CN102839165B - Gene mutation type recombined protease K and industrialized production method thereof - Google Patents
Gene mutation type recombined protease K and industrialized production method thereof Download PDFInfo
- Publication number
- CN102839165B CN102839165B CN201210363700.8A CN201210363700A CN102839165B CN 102839165 B CN102839165 B CN 102839165B CN 201210363700 A CN201210363700 A CN 201210363700A CN 102839165 B CN102839165 B CN 102839165B
- Authority
- CN
- China
- Prior art keywords
- recombinant protein
- mutation type
- protein enzyme
- type recombinant
- genic mutation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a gene mutation type recombined protease K and an industrialized production method thereof. Specifically, the invention relates to the gene mutation type recombined protease K which is obtained by performing gene reformation and protein engineering and has an enzymatic activity being more than two times of the enzymatic activity of the same natural protein, and further relates to the industrialized production method and a technical process for utilizing yeast cells to large-scale culture expressing foreign proteins and prepare the gene mutation type recombined protease K.
Description
Technical field
The present invention relates to a kind of genic mutation type recombinant protein enzyme K and industrialized preparing process thereof.More specifically, the present invention relates to a kind of enzymic activity obtaining through genetic modification and protein engineering is 2 times of above genic mutation type recombinant protein enzyme K of wild-type protease activity of the same race; And utilize yeast cell large scale culturing to express foreign protein, prepare industrialized preparing process and the technological process of described genic mutation type recombinant protein enzyme K.
Background technology
Proteinase K is a kind of serine protease, finds first (Ebeling W etc., Eur J Biochem.1974 Aug 15 in 1974 in the extract of woods Bai Shi Candida albicans (Tritirachium album limber); 47 (1): 91-7).Because this endonuclease capable digests the natural keratin that is rich in disulfide linkage, woods Bai Shi Candida albicans can be usingd Keratin sulfate as the growth of unique carbon source/nitrogenous source, and Proteinase K is also gained the name thus.
The feature of Proteinase K maximum is natural protein to have the cutting power of broad-spectrum high efficacy, is active the highest a kind of in existing proteolytic enzyme.This enzyme prefers to the carboxy-terminal peptide bond of cutting aliphatic amino acid and die aromatischen Aminosaeuren, particularly L-Ala.
In addition, Proteinase K or the very outstanding enzyme of a kind of stability, under the condition of 12,20 ℃ ~ 60 ℃ of pH 4 ~ pH, all there is activity, in the multiple chemical reagent (as SDS, urea, sequestrant (as EDTA) and sulfhydryl reagent (as trypsin inhibitor or chymotrypsin inhibitor)) that can make protein denaturation, also there is the ability of scinderin matter.
Owing to conventionally using SDS solution in lysis process, and Proteinase K is at 0.5%(w/v) SDS solution in still can remain completely active, it be can be applicable in nucleic acid extraction, nuclease in the born of the same parents that discharge by fast degradation lysis, separation obtains complete nucleic acid fragment.Formerly study and also show, Proteinase K also has outstanding stability in stain remover (as Triton X-100), thereby is also widely used in the research of membranin and transmembrane protein.
In recent years, the application of Proteinase K is not merely confined to medical diagnosis and scientific research field, also can substitute traditional chemical process that may have pollution and process starting material in the fields such as industrial process hides, papermaking, feed.Therefore the Proteinase K that, obtains high reactivity, low cost has practical significance.
Yet neutral protease K relies on traditional zymotic to extract, output is very low, and cost is higher, is not suitable for the extensive utilization of this product from now on.Therefore, the research focus of this area concentrates on and utilizes genetic engineering technique and protein engineering at present, the molecular structure of engineered protein, and expectation obtains the Proteinase K that activity is higher, cost is lower.
Up to now, the gene recombinant protein enzyme K of existing suitability for industrialized production be take prokaryotic cell prokaryocyte as host, such as escherichia expression system, and its advantage is easy, economical.Yet Proteinase K activity that this system expression obtains is not high or there is no activity, does not reach the level of neutral protease K, this may be that prokaryotic system cannot be realized this function because last handling process need to be transcribed or translate to Proteinase K.In addition, utilize prokaryotic cell prokaryocyte to carry out the output of exogenous protein expression too low, thereby be difficult to meet the need of market.
In addition, obtain commercial Proteinase K product if want, downstream purification and freeze drying technology are extremely important, the data that can not use for reference in this respect at present.For example, the purification process that utilization has been reported all can not obtain in enormous quantities, the Proteinase K of high yield.Through the inventor's test, these purification process practical value in large-scale production is not high.
For addressing the above problem, the inventor conducts in-depth research, and combines transgenation and eukaryotic cell-yeast external secretion expression technology, from engineered protein enzyme K molecular structure, starts with, and obtains the active genic mutation type recombinant protein enzyme K improving; Optimization expression system, utilizes yeast cell external secretion expression technology, and the efficient expressing gene saltant type of large scale fermentation recombinant protein enzyme K further improves activity and the output of Proteinase K; Adopt novel protein purifying mode, improve the yield in Proteinase K purge process, thereby realized mass-producing and serialization production, completed the present invention.In patent document and non-patent document, all do not find at present the report about genic mutation type recombinant protein enzyme K suitability for industrialized production in yeast.
Summary of the invention
Wild-type protease K precursor forms (SEQ ID NO.1 by 384 amino acid, UniProtKB/Swiss-Prot:P06873.2), the maturation protein enzyme K that comprises the signal peptide of 15 amino acid lengths, the propetide of 90 amino acid lengths and 279 amino acid lengths.
Through external scientist's research, than wild-type protease K, genic mutation type recombinant protein enzyme K can have higher activity.The inventor is from aminoacid sequence (the SEQ ID NO.2 of wild-type protease K, by 369 amino acid, formed, comprise the propetide of 90 amino acid lengths and the maturation protein enzyme K of 279 amino acid lengths) in selected eight critical sites, synthetic gene is also expressed successfully at eukaryotic system, has obtained the genic mutation type recombinant protein enzyme K that enzyme is lived and greatly improved.
Therefore, a first aspect of the present invention is to provide a kind of genic mutation type recombinant protein enzyme K, it is characterized in that:
(1) Y of the 151st in wild-type protease K aminoacid sequence (SEQ ID NO.2) being sported to A, the K of the 208th sports H, the S of the 273rd and sports T, the G of the 293rd and sport A, the K of the 332nd and sport R, the S of the 337th and sport N; Optionally, also carry out following any a kind of above sudden change:
(2) S of the 123rd is sported to A;
(3) L of the 180th is sported to I.
The present invention is to provide the DNA of coding said gene saltant type recombinant protein enzyme K on the other hand.
The present invention is to provide the expression vector that comprises above-mentioned DNA on the other hand.
Another aspect of the invention is to provide the transformant that imports above-mentioned expression vector.
Further aspect of the present invention is to provide the test kit that contains said gene saltant type recombinant protein enzyme K, DNA, expression vector and/or transformant.
The present invention is to provide the method for utilizing eukaryotic cell to prepare said gene saltant type recombinant protein enzyme K on the other hand, and the method comprises following steps: in substratum, cultivate the transformant that contains genic mutation type recombinant protein enzyme K of the present invention; And collect the described genic mutation type recombinant protein enzyme K in described substratum, and it is characterized in that, described transformant is yeast cell.
In addition, the inventor, by selecting the decolouring of different resins material, different layers chromatography medium purification, different protective material and freeze-dry process lyophilize, has obtained commercial genic mutation type recombinant protein enzyme K product.
Therefore, the present invention provides after fermentation production of protein enzyme K on the other hand, adopts novel purifying mode to process and improves yield and the cryodesiccated technology of batch.
Accompanying drawing explanation
From the following detailed description of being combined with accompanying drawing, will more clearly understand above and other objects of the present invention, feature and other advantage, wherein:
Fig. 1 represents to show the synoptic diagram in mutational site in genic mutation type recombinant protein enzyme K mutProK6 of the present invention, mutProK7-1, mutProK7-2 and mutProK8 aminoacid sequence.
