CN109207460B

CN109207460B - Recombinant beauveria bassiana proteinase K mutant PK-M2 and preparation method thereof

Info

Publication number: CN109207460B
Application number: CN201811234362.1A
Authority: CN
Inventors: 岳敏; 李民强
Original assignee: Dalian Bgbioscience Co ltd
Current assignee: Dalian Bgbioscience Co ltd
Priority date: 2018-10-23
Filing date: 2018-10-23
Publication date: 2021-06-15
Anticipated expiration: 2038-10-23
Also published as: CN109207460A

Abstract

The invention discloses a recombinant beauveria bassiana proteinase K mutant PK-M2 and a preparation method thereof, and the invention obtains the proteinase K mutant PK-M2 with improved activity and stability by starting with the modification of the proteinase K molecular structure of the recombinant beauveria bassiana, wherein the amino acid sequence is shown as SEQ ID NO: 1 is shown in the specification; an expression system is optimized, and a yeast extracellular secretion expression technology is utilized, so that the recombinant proteinase K mutant can be efficiently expressed in a large-scale fermentation manner, and the yield of the proteinase K is further improved; the method adopts a protein purification mode of high-efficiency affinity chromatography, improves the yield in the purification process of the proteinase K, and realizes the large-scale production of the proteinase K.

Description

Recombinant beauveria bassiana proteinase K mutant PK-M2 and preparation method thereof

Technical Field

The invention relates to the technical field of gene modification and protein engineering, in particular to a recombinant beauveria bassiana proteinase K mutant PK-M2 which has high enzyme activity, good stability and simple and convenient operation and is suitable for large-scale production and a preparation method thereof.

Background

Proteinase K (Proteinase KEC 3.4.21.64) is an important serine protease, first in 1974 in Candida albicans Linebi (C.albicans)Tritirachium album limber) Is found in the extract of (a). Proteinase K has very high enzyme activity and wide substrate specificity, and has broad-spectrum efficient cutting ability on natural protein. The enzyme preferentially cleaves carboxyl-terminal peptide bonds of aliphatic and aromatic amino acids, preferentially breaking ester and peptide bonds adjacent to the C-terminus of hydrophobic, sulfur-containing, and aromatic amino acids.

Proteinase K has wide application in biochemical experiments: in the nucleic acid extraction, dnase and rnase in the nucleic acid may be removed; in situ hybridization, the method has the function of degrading surrounding target DNA protein, can be used for processing a sample before hybridization, and improves the detection sensitivity; in the biological detection aspect, the method can be used for detecting pathogenic prion in brain tissue. In addition, the proteinase K shows good application effect in the fields of sewage treatment, industrial manufacturing, papermaking, biological processing, feed and the like.

Currently, there are two main routes for the production of proteinase K: the gene is obtained by performing fermentation, separation and purification on the Candida albicans and performing gene recombination expression. The Candida albicans grows slowly and is difficult to culture at high density, so the yield of the proteinase K is low; and the Candida albicans can also secrete other proteases, so that the difficulty of downstream separation and purification is increased, the production cost is higher, and the Candida albicans is not suitable for large-scale production. In 2008, proteinase K derived from Candida albicans successfully realizes secretory expression in a Pichia pastoris system; later, the proteinase K derived from the beauveria bassiana also successfully realizes secretory expression in a pichia pastoris system, and the activity of the recombinant beauveria bassiana proteinase K is 50% higher than that of the wild type Candida albicans proteinase K. However, in practical application, the enzyme activity stability of the recombinant Beauveria bassiana proteinase K solution is poor when the solution is stored at 4 ℃, the enzyme activity is reduced quickly, and the large-scale industrial application is limited.

Disclosure of Invention

The invention aims to solve the technical problems in the prior art and provides the recombinant beauveria bassiana proteinase K mutant PK-M2 which has high enzyme activity, good stability and simple and convenient operation and is suitable for large-scale production and the preparation method thereof.

The technical solution of the invention is as follows: a recombinant beauveria bassiana proteinase K mutant PK-M2 is characterized in that the amino acid sequence is shown as SEQ ID NO: 1 is shown.

