgg aaaggacgga ccacccggtc ccgcaggaaa taccggagca 2280

ccaggttccc caggtgtgtc aggtcctaag ggtgacgcag gacagcccgg agagaagggt 2340

tctcccggag cacagggtcc cccaggtgca cccggtcctc tgggaatagc cggaatcact 2400

ggtgctagag gactggccgg tccacctgga atgcccggtc ccagaggttc accaggtccc 2460

caaggtgtca agggagaatc aggaaagcct ggagcaaatg gtctgagtgg agaaagaggt 2520

ccacctggac cacaaggact gcccggactt gctggtacag caggagagcc cggaagagac 2580

ggaaatcctg gttcagatgg acttccaggt agagacggat ctcccggtgg aaaaggagac 2640

agaggagaga acggatctcc aggtgctcca ggtgcccctg gacaccccgg tcccccaggt 2700

ccagtgggac ccgccggtaa aagtggagac agaggtgaat caggaccagc aggacctgca 2760

ggtgctccag gacccgccgg atcaagagga gcgccaggtc cccagggtcc aagaggtgac 2820

aaaggagaga ctggagaaag aggagctgct ggtatcaaag gacatagagg atttccagga 2880

aatcctggag caccaggaag tccaggtcca gcaggtcagc aaggtgccat tggttctcca 2940

ggacccgccg gacctagagg accagtggga ccctcaggac cacctggaaa agacggtact 3000

tcaggacacc ccggtcctat tggtccaccc ggaccaagag gaaacagagg agaaagaggt 3060

tctgaaggaa gtcctggaca tcccggacag ccaggaccac caggtccccc aggtgctcca 3120

ggaccttgtt gtggtggtgt tggagccgct gcaatagccg gaattggagg tgaaaaggca 3180

ggtggattcg caccatatta tgga 3204

<210> 3

<211> 48

<212> DNA

<213>artificial sequence

<400> 3

cggaattcca tcatcatcat catcatcaat acgactctta tgacgtga 48

<210> 4

<211> 58

<212> DNA

<213>artificial sequence

<400> 4

cggaattctt acttctcgaa ttgtgggtga gaccatccat aatatggtgc gaatccac 58

Claims

1. a kind of 1 chain of recombination human source type III collagen α, which is characterized in that encode the recombination human source type III collagen egg The nucleotide sequence of white 1 chain of α as shown in SEQ ID NO:1,1 chain of recombination human source type III collagen α from aminoterminal according to It is secondary to include: aminoterminal affinity purification label, source of people type III collagen maturation peptide chain and c-terminus affinity purification label.

2. 1 chain of recombination human source type III collagen α according to claim 1, which is characterized in that the aminoterminal is affine Purification tag is 6His label, and the c-terminus affinity purification label is Strep label.

3. 1 chain of recombination human source type III collagen α according to claim 1, which is characterized in that the source of people type III Collagen maturation peptide chain includes human III type collagen N-terminal peptide, human III type collagen into helical region, human III type collagen C-terminal peptide, the people The nucleotide sequence of source type III collagen maturation peptide chain is as shown in SEQ ID NO:2.

4. 1 chain of recombination human source type III collagen α according to claim 3, which is characterized in that the source of people type III The nucleotide sequence of collagen maturation peptide chain is by natural collagen gene order by its codon according to the frequency of use of host's codon It is adjusted to obtain.

5. 1 chain of recombination human source type III collagen α according to claim 4, which is characterized in that the host is red to finish Yeast, it is described to be adjusted to the rare codon optimization in the natural collagen gene order in Pichia pastoris to be its preference password Son.

6. 1 chain of recombination human source type III collagen α according to claim 3, which is characterized in that the source of people type III The amplimer F (SEQ ID NO:3) and R (SEQ ID NO:4) of the nucleotide sequence of collagen maturation peptide chain are as follows:

7. 1 chain of recombination human source type III collagen α according to claim 6, which is characterized in that the amplimer N-terminal increase can express the nucleotide sequence of 6His, and C-terminal increase is expanded after capable of expressing the nucleotide sequence of Strep.

8. a kind of application of 1 chain of recombination human source type III collagen α, which is characterized in that the recombination human source type III collagen egg It is white to be applied to medical dressing, the mass fraction of the medical dressing each component are as follows:

Recombination human source type III collagen 0.1%~0.5% described in any one of -7 according to claim 1；

Moisturizer 1%~10%；

Carbomer 0.1%~1%；

Triethanolamine 0.1%~10%；

Remaining is purified water.

9. a kind of application of 1 chain of recombination human source type III collagen α, which is characterized in that the recombination human source type III collagen egg White to be applied to collagen dressing patch, the collagen dressing patch is by non-woven fabrics base material and is located on the non-woven fabrics base material Collagen dressing composition, the mass fraction of the collagen dressing each component are as follows:

Moisturizer 1%~10%；

Thickener 0.1%~2%；

Remaining is purified water.

10. a kind of application of 1 chain of recombination human source type III collagen α, which is characterized in that the recombination human source type III collagen Albumen is applied to the skin and mucosa protective agent of micro-shaping, the mass fraction of the skin and mucosa protecting group each component are as follows:

Recombination human source type III collagen 0.1%~1% described in any one of -7 according to claim 1；

Sodium Hyaluronate 0.1%~1%；

Moisturizer 0~40%；

Remaining is purified water.

11. a kind of application of 1 chain of recombination human source type III collagen α, which is characterized in that the recombination human source type III collagen Albumen is applied to external use skin care, the mass fraction of the external use skin care each component are as follows:

Recombination human source type III collagen 0.01%~0.1% described in any one of -7 according to claim 1；

Moisturizer 1%~5%；

Butanediol 1%~5%；

Sodium Hyaluronate 0.01%~0.1%；

Carbomer 0.1%~1%；

Glycine betaine 1%~5%；

Silk peptide 0.01%~0.1%；

Beta glucan 0.1%~1%；

Jojoba ester 0.01%~0.1%；

Dipotassium glycyrrhizinate 0.1%~0.5%；

Triethanolamine 0.1%~1%；

Remaining is purified water.

12. a kind of application of 1 chain of recombination human source type III collagen α, which is characterized in that the recombination human source type III collagen Albumen is applied to importing property skin care item, the mass fraction of the importing property skin care item each component are as follows:

Moisturizer 1%~10%；

Sodium Hyaluronate 0.1%~0.5%；

Micromolecule hyaluronic acid sodium 0.01%~0.05%；

Sodium chloride 0.8%~1%；

Argireline 0.0005%~0.002%；

Remaining is purified water.