Fig. 2 represents the carrier collection of illustrative plates of Yeast expression carrier pPIC9K.
Fig. 3 represents to utilize SDS-PAGE to detect the result (laboratory scale of the expression of genic mutation type recombinant protein enzyme K mutProK8 of the present invention in GS115 yeast cell; Shake flask fermentation).
Fig. 4 represents to utilize Western trace to detect the result (laboratory scale of the expression of genic mutation type recombinant protein enzyme K mutProK8 of the present invention in GS115 yeast cell; Shake flask fermentation and 30L ferment tank).
Fig. 5 represents the result (laboratory scale of the native polyacrylamide gel electrophoresis of genic mutation type Proteinase K mutProK8 and wild-type protease K; Shake flask fermentation).
Fig. 6 represents the qualitative experiment result of genic mutation type Proteinase K mutProK8 digestion bovine serum albumin (BSA).
Resulting tyrosine typical curve when Fig. 7 represents to utilize F-C analytical method to carry out qualitative detection to the enzymic activity of genic mutation type recombinant protein enzyme K of the present invention.
Fig. 8 represents to utilize SDS-PAGE to detect the result of 2 tons of fermentor cultivation pichia spp different time yield of enzyme.
The result that the purity of genic mutation type recombinant protein enzyme K after Fig. 9 represents to utilize electrophoresis to purified freeze-drying detects: Fig. 9 A: denaturing polyacrylamide gel electrophoresis; Fig. 9 B: native polyacrylamide gel electrophoresis.
Figure 10 represents the stability result of genic mutation type recombinant protein enzyme K of the present invention.
Embodiment
Below will elaborate the present invention.
One. genic mutation type recombinant protein enzyme K of the present invention and determination of activity
Genic mutation type recombinant protein enzyme K of the present invention, is characterized in that:
(1) Y of the 151st in wild-type protease K aminoacid sequence (SEQ ID NO.2) being sported to A, the K of the 208th sports H, the S of the 273rd and sports T, the G of the 293rd and sport A, the K of the 332nd and sport R, the S of the 337th and sport N; Optionally also carry out following any a kind of above sudden change:
(2) S of the 123rd is sported to A;
(3) L of the 180th is sported to I.
In the present invention, " 123 ", " 151 ", " 180 ", " 208 ", " 273 ", " 293 ", " 332 " and " 337 " are not the absolute location that must represent from the N end of described Proteinase K, and mean the relative position of comparing with the aminoacid sequence of SEQ ID NO.2.For example, in the proteolytic enzyme of the aminoacid sequence that contains SEQ ID NO.2, when the N of 123, this proteolytic enzyme amino acid of having held a certain topagnosis, above-mentioned 123 become 122.Even if in this case, the described amino acid that is counted as 122 from N end residue is still the amino acid of " 123 " in the present invention.By the aminoacid sequence of the aminoacid sequence of interested proteolytic enzyme and SEQ ID NO.2 is compared and is determined described amino acid whose relative position.
Compare with the enzymic activity of corresponding wild-type protease (SEQ IDNO.2), the enzymic activity of genic mutation type recombinant protein enzyme K of the present invention is higher.
According to the present invention one preferred embodiment, can measure by following method the activity of recombinant protein enzyme of the present invention.
Casein food grade is dissolved in potassium phosphate solution and regulates pH value to prepare substrate solution.Sample is added in above-mentioned substrate solution.This mixture is reacted at 37 ℃, then add reaction terminating liquid termination reaction.By the centrifugal supernatant that obtains, add anhydrous sodium carbonate, then add phenol reagent (Folin-Ciocalteu reagent).After reaction, under 660nm, measure absorbancy.Absorbance with sample is deducted to the content that value that blank absorbance obtains is converted into free tyrosine, to calculate protein-active value.The unit of protein-active is U/mL(units per ml).This 1 unit refers in aforesaid method, makes to be equivalent to the amount of the enzyme that the phenol reagent colour developing thing of 1 μ mol tyrosine increases at 1 minute in (min).By making the working curve of tyrosine, obtain the tie-in equation of tyrosine and phenol reagent colour developing thing.
Two. the DNA of the genic mutation type recombinant protein enzyme K of the present invention that encodes
DNA of the present invention is the DNA of coding genic mutation type recombinant protein enzyme K of the present invention.According to the present invention, one preferred embodiment, DNA of the present invention can obtain in the following manner: for example, such as adopting the methods such as PCR (to obtain wild-type protease K gene, nucleotide sequence as shown in SEQ ID NO.3), by fixed-point mutation method etc., object sudden change is imported to the DNA of each genic mutation type recombinant protein enzyme of preparation coding K.
For fixed-point mutation method, be not particularly limited, for example, can use commercially available QuikChange Site-Directed Mutagenesis Kit(Stratagene company to manufacture) etc. carry out.As the method for introducing rite-directed mutagenesis, for example, Gapped duplex method and Kunkel method are all known.
According to the present invention, another preferred embodiment, also can obtain DNA of the present invention by chemosynthesis.According to a particularly preferred embodiment of the present, for improving the expression efficiency of recombinant protein in host cell, the encoding sequence of wild-type protease K (SEQ ID NO.3) can be replaced with to the DNA sequence dna that host cell preference codon forms, introduce after object sudden change, then prepare DNA of the present invention by the mode of chemosynthesis.A most preferred embodiment according to the present invention, described host cell preference codon is yeast biased codons.
Preferably, as the DNA of coding genic mutation type recombinant protein enzyme K of the present invention, for example, for thering is the DNA of the nucleotide sequence of the represented 7-1113 position of SEQ ID NO.6-9.But, as long as coding genic mutation type recombinant protein enzyme K of the present invention is not limited to these.
In addition, the encode polynucleotide of genic mutation type recombinant protein enzyme K of the present invention can be also the polynucleotide of the following genic mutation type recombinant protein enzyme K of coding: the genic mutation type recombinant protein enzyme K of hybridizing under stringent condition and encoding and have above-mentioned specific sudden change and have above-mentioned desirable activity with the complementary sequence of the nucleotide sequence of the represented 7-1113 position of SEQ ID NO.6-9.
Stringent condition refers to the condition that forms so-called specific hybrid and do not form non-specific hybridization.Although this condition is because of nucleotide sequence or its length difference, the example comprises (for example having high homology, have and be not less than 75%, be preferably not less than 90%, be further preferably not less than 95% homology) the mutual cross of DNA phase, and the condition that homology is not hybridized lower than the DNA of above-mentioned standard; Or in Southern hybridization for the hybridization conditions of the typical conditions of rinsing (60 ℃ and 1 * SSC, 0.1%SDS, preferably 0.1 * SSC and be equivalent to the salt concn of 0.1%SDS).
Three. expression vector of the present invention
Expression vector of the present invention is for expressing the expression vector of genic mutation type recombinant protein enzyme K of the present invention.According to the present invention one preferred embodiment, described expression vector can have following structure: control the upstream that promoter sequence that described DNA expresses is connected to the DNA of coding genic mutation type recombinant protein enzyme K of the present invention.In addition, terminator can also be connected to the downstream of described DNA.
As the expression vector in yeast cell, can use any type in pPICZ, pPICZ α, pGAPZ, pGAPZ α, pGAPZ α A and pPIC9K.From the angle of copy number and stability, preferred pPIC9K.
According to the present invention one preferred embodiment, for selecting the selectable marker gene of recombinant chou or also can inserting expression vector of the present invention for detection of the reporter gene that quiding gene is expressed.The example of selectable marker gene includes but not limited to hygromycin gene, kalamycin resistance gene and ampicillin resistance gene.The example of reporter gene includes but not limited to beta-Glucuronidase (GUS) gene, E.C. 2.3.1.28 (CAT) gene, luciferase (LUC) gene and green fluorescent protein (GFP) gene.