The preparation method of the recombinant beauveria bassiana proteinase K mutant PK-M2 is characterized by comprising the following steps:

a. construction of recombinant Beauveria bassiana proteinase K mutant expression vector pPIC9K-M2

Synthesizing an M2 coding sequence shown as SEQ ID NO.2 and cloning the M2 coding sequence into a pUC57 plasmid to obtain a pUC57/M2 plasmid; amplifying a pUC57/M2 plasmid, cutting off an M2 coding sequence by using restriction enzymes EcoR I and Not I respectively, connecting with a pPIC9K vector subjected to the same double enzyme digestion, transforming a connecting product into TOP 10 competent cells, selecting and cloning, and amplifying the plasmid to obtain a recombinant beauveria bassiana proteinase K mutant vector pPIC 9K-M2;

b. transforming the recombinant beauveria bassiana proteinase K mutant expression vector pPIC9K-M2 into GS115 yeast competent cells

Carrying out enzyme digestion on the recombinant beauveria bassiana proteinase K mutant vector pPIC9K-M2 by using restriction enzyme Sal I, dissolving the recombinant beauveria bassiana proteinase K mutant vector into a linear fragment with the concentration of 2 mu g/mu L by using TE buffer solution, uniformly mixing the linear fragment of 10 mu L with GS115 yeast competent cells, transferring the mixture into an electric rotor with ice precooling, and carrying out electric shock after ice bath for 5 min; adding 1mL of ice-precooled 1M sorbitol solution into the electric rotating cup, uniformly mixing, transferring into a 1.5mL of EP tube, and standing and incubating for 5h at 30 ℃; coating each 200 mu L of the thallus suspension on an MD (MD) plate, and culturing the MD plate in an environment at 30 ℃ until a single colony appears;

c. screening for high copy number and Mut⁺Phenotypic GS115/pPIC9K-M2 Yeast Single colony

Preparing YPD screening plates with the concentration of 5g/L G418, picking 200 growing colonies on MD plates, spotting the colonies in the YPD screening plates with the concentration of 5g/L G418, screening yeast colonies with the diameter of more than 2mm, and performing PCR identification by taking the screened yeast colony DNA as template DNA;

the PCR primers are as follows:

F-AOX1：gactggttccaattgacaagc；

R-AOX1：ggcaaatggcattctgacat；

the PCR system is as follows:

reaction system	Volume (μ L)
		2×Taq Mix	10
F-AOX1	0.4
		R-AOX1	0.4
Template DNA	0.4
		ddH₂O	8.8

The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 20s, annealing at 55 ℃ for 20s, extension at 72 ℃ for 2min, and reaction for 30 cycles; extending for 5min at 72 ℃;

detecting PCR product by agarose gel electrophoresis, screening yeast single colony with PCR product of 2200bp and 1632bp bands to high copy number and Mut⁺Phenotypic GS115/pPIC 9K-M2;

d. high copy number and Mut obtained by screening⁺Phenotypic GS115/pPIC9K-M2 yeast single colonies were inoculated into 50mL YPD medium, cultured OD at 30 ℃ with shaking at 200rpm₆₀₀At 3.0, the cells were further inoculated into 50mL of BMGY medium at an inoculum size of 1%, and cultured at 30 ℃ with shaking at 200rpm until OD₆₀₀Is 2 to 6; centrifuging 1500g to collect thallus, suspending the thallus by 100mL of BMMY culture medium, continuously shaking and culturing for 120 hours at 28 ℃ and 200rpm, and supplementing methanol with the final concentration v/v of 0.5% into the fermentation liquor every 24 hours; centrifuging the culture medium to obtain a fermentation broth supernatant containing the recombinant beauveria brookfield proteinase K mutant PK-M2;

e. and (2) performing centrifugal separation and metal ion chelating affinity chromatography on the supernatant of the fermentation liquor at 8,000rpm, eluting with an elution buffer solution containing 300 mmol/L imidazole and pH 7.5, removing imidazole from the collected eluent by ultrafiltration, performing column chromatography separation on the collected eluent, decolorizing with macroporous decolorizing gel, and freeze-drying to obtain the recombinant beauveria bassiana proteinase K mutant PK-M2.

The invention starts with the reconstruction of the proteinase K molecular structure of the recombinant Beauveria bassiana to obtain a proteinase K mutant PK-M2 with improved activity and stability; an expression system is optimized, and a yeast extracellular secretion expression technology is utilized, so that the recombinant proteinase K mutant can be efficiently expressed in a large-scale fermentation manner, and the yield of the proteinase K is further improved; the method adopts a protein purification mode of high-efficiency affinity chromatography, improves the yield in the purification process of the proteinase K, and realizes the large-scale production of the proteinase K.

Drawings

FIG. 1 is a schematic diagram of the mutation sites in the amino acid sequence of the recombinant Beauveria brucei protease mutant PK-M2 according to the embodiment of the invention.

FIG. 2 is a diagram illustrating the expression result of the recombinant Beauveria bassiana proteinase K mutant PK-M2 in GS115 yeast cells detected by SDS-PAGE in the embodiment of the invention.

FIG. 3 is a schematic diagram showing the result of detecting the purity of the obtained lyophilized recombinant beauveria bassiana proteinase K mutant PK-M2 by electrophoresis in the embodiment of the invention.

FIG. 4 is a graph showing the stability results of the recombinant Beauveria bassiana proteinase K mutant PK-M2 of the embodiment of the invention.

Detailed Description

The experimental procedures, in which the specific conditions are not specified in the examples of the present invention, can be generally carried out under conventional conditions, for example, under the conditions described in molecular cloning protocols written by J.Sambruker (Sambrook), et al, or under the conditions recommended by the manufacturers. The terms and associated assay methods referred to in the present invention are explained below:

1. the protease activity determination method comprises the following steps: adopts the method for determining the protease preparation of the national standard of the people's republic of China (GB/T25327-2009).

2. Definition of enzyme activity unit: 1g of solid enzyme powder (or 1mL of liquid enzyme) hydrolyzes casein for 1min under the conditions of certain temperature and pH value to generate 1 mu g of tyrosine, namely 1 enzyme activity unit expressed by U/g (U/mL).

3. Proteinase K the activity of the protease was determined by the Folin method using a solution comprising: folin use solution (one commercial Folin solution was mixed with two portions of water, shaken up), sodium carbonate solution (42.4 g/L), trichloroacetic acid (65.4 g/L), gradient pH buffer, casein solution (10.0 g/L). The reaction process is as follows: adding 1mL enzyme solution into the test tube, performing warm bath at 40 deg.C for 2min, adding 1mL casein solution, shaking, performing warm bath at 40 deg.C for 10min, adding 2mL trichloroacetic acid solution, and shaking (adding trichloroacetic acid and casein solution into blank control). Taking out and standing for 10min, and filtering with slow qualitative filter paper. Taking 1mL of filtrate, adding 5mL of sodium carbonate solution, adding 1mL of forskolin reagent solution, developing at 40 ℃ for 20min, and measuring absorbance at 680nm wavelength by using a10 mm cuvette.

The preparation method of the recombinant beauveria bassiana proteinase K mutant PK-M2 comprises the following steps:

The amino acid sequence is shown as SEQ ID NO: 3 (SEQ ID NO: 4) of wild Beauveria brucei proteinase K is replaced by a DNA sequence consisting of Pichia preferred codons, an EcoR I enzyme cutting site is added at the 5 'end of the DNA sequence, a hexahistidine tag, a stop codon TAA and a Not I enzyme cutting site are sequentially added at the 3' end, and corresponding mutations are introduced on the basis, as shown in figure 1: H101S, R102T, a103S, K104P, S147A, R204H, K329R, N346G, V347D. Synthesizing an M2 coding sequence (Beijing Liuhua Dagen science and technology limited) shown as SEQ ID No.2 by using a chemical method, and cloning the M2 coding sequence into a pUC57 plasmid (Beijing Liuhua Dagen science and technology limited) to obtain a pUC57/M2 plasmid; amplifying a pUC57/M2 plasmid, cutting off an M2 coding sequence by using restriction enzymes EcoR I and Not I respectively, connecting with a pPIC9K vector subjected to the same double enzyme digestion, transforming a connecting product into TOP 10 competent cells, selecting and cloning, and amplifying the plasmid to obtain a recombinant beauveria bassiana proteinase K mutant vector pPIC 9K-M2;

The recombinant beauveria bassiana proteinase K mutant vector pPIC9K-M2 is cut by restriction enzyme Sal I, then dissolved to be a linear fragment with the concentration of 2 mu g/mu L by TE buffer solution (pH 8.0), 10 mu L of the linear fragment is taken to be uniformly mixed with GS115 yeast competent cells, the mixture is transferred to an ice-precooled electric rotating cup (the gap between two electrodes is 0.2 cm), and electric shock is carried out after 5min of ice bath, and the electric shock parameters are as follows: the voltage is 1.5KV, the capacitance is 25 muF, and the resistance is 250 omega; then, 1mL of ice-precooled 1M sorbitol solution is rapidly added into the electric rotating cup, mixed uniformly and then transferred into a 1.5mL EP tube, and the mixture is kept stand and incubated for 5 hours at the temperature of 30 ℃; coating the thallus suspension on an MD plate (13.4 g/L yeast basic nitrogen source; 0.4mg/L biotin; 20g/L glucose, 1.5% agar) per 200 μ L, and culturing the MD plate in an environment at 30 deg.C until single colony appears;