According to the present invention, another preferred embodiment, for secreting, expressing genic mutation type recombinant protein of the present invention enzyme K or for the ease of the expressed Proteinase K of purifying, can comprise appended sequence in expression vector of the present invention.In this case, Proteinase K of the present invention is expressed with the form of fusion rotein (merging with albumen or the peptide of appended sequence coding).The example of described appended sequence includes but not limited to the nucleotide sequence of coded signal peptide or propetide; And the nucleotide sequence of coding His label or GST label.
Four. transformant of the present invention
Transformant of the present invention is the cell that imports expression vector of the present invention, and this cell can be produced genic mutation type recombinant protein enzyme K of the present invention.Although this transformant can be prokaryotic cell prokaryocyte can be maybe eukaryotic cell, be preferably eukaryotic cell.
Described eukaryotic example includes but not limited to yeast cell.According to the present invention one preferred embodiment, described eukaryotic cell is yeast cell.According to the present invention another preferred embodiment, described yeast cell is pichia spp (Pichia) cell, candiyeast (Candida) cell, Hansenula polymorpha (Hansenula polymorpha) cell, torulopsis (Torulopsis) cell, fission yeast (Schizosaccharomyces) cell and kluyveromyces (Kluyveromyces) cell.
An especially preferred embodiment according to the present invention, described yeast cell is Pichia pastoris.Owing at present the fermentation condition of pichia spp being had to more deep research, and described Pichia pastoris cost in fermentation preparation is minimum, can meet the demand of technical need and product marketization, thereby Pichia pastoris is considered to highly preferred transformant in genic mutation type recombinant protein enzyme K production.
According to the present invention one preferred embodiment, described Pichia pastoris is GS115 yeast cell (U.S. Gproan Protein Engineering, Inc. gives).
Can suitably select expression vector to import the method for transformant according to the type of transformant.These methods are all well known by persons skilled in the art.
According to the present invention one preferred embodiment, can obtain by the following method the transformant of pichia spp: the method that adopts electric shock to transform, is transformed into linearizing expression vector in yeast competent cell.Subsequently thalline suspension is coated to flat board upper, and until there is single bacterium colony in culture plate.
Five. test kit of the present invention
Test kit of the present invention be comprise genic mutation type recombinant protein enzyme K of the present invention, one or more the test kit in DNA, expression vector of the present invention and the transformant of the present invention of the genic mutation type recombinant protein enzyme K of the present invention that encodes.
Conventionally, described test kit comprises container and on this container or the label or the package insert that are associated with this container.Suitable container comprises, for example, and bottle, bottle, syringe etc.This container can be formed by multiple material, as glass or plastics.Described label and package insert have been indicated using method and the purposes of this test kit.
Optionally, test kit of the present invention also can comprise one or more components in addition, described component is selected from the group consisting of test tube, reaction buffer, PCR primer, dNTP, Taq polysaccharase, reversed transcriptive enzyme, DNA enzyme, RNA enzyme inhibitors, DEPC water and sterilized water, but is not always limited to this.
Six. preparation method's (laboratory scale) of genic mutation type recombinant protein enzyme K of the present invention
By cultivating transformant of the present invention, can produce genic mutation type recombinant protein enzyme K of the present invention, by the form of the fusion rotein with signal peptide fusion, express genic mutation type recombinant protein enzyme K of the present invention for secretion, proteolytic enzyme of the present invention can accumulate in substratum.When using inducible promoter, preferably induce in the training period.Although it is different with the type of cell to cultivate the method for described transformant, can use traditional method.
According to the present invention one preferred embodiment, the example of method of cultivating described pichia spp transformant is as described below:
Picking yeast list bacterium colony is cultivated to YPD substratum (yeast extract 10g/L, peptone 20g/L, glucose 20g/L).Centrifugal collection thalline.With MM substratum (13.4g/L YNB, 4 * 10
-4g/L vitamin H, 5mL/L methyl alcohol) shaking culture after resuspended thalline, starts abduction delivering.Every 24 hours is 1%(v/v to adding final concentration in the fermented liquid of abduction delivering) methyl alcohol.
Seven. preparation method's (technical scale) of genic mutation type recombinant protein enzyme K of the present invention
From the transformant of picking, obtain 3 the highest bacterial strains of genic mutation type recombinant protein enzyme K expression amount.Shake-flask culture three strain engineering strains, centrifugal results fermented supernatant fluid carries out enzyme and lives, expresses the tests such as output, digestion BSA, further chooses the best bacterial strain of a strain and carries out pilot scale scale-up.30 liters of fermentor tank levels, carry out the exploration of engineering strain optimal culture condition, comprise the consumption of culture medium prescription, dissolved oxygen amount, induction time and inductor methyl alcohol etc.
According to the present invention, one preferred embodiment, described pilot scale amplification test can carry out under the following conditions: adopt and substratum identical in shake flask fermentation, the methanol induction time is 48 ~ 168 hours, and dissolved oxygen amount is 20% ~ 40%, and the consumption of inductor methyl alcohol is 0.5% ~ 3%(v/v).
The technical scheme that 30 liters of fermentor tanks are obtained, is transplanted to 2 tons of tank industrial scale tests, copies pilot scale fermentation condition completely, continuously ferments and cultivates 48 ~ 168 hours, the every fermentation index of on-line monitoring at any time and cataphoretic determination protein expression level.
A highly preferred embodiment according to the present invention, the methanol induction time is 72 hours.
Lower tank centrifugation thalline and fermented liquid, when described genic mutation type recombinant protein enzyme K(is secreted into the proteolytic enzyme in substratum) while being in the state being present in fermented liquid supernatant, can be used; Also can use described proteolytic enzyme by concentrated described fermented liquid supernatant.Can purifying or partial purification described in genic mutation type recombinant protein enzyme K(be secreted into the proteolytic enzyme in substratum).
Utilize the general method of protein purification, can realize purifying or partial purification.For example, can use chromatogram (as ion-exchange or gel-filtration), ammonium sulfate precipitation or the organic solvent precipitation technology of comprising.Also can be by the enzyme after the concentrated described purifying such as freeze-drying, ultra-filtration membrane and organic solvent precipitation.
According to the present invention, one preferred embodiment, the hexahistine label that utilization is added at the C of genic mutation type recombinant protein enzyme K of the present invention end, first fermented liquid passes through centrifugation, supernatant liquor is through metal ion-chelant affinitive layer purification, and then through weak cation exchange chromatography purification, freeze-drying becomes finished product enzyme again, while having avoided adopting ultrafiltration-cation seperation column-ultrafiltration-anion column to carry out purifying in traditional purification process, albumen major part when ultrafiltration is precipitated out and the defect that causes yield to reduce, thereby makes comprehensive yield improve compared to existing technology 80%.
Embodiment
By means of following embodiment, can understand better the present invention, these embodiment only, for illustrating the present invention, should not be interpreted as limitation of the present invention.
In addition, all genetic manipulations can be by Molecular Cloning(Cold Spring Harbor Laboratory Press (1989)) the carrying out recorded.
The structure of embodiment 1 Proteinase K Expression vector pPIC9K-ProK and pPIC9K-mutProK
The encoding sequence of wild-type protease K (SEQ ID NO.3) is replaced with to the DNA sequence dna that pichia spp preference codon forms, at its 5 ' end, add SnaB I restriction enzyme site TACGTA, 3 ' end adds hexahistine label C ACCATCACCACCATCAC(SEQ ID NO.4 in turn), terminator codon TAA and NotI restriction enzyme site GCGGCCGC, utilize the sequence (SEQ ID NO.5) of the synthetic gained of chemical process.The SnaB I restriction enzyme site TACGTA that 5 ' end is added replaces with EcoR I restriction enzyme site GAATTC, and further introduce (as shown in Figure 1) after corresponding sudden change, utilize the sequence (SEQ ID NO.6-9) (the Canadian gene synthesis technology BioBasic Inc. of service company) of the synthetic gained of chemical process.The sequence of above-mentioned chemosynthesis has all been cloned into (the Canadian gene synthesis technology BioBasic Inc. of service company) in pUC57 plasmid.
Amplification pUC57/ProK plasmid and pUC57/mutProK plasmid, with restriction enzyme SnaB I, Not I and EcoR I, Not I, ProK and mutProK encoding sequence are cut respectively, be connected with the pPIC9K carrier (American I nvitrogen company) that carries out same double digestion, to connect product and transform DH5 α competent cell, picking clone, amplification plasmid, identifies plasmid with restriction enzyme SnaB I, Not I or EcoR I, Not I respectively.
Pass through aforesaid method, by the DNA fragmentation subclone (as shown in Figure 2) to Yeast expression carrier pPIC9K of encoding wild type Proteinase K and genic mutation type recombinant protein enzyme K of the present invention, thereby construct wild-type protease K Expression vector pPIC9K-ProK and genic mutation type recombinant protein enzyme K Expression vector pPIC9K-mutProK:pPIC9K-mutProK6(Y151A of the present invention, K208H, S273T, G293A, K332R, S337N), pPIC9K-mutProK7-1(S123A, Y151A, K208H, S273T, G293A, K332R, S337N), pPIC9K-mutProK7-2(Y151A, L180I, K208H, S273T, G293A, K332R, S337N) and pPIC9K-mutProK8(S123A, Y151A, L180I, K208H, S273T, G293A, K332R, S337N) (as shown in Figure 1).
Sequencing result shows, target fragment is all correctly inserted in above-mentioned expression vector.The conversion of embodiment 2 Proteinase K Expression vector pPIC9K-ProK and pPIC9K-mutProK
Utilize restriction enzyme Sal I enzyme to cut recombinant plasmid constructed in embodiment 1, make it linearizing, then use TE damping fluid (pH 8.0) to be dissolved to the concentration of 1 μ g/ μ L, plasmid and the GS115 yeast competent cell of getting 20 μ L dissolvings mix, be transferred in the electric revolving cup (two clearance between poles 0.1cm) of ice precooling ice bath 5min.The method that adopts electric shock to transform, utilizes the built-in pichia spp Transformation Parameters of electric conversion instrument to shock by electricity, and above-mentioned expression vector is transformed in GS115 yeast competent cell.
After electric shock,, to the 1M Sorbitol Solution USP that adds the precooling of 1mL ice in electric revolving cup, mix gently rapidly, go in 1.5mL EP pipe.Thalline suspension is coated to MD flat board (13.4g/L yeast basis nitrogenous source; 0.4mg/L vitamin H; 20g/L glucose, 1.5% agar) upper, every 500 μ L coating one flat plates.Flat board is placed in to 30 ℃ of environment and cultivates, until there is single bacterium colony, obtain GS115/pPIC9K-ProK and GS115/pPIC9K-mutProK.
Embodiment 3 high copy numbers and Mut
+the GS115/pPIC9K-ProK of phenotype and the screening of GS115/pPIC9K-mutProK
Prepare respectively the YPD screening dull and stereotyped (yeast extract 10g/L, peptone 20g/L, glucose 20g/L, 1.5% agar) of four G418 concentration gradients (0.75mg/mL, 1mg/mL, 1.75mg/mL, 2.0mg/mL).Dull and stereotyped for the MD cultivating in embodiment 2, with 70 yeast list bacterium colonies of each picking of aseptic toothpick, point screens in flat board at the YPD of above-mentioned four G418 concentration gradients, and makes corresponding numbering.Each clone is all cooked the screening of 4 gradients.
PPIC9K expression vector can be given pichia spp Geneticin resistance, and its resistance level mainly depends on the copy number of the kan gene of integration.The pPIC9K of single copy is incorporated into pichia spp postgenome, can give the Geneticin resistance level of the about 0.25mg/mL of pichia spp.Owing to having genetic linkage between kan gene and expression cassette (pAOX1 and goal gene), thereby can roughly infer the target protein encoding gene copy number that this clone comprises according to the resistance level of Geneticin.
Dull and stereotyped by observing above-mentioned screening, whether preliminary judgement GS115/pPIC9K-ProK and GS115/pPIC9K-mutProK yeast clone contain the target protein encoding gene of high copy number.In screening flat board, the content of G418 is higher, and yeast colony growth profile is larger, shows the copy that contains more target protein gene in this yeast mono-clonal, can tolerate the G418 of higher concentration.
Meanwhile, above-mentioned mono-clonal is carried out to PCR evaluation.Primer is 5'AOX1(SEQ ID NO.10), 3'AOX1(SEQ ID NO.11).
5'AOX1：GACTGGTTCCAATTGACAAGC
3'AOX1：GCAAATGGCATTCTGACATCC
PCR system (20 μ L):
PCR program:
94℃5min；
94 ℃ of 30s, 55 ℃ of 1min, 72 ℃ of 2min 15s, 30 circulations;
72℃6min。
Utilize agarose gel electrophoresis to detect the size of PCR product.With Sal I linearization plasmid, transform after GS115, mostly on HIS4 site, recombinate, most of transformants are Mut
+phenotype; Yet because plasmid contains AOX1 gene order, likely in AOX1 site, recombinate, destroy wild-type AOX1 gene, produce Mut
stransformant.Therefore, in theory, if object fragment is inserted success and phenotype is Mut
+, should have two bands about 2200bp left and right, 1632bp; If only have band of 1632bp, phenotype may be Mut
s.
PCR result shows the band can amplify 2200bp left and right, show that object fragment all inserts successfully, and phenotype is Mut
+.
Expression and the detection (laboratory scale) of embodiment 4 genic mutation type recombinant protein enzyme K in yeast cell
High copy number and Mut that screening in embodiment 3 is obtained
+the yeast list colony inoculation of the GS115/pPIC9K-ProK of phenotype and GS115/pPIC9K-mutProK is to 20mL YPD substratum (yeast extract 10g/L, peptone 20g/L, glucose 20g/L), and 30 ℃, 250rpm cultivates 24h.The centrifugal collection thalline of 1500g.With 10mL MM substratum (13.4g/LYNB, 4 * 10
-4g/L vitamin H, 5mL/L methyl alcohol) resuspended thalline.Subsequently at 30 ℃, shaking flask under 250rpm (2L) abduction delivering.Every 4 hours from fermented liquid sampling in order to detecting, and to adding final concentration in the fermented liquid of abduction delivering, be 1%(v/v) methyl alcohol.Continuous 5 days, cultivate altogether 120 hours.
And then, utilize 30 liters of fermentor tanks to carry out pilot scale scale-up, pichia spp culture scheme (www.invitrogen.com) with reference to American I nvitrogen company, adopt and substratum identical in shake flask fermentation, the methanol induction time is set as to 120 hours, dissolved oxygen amount is controlled at 30%, and the consumption of inductor methyl alcohol is 1%(v/v), within every 4 hours, from fermented liquid, sample in order to detecting.
After cultivation, centrifugal substratum, thus obtain the fermented liquid supernatant that contains said gene saltant type recombinant protein enzyme K, and be placed in-70 ℃ of preservations.
Utilize SDS-PAGE, Western blotting and Native-PAGE to detect the expression of genic mutation type recombinant protein enzyme K of the present invention in yeast cell.
1.SDS-PAGE detects
According to following experimental program, carry out SDS-PAGE detection:
1.1 preparation SDS-PAGE gels:
1.1.1 the preparation of separation gel:
In small beaker, add successively required solution composition, pour in the gap of the double glazing unit being pre-assembled, more than room temperature is placed 20min, until gel polymerisation is complete.
1.1.2 the preparation of concentrated glue:
In small beaker, add successively required solution composition, pour into the gap of the separation gel top of having condensed between double glazing unit, more than room temperature is placed 20min, until gel polymerisation is complete.
1.2 the substratum supernatant of GS115/pPIC9K-mutProK8, by-70 ℃ of taking-ups, with boiling water bath is processed to 10min after melting on ice.The centrifugal 1min of 12000g, draws supernatant and joins in the sample duct of the gel of as above preparing, and applied sample amount is 20 μ L.Add protein molecular weight standard (Unstained Protein Molecular Weight Marker, Fermentas) simultaneously.
1.3200V constant voltage electrophoresis 1.5h.