YPD selection plates (yeast extract 10G/L, peptone 20G/L, glucose 20G/L, 1.5% agar) at a concentration of 5G/L G418 were prepared, 200 colonies were picked up on MD plates, spotted on the YPD selection plates at the concentration of G418, and yeast colonies larger than 2mm in diameter were selected.

Respectively selecting single yeast colonies with the diameter of more than 2mm, inoculating the single yeast colonies into 3ml YPD medium, carrying out shaking culture at 30 ℃ and 200rpm for 24h, extracting genome DNA by using a yeast genome extraction kit, and carrying out PCR identification on the selected yeast colonies by using the genome DNA as template DNA.

The PCR primers are as follows:

F-AOX1：gactggttccaattgacaagc；

R-AOX1：ggcaaatggcattctgacat；

the PCR system is as follows:

d. high copy number and Mut obtained by screening⁺Phenotypic GS115/pPIC9K-M2 yeast single colonies were inoculated into 50mL YPD medium (yeast extract 10g/L, peptone 20g/L, glucose 20 g/L), OD was cultured with shaking at 200rpm at 30 ℃₆₀₀At 3.0, the cells were inoculated in 50mL of BMGY medium (yeast extract 10g/L, peptone 20g/L, YNB 13.4g/L, 0.1mol/L pH 6.0 phosphate buffer, biotin 0.4mg/L, glycerol 10 g/L) at 1% inoculum size, and cultured at 30 ℃ and 200rpm with shaking to OD₆₀₀Is 2 to 6; 1500g of the cells were collected by centrifugation, the cells were resuspended in 100mL of BMMY medium (yeast extract 10g/L, peptone 20g/L, YNB 13.4g/L, 0.1mol/L pH 6.0 phosphate buffer, biotin 0.4mg/L, methanol 5 mL/L), and the cells were cultured at 28 ℃ for 120 hours with continuous shaking at 200rpm, and methanol was added to the fermentation broth at a final concentration v/v of 0.5% every 24 hours; centrifuging the culture medium to obtain a fermentation broth supernatant containing the recombinant beauveria brookfield proteinase K mutant PK-M2, and storing at-70 ℃;

for example, in the process of enlarged culture in a fermentation tank, the temperature in the thallus growth stage is controlled at 28 ℃, the temperature in the induction expression stage is controlled at 25 ℃, and the pH value in the whole fermentation process is controlled at 7.0. The methanol induction time is 120 hours, and the dissolved oxygen content is controlled at 35%. The supplement of methanol as an inducer is coupled with dissolved oxygen, when the dissolved oxygen is higher than 35%, the supplement of methanol is carried out, and the expression quantity of the recombinant beauveria bassiana proteinase K mutant PK-M2 can reach 2g/L fermentation liquor.

The yield is superior to that of the existing protease K industrial production method (0.3-0.5 g/L fermentation liquor), so that the high yield of later purification and freeze-drying becomes possible, and conditions are provided for large-scale industrial production.

e. And (2) performing centrifugal separation and metal ion chelation affinity chromatography on the supernatant of the fermentation liquor at 8,000rpm, eluting with an elution buffer solution containing 300 mmol/L imidazole and pH 7.5, removing imidazole from the collected eluent by ultrafiltration, performing column chromatography separation and macroporous decolorizing gel, and lyophilizing to obtain the recombinant beauveria bassiana proteinase K mutant PK-M2, wherein the comprehensive yield is improved by 80% compared with the prior art.

The obtained recombinant beauveria broomrape proteinase K mutant PK-M2 has an amino acid sequence shown in SEQ ID NO: 1, namely, the mutation of His at the 101 th site of an amino acid sequence into Ser, the mutation of Arg at the 102 th site into Thr, the mutation of Ala at the 103 th site into Ser, the mutation of Lys at the 104 th site into Pro, the mutation of Ser at the 147 th site into Ala, the mutation of Arg at the 204 th site into His, the mutation of Lys at the 329 th site into Arg, the mutation of Asn at the 346 th site into Gly, and the mutation of Val at the 347 th site into Asp; the "position 101" … … "position 347" does not indicate an absolute position from the N-terminus but indicates a relative position compared with the amino acid sequence of SEQ ID NO. 3.