1.4 unload gel.Shown according to the form below, prepare staining fluid and destainer, carry out coomassie brilliant blue staining, to observe the target protein band in sample.
Coomassie brilliant blue staining liquid: destainer:
Result as shown in Figure 3, is cultivated and can in fermented liquid supernatant (shake flask fermentation), be observed obvious target protein band in 3.5 hours.Wherein, the sample in each swimming lane is as follows:
The 1st road: protein molecular weight standard;
The 2nd road: abduction delivering 51.5 hours;
The 3rd road: abduction delivering 47.5 hours;
The 4th road: abduction delivering 31.5 hours;
The 5th road: abduction delivering 27.5 hours;
The 6th road: abduction delivering 23.5 hours;
The 7th road: abduction delivering 7.5 hours;
The 8th road: abduction delivering 3.5 hours;
The 9th road: the contrast before induction.
Wherein, 7 protein bands of protein molecular weight standard (Unstained Protein Molecular Weight Marker, Fermentas) represent respectively the albumen size of 116 kD, 66.2 kD, 45 kD, 35 kD, 25 kD, 18.4 kD and 14.4 kD.
2.Western trace
(1) transfer printing: the glue after electrophoresis is taken out, immerse after transfering buffering liquid, slowly shake 30min on shaking table; Cut nitrocellulose filter, immerse at least 5min of transfering buffering liquid; With filter paper of transferring buffered liquid wetting, be laid on the bottom electrode plate of transfer printing instrument, film is laid on filter paper, do not stay bubble, gel is affixed on film, do not stay bubble; Wetting another filter paper, covers on gel, with the glass test tube bubble of rushing; Cover top layer battery lead plate, connect positive and negative power supply, transferring film 50V, 4 ℃ spend the night.
(2) hybridization: after transferring film, take out transfer film, room temperature, 25mL TBS washes film 5min; Transfer film immerses sealing 25mL damping fluid, incubated at room 1h; Take out transfer film and wash three times with TBST, each 5min, each 15mL; Film and primary antibodie diluent 10mL hybridization, 4 ℃ of concussions are spent the night; Take out transfer film and wash three times with TBST, each 5min, each 15mL; Hatch 10mL hybridization with two anti-diluents, room temperature concussion 1h; Take out transfer film and wash three times with TBST, each 5min, each 15mL; Outwell film washing liquid, film is sandwiched in to thieving paper centre and sucks unnecessary liquid, be laid on sheet glass; With preservative film, wrap film, do not stay bubble, in albumen side direction, be fixed in sheet folder and prepare exposure.
(3) develop a film: cut out egative film, compressing tablet, exposure 1-3min; Development 3min, in water rinsing several times, photographic fixing 10 ~ 15min, clear water rinses; According to development effect, determine the time shutter.
Result as shown in Figure 4, can be observed obvious protein expression.Wherein, getting induction shake flask fermentation supernatant liquor and the 30L fermented supernatant fluid of latter 72 hours analyzes.Outside isolating protein molecular weight standard (5 μ L), the equal loading 20 μ L of each swimming lane sample, the sample in each swimming lane is as follows:
The 1st road: shake flask fermentation supernatant liquor, concentrated 20 times;
The 2nd road: shake flask fermentation supernatant liquor, concentrated 10 times;
The 3rd road: shake flask fermentation supernatant liquor, concentrated 5 times;
The 4th road: shake flask fermentation supernatant liquor;
The 5th road: 30L fermented supernatant fluid;
The 6th road: 30L fermented supernatant fluid, concentrated 5 times;
The 7th road: 30L fermented supernatant fluid;
The 8th road: protein molecular weight standard.
Wherein, 10 protein bands of protein molecular weight standard (Precision Plus Protein Dual Color Standards, Bio-Rad) represent respectively the albumen size of 250kD, 150kD, 100kD, 75kD, 50kD, 37kD, 25kD, 20kD, 15kD, 10kD.
The result and the GS115/mutProK8 similar (data are not shown) that utilize GS115/mutProK6, GS115/mutProK7-1 and GS115/mutProK7-2 to obtain.
As can be seen here, genic mutation type recombinant protein enzyme K of the present invention can be in yeast cell effective expression.
3. native polyacrylamide gel electrophoresis (Native-PAGE)
3.1 experimental principles:
Native polyacrylamide gel electrophoresis (basic protein active electrophoresis) is a kind of ordinary method of using in analysis of protein well-known to those skilled in the art.The method is utilized the separated basic protein of low pH gel systems, according to the difference of its electrophoretic mobility and the molecular sieve effect of gel, completes.
3.2 instruments, reagent:
3.2.1 instrument:
Electrophoresis apparatus, whizzer, pH meter etc.
3.2.2 reagent and solution:
30% acrylamide soln: acrylamide (Acr) 29g, N, N '-methylene bisacrylamide (Bis) 1g, mixes rear adding distil water 20mL, and 37 ℃ of dissolvings, are settled to 100mL, 4 ℃ of preservations in brown bottle.
4 * separation gel damping fluid: take 1.35g KOH, be dissolved in 80mL water, regulate pH=4.3 with glacial acetic acid, add water and be settled to 100mL, in 4 ℃ of preservations.
8 * spacer gel damping fluid: take 2.7g KOH, be dissolved in 80mL water, regulate pH=6.8 with glacial acetic acid, add water and be settled to 100mL, in 4 ℃ of preservations.
1 * electrophoretic buffer: take ALANINE 31.185g, add suitable quantity of water and dissolve, regulate pH=4.3 ~ 4.5 with glacial acetic acid, add water and be settled to 1000mL, in 4 ℃ of preservations.
5 * sample-loading buffer: 2.5mL 8 * separation gel damping fluid, 3.625mL glycerine, adds water and is settled to 10mL, and methyl green is appropriate ,-20 ℃ of preservations.
10% ammonium persulfate solution: analytical pure ammonium persulphate 1g, be dissolved in water, be settled to 10mL, in 4 ℃ of preservations.(ammonium persulphate can slowly decompose, thus fresh preparation every other week or prepare after be placed in little centrifuge tube ,-20 ℃ of preservations, the used time takes out a tubule and uses).
TEMED(N, N, N, N-Tetramethyl Ethylene Diamine) solution: reagent stoste takes a morsel, and is placed in brown vial, in 4 ℃ of preservations.
Coomassie brilliant blue R-250 staining fluid: Coomassie brilliant blue (Coomassie blue R-250) 0.5g, 200mL destainer.
Destainer: ethanol 450mL, Glacial acetic acid 100mL, water 450mL.
50mmol/L HAc-NaAc damping fluid (pH=4.0) (dilute sample is used).
3.3 working method:
3.3.1 making sheet: sheet glass is cleaned, on request sheet glass is fixed on the mould of plastics.
Prepare 15% separation gel (lower floor's glue) 10mL, fill a prescription as follows:
| Solution composition | Addition (mL) |
| Distilled water | - |
| 30% acrylamide soln | 5.05 |
| 50% glycerine | 2.27 |
| 4 * separation gel damping fluid | 2.54 |
| 8 * spacer gel damping fluid | - |
| 10% ammonium persulfate solution | 0.121 |
| TEMED solution | 0.015 |
| Cumulative volume | 10 |
Component in formula is joined in 50mL beaker, mix, use 1mL liquid-transfering gun, along sheet glass, slowly join in film groove, in each plate, add 5.0mL.After separation gel adds, with wash bottle gently at Jiao Mianshang, add water, make it water seal.Room temperature is placed about 30min, after glue condenses naturally, slowly water is inclined, and uses filter paper suck dry moisture.
Prepare 5% spacer gel (upper strata glue) 3mL, 5mL, fill a prescription as follows:
| Solution composition | Addition (mL) | Addition (mL) |
| Distilled water | 2.07 | 3.45 |
| 30% acrylamide soln | 0.498 | 0.83 |
| 50% glycerine | - | - |
| 4 * separation gel damping fluid | - | - |
| 8 * spacer gel damping fluid | 0.378 | 0.63 |
| 10% ammonium persulfate solution | 0.03 | 0.05 |
| TEMED solution | 0.003 | 0.005 |
| Cumulative volume (mL) | 3 | 5 |
Component in formula is joined in 50mL beaker, mix rapidly, along sheet glass, slowly join on separated film, till filling it up with rapidly.Comb is inserted in the glue of upper strata gently.After gelling is solid, mould is put into water, slowly transfer to comb.