Experiment:

1. the expression of the recombinant beauveria bassiana proteinase K mutant PK-M2 in yeast cells GS115/pPIC9K-M2 is detected by SDS-PAGE:

the SDS-PAGE formulation was as follows:

	12% separation gel (mL)	5% concentrated glue (mL)
			Ultrapure water	3.3	3.4
30% Polyacrylamide solution (29: 1)	4.0	0.83
			1.5mol/L Tris solution (pH 8.8)	2.5	0.631.5 mol/L Tris solution (pH 6.8)
10% SDS	0.1	0.05
			10% ammonium persulfate solution	0.1	0.05
TEMED	0.004	0.005

Adding solution components required by 12% of separation gel into a small beaker in sequence, filling the mixture into a gap of a pre-assembled double-layer glass plate, and standing the mixture at room temperature for more than 20min until the gel polymerization is complete. Then adding 5% of solution components required by the concentrated gel into a small beaker, filling the solution components into a gap above the coagulated separation gel between double-layer glass plates, and standing at room temperature for more than 20min until the gel is completely polymerized.

2 × SDS protein loading buffer formulation: 1.5M Tris-HCl pH 6.81 ml, SDS 0.4g, bromophenol blue 0.02g, glycerin 4ml, adding double distilled water to constant volume to 10 ml.

Taking out the supernatant of the fermentation liquor of GS115/pPIC9K-M2 from-70 ℃, melting on ice, mixing 10 mu L of the supernatant with equal volume of 2 xSDS protein loading buffer, treating for 10min by a boiling water bath, centrifuging for 1min at 12000g, sucking the supernatant and adding the supernatant into the sample pore channel of the gel prepared above, wherein the loading amount is 10 mu L. Simultaneously adding protein molecular weight standard, and performing constant voltage electrophoresis at 120V for 1 h.

The gel was unloaded. A staining solution and a destaining solution are prepared according to the following formulas, and Coomassie brilliant blue staining is carried out to observe a target protein band in a sample.

The dyeing liquid formula comprises: 650ml of double distilled water; 250ml of isopropanol; acetic acid 100 ml; 1g of Coomassie Brilliant blue R-250.

The formula of the destaining solution is as follows: 850ml of double distilled water; 50ml of ethanol; acetic acid 100 ml.

As shown in FIG. 2, a clear target protein band with a molecular weight of 29kD was observed in the supernatant of the fermentation broth under the shake flask condition. Among them, 3 visible protein bands of the protein molecular weight standard (MAKER) respectively represent 48kD, 35kD and 25 kD. The result shows that the recombinant beauveria broomrape proteinase K mutant PK-M2 can be effectively expressed in yeast cells.

2. Enzyme activity determination of recombinant beauveria bassiana proteinase K mutant PK-M2

By adopting a method for determining a national standard protease preparation (GB/T25327-2009) of the people's republic of China, the protease ProK and the protease K enzyme activity of the recombinant beauveria bassiana protease K mutant PK-M1 freeze-dried powder prepared by the embodiment of the invention are respectively detected under the condition of pH 7.5.

The protease ProK is lyophilized powder obtained by recombining, cloning, purifying and lyophilizing a DNA coding sequence ProK (SEQ ID NO. 4) of wild type beauveria bassiana protease K according to the preparation method of the embodiment of the invention.

The results are shown below:

	PK-M2	ProK
			enzyme activity (U/mg)	63.0	30.3

Therefore, the activity of the recombinant beauveria bassiana proteinase K mutant PK-M2 prepared by the invention is obviously superior to that of the wild proteinase K.

3. And detecting the purity of the purified and freeze-dried recombinant beauveria bassiana proteinase K mutant PK-M2 by using SDS-PAGE.

The results are shown in FIG. 3. A clear band of the protein of interest with a molecular weight of 29kD was observed. Among them, 3 visible protein bands of the protein molecular weight standard (MAKER) respectively represent 48kD, 35kD and 25 kD. The results show that the purified lyophilized recombinant beauveria brookfield proteinase K mutant PK-M2 has very high purity (99%).