3.3.2 sample preparation:
Get resulting fermented liquid 2mL, the centrifugal 1.5min of 10000r/min.With rifle head, draw the sample supernatant of 80 μ L after centrifugal in little centrifuge tube, add 20 μ L5 * sample-loading buffers, mix.
3.3.3 loading:
Device is put into electrophoresis chamber, at electrophoresis chamber, add 1 * electrophoretic buffer outward, in two glass plywood medial launders, also fill with this liquid (being as the criterion with submergence adhesive tape loading hole).Sample after carefully 20 μ L being processed with rifle head joins in loading hole.
3.3.4 electrophoresis:
By the wiring of electrophoresis apparatus, redness connects negative pole, and black connects positive pole (basic protein reversible circulation), connects power supply, start.Regulation output voltage is to 180V.When showing that electric current is 0, till electrophoresis sample walks to gel bottommost.
3.3.5 dyeing:
With coomassie brilliant blue staining immersion foaming gel, under room temperature, vibration dyeing on shaking table.
3.3.6 decolouring:
Staining fluid is poured out, with distilled water, washed away unnecessary staining fluid, add destainer, decolour to sample strip clear display.
Result is referring to Fig. 5.Wherein, contrast ProK is the commercialization Proteinase K (the wild-type protease K of procaryotic cell expression) of Merck company.Visible, genic mutation type recombinant protein enzyme K of the present invention can be in yeast cell effective expression.
The detection of embodiment 5 genic mutation type recombinant protein enzyme K activity
Utilize resulting shake-flask culture fermented liquid supernatant in embodiment 4, by Bradford method, measure protein concn, with PBS, the protein concentration of fermented liquid supernatant is adjusted to 0.97mg/mL.
Reaction substrate is the BSA of guanidine hydrochloride denaturation: 5mg BSA is dissolved in to 6M Guanidinium hydrochloride, 50mM Tris-Cl(pH 8.0), 5mM DTT, final volume is 1mL.95 ℃ of water-bath 20min; Be down to after room temperature, add 50mM Tris-Cl(pH 7.5) and 5mM CaCl
2, the final concentration of Guanidinium hydrochloride is down to below 2M.
Temperature of reaction: 55 ℃; (100 μ L) is as shown in the table for reaction system:
| Sample | 3 | 4 | 5 | 6 | 7 | 8 | 10 |
| BSA（μL） | 90 | 90 | 70 | 70 | 50 | 50 | 100 |
| mutProK8（μL） | 10 | 10 | 30 | 30 | 50 | 50 | 0 |
| Reaction times | 2h | Spend the night | 2h | Spend the night | 2h | Spend the night | 2h |
After finishing, reaction adds 25 μ L5 * sample-loading buffers, loading 30 μ L, 100V electrophoresis 90min.
In sample 1:100 μ L mutProK8 fermentation, reset and add 25 μ L 5 * sample-loading buffers, loading 20 μ L.
The purified concentrated mutProK8 of sample 2:100 μ L adds 25 μ L 5 * sample-loading buffers, loading 20 μ L.
Sample 9:10 μ L not sex change BSA adds 2.5 μ L 5 * sample-loading buffers, loading 2 μ L.
As shown in Figure 6A, add after genic mutation type recombinant protein enzyme K of the present invention, BSA is all completely degraded.Only containing contrasting BSA and only not degrading containing the sample of mutProK8.
In addition, as shown in Figure 6B, only 0.01 μ gmutProK8, with regard to the degradable 16 μ gBSA of energy, shows that the resulting genic mutation type recombinant protein of the present invention enzyme K has outstanding activity.Wherein, in each swimming lane, sample is as follows:
The 1st road: protein molecular weight standard;
The 2nd road: BSA 16 μ g, wild-type protease K;
The 3rd road: BSA 16 μ g, 0.01 μ g mutProK8;
The 4th road: BSA 16 μ g, 0.1 μ g mutProK8;
The 5th road: BSA 16 μ g, 1.0 μ gmutProK8.
Wherein, 7 protein bands of molecular weight standard (Unstained Protein Molecular Weight Marker, Fermentas) represent respectively the albumen size of 116kD, 66.2kD, 45kD, 35kD, 25kD, 18.4kD and 14.4kD.
Result and mutProK8 similar (data are not shown) that mutProK6, mutProK7-1 and mutProK7-2 obtain.
The above results tentatively shows that genic mutation type recombinant protein enzyme K raw product of the present invention has obvious protease activity.
The detection by quantitative of the specific activity of embodiment 6 genic mutation type recombinant protein enzyme K
Detect by the following method the enzymic activity utilize the genic mutation type recombinant protein enzyme K of the present invention that the experimental program in embodiment 4 obtains:
Response procedures:
With 50mM potassium phosphate solution preparation 0.65%(w/v) casein food grade solution, slowly heating is until form single uniform dispersion, use 1M HCl solution or NaOH solution adjusting pH to 7.5 at 37 ℃.Preparation is containing 10mM NaAc and 5mM Ca (Ac)
2solution, at 37 ℃, with 0.1M HCl or NaOH, regulate pH to 7.5.Be cooled to room temperature containing 10mM NaAc and 5mM Ca (Ac)
2solution preparation concentration be 0.1 ~ 0.2U/mL Proteinase K (wild-type protease K(ProK) or genic mutation type recombinant protein enzyme K(mutProK of the present invention)) solution, this solution is for using front preparation.
According to following order, add successively each reagent (mL):
Hatch 30min manually mixing off and on for 37 ℃, with No. 50 filter paper filterings and collect clear liquor and carry out next step experiment.
Standard curve making and colorimetric reaction:
1. typical curve:
10mL forint phenol reagent is diluted with water to 40mL, preparation 0.5N F-C reagent.Slowly heating, until tyrosine dissolves and is cooled to room temperature, is prepared 1.1mM TYR standard solution.
According to following order, add successively each reagent (mL):
2. sample determination:
In 4 bottles, according to following order, add successively each reagent (mL) respectively:
Hatch and manually mix off and on for 37 ℃, after 30min, take out bottle and be cooled to room temperature.If solution presents muddy shape, with being conducive to absorbance after 0.45 μ m membrane filtration, measure.Reaction solution is transferred in Glass Containers, with spectrophotometer, at 660nm place, measures the absorbance of Std 1 ~ 4, Std blank, sample and contrast.Result is calculated:
1. typical curve:
△
660nmstd=A
660nmstd-A
660nmstd is blank
Use △
660nmthe amount of Std and TYR (μ mol) drawing standard graphic representation.
Gained typical curve as shown in Figure 7.
2. sample determination:
△
660nmsample=A
660nmsample-A
660nmblank
Utilize typical curve to calculate the amount (μ mol) of the TYR of release.
Enzymic activity (U/mL)=(amount of the TYR of release (μ mol)) * 11/(1 * 10 * 2).
Wherein, the cumulative volume (mL) during 11=reaction terminating
The 10=reaction times (min)
Enzyme reagent volume (mL) during 1=reaction
Reaction solution volume used (mL) during 2=colorimetric
U/mg solid=(U/mL enzyme)/(mg solid/mL enzyme)
U/mg albumen=(U/mL enzyme)/(mg albumen/mL enzyme)
Enzymic activity definition
1 unit of enzyme activity is defined as, and under 7.5,37 ℃ of conditions of pH, per minute decomposites 1.0 μ mol(181 μ g from casein food grade) TYR.(Forint phenol method carries out colorimetric)
Final reagent concentration
In the reaction system of 6mL, reagent final concentration is: 42mM potassiumphosphate, 0.54%(w/v) casein food grade, 1.7mM NaAc, 0.8mM Ca (Ac)
2proteinase K solution with 0.1 ~ 0.2U/mL.
Result is as shown in the table:
| mutProK6 | mutProK7-1 | mutProK7-2 | mutProK8 | ProK | |
| Active (U/mg) | 38.5 | 45.0 | 43.5 | 66.5 | 31.0 |
Visible, the genic mutation type recombinant protein enzyme K that the present invention prepares can demonstrate the enzymic activity that is obviously better than neutral protease K, and wherein, the mutProK8 of eight whole sudden changes of critical sites demonstrates 2 times of above outstanding enzymic activitys of neutral protease K enzymic activity; And then, than further the S of the 123rd is sported to A(mutProK7-1 on the basis of mutProK6) or further the L of the 180th is sported to I(mutProK7-2) the enzymic activity of recombinant protein enzyme K, the mutProK8 simultaneously these two critical sites being suddenlyd change has demonstrated the enzymic activity (66.5U/mg) significantly improving surprisingly.
The large-scale industrialization of embodiment 7 genic mutation type recombinant protein enzyme K is produced and purifying
From the transformant of picking, obtain 3 the highest bacterial strains of genic mutation type recombinant protein enzyme K expression amount.Utilize experimental program as described in example 4 above, shake-flask culture three strain engineering strains, purifying protein enzyme K carry out enzyme and live, express the tests such as output, digestion BSA from fermented liquid, further chooses the best bacterial strain of a strain and carries out pilot scale scale-up.
30 liters of fermentor tank levels, carry out the exploration of engineering strain optimal culture condition, pichia spp culture scheme (www.invitrogen.com) with reference to American I nvitrogen company, adopt and substratum identical in shake flask fermentation, the methanol induction time is 120 hours, dissolved oxygen amount is controlled at 30%, the consumption of inductor methyl alcohol is 1%(v/v), sampling in every 8 hours after induction, electrophoretic analysis Proteinase K expression amount.
The technical scheme that 30 liters of fermentor tanks are obtained, is transplanted to 2 tons of tank industrial scale tests, copies pilot scale fermentation condition completely, continuously ferments and cultivates 72 hours, the every fermentation index of on-line monitoring at any time and cataphoretic determination protein expression level.Lower tank centrifugation thalline and fermented liquid.
Get the fermented liquid supernatant of the mutProK8 before induction in contrast, the fermented liquid supernatant sample of getting respectively induction rear 8h, 16h, 24h, 32h, 40h, 48h, 56h, 64h carries out SDS-PAGE electrophoresis detection.Result as shown in Figure 8.Wherein, in each swimming lane, sample is as follows:
The 1st road: contrast before induction;
The 2nd road: induce latter 8 hours;
The 3rd road: induce latter 16 hours;
The 4th road: induce latter 24 hours;
The 5th road: induce latter 32 hours;
The 6th road: induce latter 40 hours;
The 7th road: induce latter 48 hours;
The 8th road: induce latter 56 hours;
The 9th road: induce latter 64 hours;
10 road: induce latter 72 hours.
Result and mutProK8 similar (data are not shown) that mutProK6, mutProK7-1 and mutProK7-2 obtain.
Visible, utilize this large-scale industrialization mode of production, can effectively improve the productive rate (higher than 1.3g/L fermented liquid) of genic mutation type recombinant protein enzyme K of the present invention.This productive rate is better than the productive rate (0.3-0.5g/L fermented liquid) of current existing Proteinase K industrial process, thereby makes the high yield of later stage purifying, freeze-drying become possibility, for large-scale industrial is provided by the condition that provides.
The hexahistine label that utilization is added at the C of recombinant protein enzyme K end, greatly reduced non-specific binding to irrelevant foreign protein and nucleic acid and other non-specific binding molecule in purification column, fermented liquid is through 10, 000rpm high speed centrifugation is separated, metal-chelating column chromatography and weak cation exchange column chromatography for separation, after the decolouring processing of macropore decolouring glue and freeze-drying, become finished product enzyme, while having avoided adopting ultrafiltration-cation seperation column-ultrafiltration-anion column to carry out purifying in traditional purification process, albumen major part when ultrafiltration is precipitated out and the defect that causes yield to reduce, yield after purifying is higher than the initial fermented liquid of 500mg/L, thereby make comprehensive yield improve compared to existing technology 80%.
Utilize SDS-PAGE and non-sex change PAGE to detect the purity of the Proteinase K after the freeze-drying of above-mentioned technique purifying.Result as shown in Figure 9.Can find out, the recombinant protein enzyme K after purifying freeze-drying has high purity (99%).
The stability of embodiment 8 genic mutation type recombinant protein enzyme K
The enzyme of depositing in the mutProK8 of-20 ℃ with solution form and depositing in the mutProK8 of 4 ℃ with the lyophilized powder form stability of living is detected.
Result as shown in figure 10.Can find out, the enzyme activity of lyophilized powder substantially remained unchanged in 1 year, and the mutProK8 of solution form has also retained about 98.5% enzyme work after 1 year, shows to utilize genic mutation type recombinant protein enzyme K prepared by method of the present invention to have high stability.
Finally it should be noted that: above embodiment is only unrestricted in order to the present invention to be described, although disclose for illustrative purposes the preferred embodiment of the present invention, those of ordinary skill in the art is to be understood that, can carry out various modifications, add or be equal to replacement to the present invention, and not departing from the spirit and scope of the present invention, it all should be encompassed in the middle of claim scope of the present invention.
Industrial applicibility
Genic mutation type recombinant protein enzyme K using gene engineering technique of the present invention is produced biologically active substance in a large number, can overcome the defect that natural product yield poorly, expense is high.Conjugated protein engineering, the molecular structure of engineered protein, obtains the proteolytic enzyme product that function is more powerful, and reduces cost, and these new technologies tool in industrial enzymes has been widely used.
Claims (12)
1. genic mutation type recombinant protein enzyme K, is characterized in that: the Y of the 151st of the aminoacid sequence as shown in SEQ ID NO.2 is sported to A, the K of the 208th and sport H, the S of the 273rd and sport T, the G of the 293rd and sport A, the K of the 332nd and sport R, the S of the 337th and sport N; And, further the S of the 123rd is sported to A, the L of the 180th and sports I,
Wherein, described genic mutation type recombinant protein enzyme K is produced by yeast cell.
2. genic mutation type recombinant protein enzyme K as claimed in claim 1, wherein, the C of described genic mutation type recombinant protein enzyme K end is further connected with hexahistine label.
Coding genic mutation type recombinant protein enzyme K as claimed in claim 1 or 2 DNA.
4. DNA as claimed in claim 3, wherein, described DNA is all or part of of the represented nucleotide sequence of SEQ ID NO.9, described part is comprised of the nucleotide sequence of SEQ ID NO.9 7-1113 position.
5. the expression vector that comprises the DNA as described in claim 3 or 4.
6. expression vector as claimed in claim 5, wherein, described expression vector is pPICZ, pPICZ α, pGAPZ, pGAPZ α, pGAPZ α A and pPIC9K.
7. import the transformant of the expression vector described in claim 5 or 6, it is characterized in that, described transformant is pichia spp (Pichia) cell, candiyeast (Candida) cell, Hansenula polymorpha (Hansenula polymorpha) cell, torulopsis (Torulopsis) cell, fission yeast (Schizosaccharomyces) cell or kluyveromyces (Kluyveromyces) cell.
8. transformant as claimed in claim 7, wherein, described transformant is Pichia pastoris.
9. test kit, is characterized in that, described test kit comprises and is selected from one or more in following material: the genic mutation type recombinant protein enzyme K described in claim 1 or 2; DNA described in claim 3 or 4; Expression vector described in claim 5 or 6; And the transformant described in claim 7 or 8.
10. prepare the method for genic mutation type recombinant protein enzyme K as claimed in claim 1 or 2, described method comprises the steps: to cultivate transformant as claimed in claim 7 or 8 in substratum; And collect the described genic mutation type recombinant protein enzyme K in described substratum.
11. method as claimed in claim 10, the method further comprises the purifying process process of described genic mutation type recombinant protein enzyme K, and described purifying process process comprises centrifugation, chromatographic separation, decolouring processing and freeze-drying.
12. methods as claimed in claim 11, wherein, described chromatographic separation is to utilize histidine-tagged metal ion-chelant affinity chromatography of carrying out.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210363700.8A CN102839165B (en) | 2012-09-26 | 2012-09-26 | Gene mutation type recombined protease K and industrialized production method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210363700.8A CN102839165B (en) | 2012-09-26 | 2012-09-26 | Gene mutation type recombined protease K and industrialized production method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102839165A CN102839165A (en) | 2012-12-26 |
| CN102839165B true CN102839165B (en) | 2014-12-10 |
Family
ID=47366884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210363700.8A Active CN102839165B (en) | 2012-09-26 | 2012-09-26 | Gene mutation type recombined protease K and industrialized production method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102839165B (en) |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059900A (en) * | 2013-03-19 | 2014-09-24 | 中国科学院天津工业生物技术研究所 | Protease K and application thereof |
| CN105087529A (en) * | 2014-05-07 | 2015-11-25 | 天津旭晨科技有限公司 | Genetically engineered protease K and production method of protease K |
| CN105193640B (en) * | 2014-06-24 | 2018-10-12 | 金普诺安蛋白质工程技术（北京）有限公司 | Application of the Proteinase K in skin care and cosmetic field |
| CN104232611B (en) * | 2014-09-16 | 2018-06-08 | 合肥巅峰生物科技有限公司 | A kind of recombination muscardine Proteinase K and its industrialized production and purification process |
| CN106318929A (en) * | 2016-09-21 | 2017-01-11 | 百源科创分子医学研究所（南通）有限公司 | Process for producing oligonucleotides through enzymolysis method |
| CN109280656B (en) * | 2018-10-23 | 2021-06-15 | 大连博格林生物科技有限公司 | Recombinant beauveria bassiana proteinase K mutant PK-M1 and preparation method thereof |
| CN109207460B (en) * | 2018-10-23 | 2021-06-15 | 大连博格林生物科技有限公司 | Recombinant beauveria bassiana proteinase K mutant PK-M2 and preparation method thereof |
| CN114181925A (en) * | 2020-09-14 | 2022-03-15 | 武汉禾元生物科技股份有限公司 | Industrial purification and freeze-drying method for recombinant proteinase K |
| CN112831487B (en) * | 2021-01-27 | 2022-05-06 | 武汉爱博泰克生物科技有限公司 | Purification method and application of recombinant proteinase K |
| CN113234707B (en) * | 2021-05-31 | 2022-11-22 | 武汉瀚海新酶生物科技有限公司 | Protease K mutant and preparation method thereof |
| CN113337492B (en) * | 2021-06-02 | 2023-04-07 | 武汉瀚海新酶生物科技有限公司 | Protease K heat-resistant mutant |
| CN113215138B (en) * | 2021-06-02 | 2022-11-22 | 武汉瀚海新酶生物科技有限公司 | Proteinase K mutant with improved thermal stability |
| CN113913412B (en) * | 2021-10-13 | 2023-10-03 | 湖北大学 | Proteinase K mutant and its preparing process |
| PL244825B1 (en) * | 2021-11-26 | 2024-03-11 | Blirt Spolka Akcyjna | Mutant of Tritirachium album proteinase K and its zymogen, an expression plasmid, a recombinant strain of Pichia pastoris and method for preparing a mature form of proteinase K mutant |
| CN114196656B (en) * | 2021-12-29 | 2023-10-24 | 南京巨匠生物科技有限公司 | Proteinase K mutant and construction and application of its expression vector |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1303437A (en) * | 1998-03-26 | 2001-07-11 | 宝洁公司 | Serine protease variants having amino acid deletions and substitutions |
| CN1426469A (en) * | 2000-04-24 | 2003-06-25 | 宝洁公司 | Enzyme variants having one or more D-amino acid substitutions |
| CN101511365A (en) * | 2006-08-29 | 2009-08-19 | 埃科特莱茵药品有限公司 | Therapeutic compositions comprising a specific endothelin receptor antagonist and a PDE5 inhibitor |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10105911A1 (en) * | 2001-02-09 | 2002-08-14 | Roche Diagnostics Gmbh | Expression of the recombinant proteinase K from Tritirachium album in yeast |
-
2012
- 2012-09-26 CN CN201210363700.8A patent/CN102839165B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1303437A (en) * | 1998-03-26 | 2001-07-11 | 宝洁公司 | Serine protease variants having amino acid deletions and substitutions |
| CN1426469A (en) * | 2000-04-24 | 2003-06-25 | 宝洁公司 | Enzyme variants having one or more D-amino acid substitutions |
| CN101511365A (en) * | 2006-08-29 | 2009-08-19 | 埃科特莱茵药品有限公司 | Therapeutic compositions comprising a specific endothelin receptor antagonist and a PDE5 inhibitor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102839165A (en) | 2012-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102839165B (en) | Gene mutation type recombined protease K and industrialized production method thereof | |
| Machida et al. | Nucleotide sequences of Saccharomycopsis fibuligera genes for extracellular beta-glucosidases as expressed in Saccharomyces cerevisiae | |
| CN101177685B (en) | Screening method for genes of brewing yeast | |
| CN110054702B (en) | Zearalenone degrading enzyme fusion protein and encoding gene and application thereof | |
| CN112209995B (en) | Preparation method of SARS-CoV-2 surface protein receptor binding region | |
| CN109280656B (en) | Recombinant beauveria bassiana proteinase K mutant PK-M1 and preparation method thereof | |
| CN101591664A (en) | The gene of a kind of high antimer selective epoxidation thing lytic enzyme and coding thereof | |
| CN111763678B (en) | Promoter for improving activity of heterologous expression enzyme of keratinase | |
| CN104232611B (en) | A kind of recombination muscardine Proteinase K and its industrialized production and purification process | |
| CN107446039A (en) | A kind of human insulin analogue precursor and preparation method thereof | |
| CN109207460A (en) | Recombinate muscardine Proteinase K mutant PK-M2 and preparation method | |
| CN106701813A (en) | Expression vector as well as construction method and application thereof | |
| CN102559730B (en) | Method for increasing expression of CP4-EPSPS in Hansenula polymorpha | |
| CN101948519A (en) | Mytilus coruscus foot adhesive protein as well as encoding sequence and preparation method thereof | |
| Queiros et al. | Isolation and characterization of Kluyveromyces marxianus mutants deficient in malate transport | |
| CN114196688B (en) | Expression of prokaryotic alkaline phosphatase in yeast | |
| CN105200024A (en) | Lipase CALB mutant and preparation method and application thereof | |
| CN108795891A (en) | A kind of glucose oxidase CnGODA and its gene and application | |
| CN102533841B (en) | Method for increasing expression of bacillus thuringiensis(Bt) insecticidalcrystalprotein in hansenula polymorpha | |
| CN103667212B (en) | Glucoamylase and application thereof | |
| CN105349536A (en) | Specific PCR primer for pathogenesis-related protein PR10 gene of tobacco and application thereof | |
| CN102485890A (en) | Expression of recombined human protein disulphide isomerase (hPDI491) with Pichia pastoris in secretion manner | |
| CN102277327B (en) | Colon bacillus for over-expressing RimL and application on preparing N-extrasin alpha acetylate | |
| CN116731144B (en) | Recombinant rice antioxidant peptide and preparation method and application thereof | |
| CN110819609A (en) | Mutant lipase with improved thermal stability as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 215425 No. 18, Lingxi Road, Taicang biomedical industrial park, Shaxi Town, Taicang City, Suzhou City, Jiangsu Province Patentee after: Jiangsu jinpunuoan Biotechnology Co.,Ltd. Address before: 215425 No. 1, Zhaoyan Road, Taicang biomedical industrial park, Shaxi Town, Taicang City, Jiangsu Province Patentee before: GPROAN BIOTECHNOLOGIES (SUZHOU), Inc. |