4. Stability of recombinant beauveria broomrape proteinase K mutant PK-M2

The enzyme activity stability of the recombinant beauveria bassiana proteinase K mutant PK-M2 stored at-20 ℃ in a solution form and the enzyme activity stability of the recombinant beauveria bassiana proteinase K mutant PK-M2 stored at 4 ℃ in a freeze-dried powder form are detected.

The results are shown in FIG. 4. The enzyme activity of the recombinant beauveria bassiana proteinase K mutant PK-M2 freeze-dried powder is basically kept unchanged within one year; the solution form of the recombinant Beauveria bassiana proteinase K mutant PK-M2 also keeps more than 95% of enzyme activity after one year, which shows that the recombinant Beauveria bassiana proteinase K mutant PK-M2 prepared by the method has extremely high stability.

Sequence listing

<110> Dalian Bogelin Biotech Ltd

<120> recombinant beauveria bassiana proteinase K mutant PK-M2 and preparation method thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 365

<212> PRT

<213> Artificial sequence (Proteinase K)

<220>

<221> VARIANT

<222> (1)..(365)

<400> 1

Ala Pro Val Val Glu Pro Ala Pro Leu Ile Glu Ala Arg Gly Gln Thr

1 5 10 15

Ile Ala Gly Asn Tyr Ile Val Lys Leu Lys Asp Thr Ala Thr Met Ser

20 25 30

Ile Met Asp Ala Ala Ser Lys Val Ser Lys Pro Lys Phe Val Tyr Thr

35 40 45

Asp Val Phe Pro Gly Tyr Ala Ala Ser Leu Ser Pro Glu Glu Val Glu

50 55 60

Arg Leu Arg His Asp Pro Asn Val Glu Ser Ile Glu Gln Asp Ala Ile

65 70 75 80

Val Ser Ile Asn Ala Ile Val Arg Gln Pro Gly Ala Pro Trp Gly Leu

85 90 95

Gly Arg Ile Ser Ser Thr Ser Pro Gly Asp Thr Thr Tyr Val Tyr Asp

100 105 110

Ser Thr Ala Gly Gln Gly Ala Cys Val Tyr Val Ile Asp Thr Gly Val

115 120 125

Glu Ala Thr His Pro Glu Phe Glu Gly Arg Ala Lys Gln Val Lys Thr

130 135 140

Phe Val Ala Gly Ser Lys Asp Gly His Gly His Gly Thr His Cys Ala

145 150 155 160

Gly Thr Ile Gly Ser Lys Thr Tyr Gly Val Ala Lys Lys Val Ser Ile

165 170 175

Phe Gly Val Lys Val Leu Glu Asp Ser Gly Ser Gly Ser Leu Ser Gly

180 185 190

Val Ile Ala Gly Met Asp Tyr Val Ala Gln Asp His Arg Thr Arg Ser

195 200 205

Glu Cys Thr Lys Gly Ala Ile Ala Ser Met Ser Leu Gly Gly Gly Tyr

210 215 220

Ser Ala Ala Val Asn Lys Ala Ala Ala Asn Leu Gln Ala Ser Gly Val

225 230 235 240

Phe Val Ala Val Ala Ala Gly Asn Asp Asn Arg Asp Ala Ala Asn Thr

245 250 255

Ser Pro Ala Ser Glu Pro Ser Val Cys Thr Val Gly Ala Thr Asp Ser

260 265 270

Ser Asp Arg Arg Ser Ser Phe Ser Asn Tyr Gly Lys Val Leu Asp Ile

275 280 285

Phe Ala Pro Gly Thr Gly Ile Leu Ser Thr Trp Ile Asn Gly Gly Thr

290 295 300

Asn Thr Ile Ser Gly Thr Ser Met Ala Thr Pro His Ile Ala Gly Leu

305 310 315 320

Gly Ala Tyr Leu Trp Val Leu Gly Arg Gly Thr Ala Gly Asn Leu Cys

325 330 335

Lys Val Ile Gln Asp Leu Ser Thr Lys Gly Asp Leu Thr Gly Val Pro

340 345 350

Ser Gly Thr Val Asn Tyr Leu Ala Phe Asn Gly Ala Thr

355 360 365

<210> 2

<211> 1130

<212> DNA

<213> Artificial sequence (Proteinase K)

<220>

<221> exon

<222> (1 )..( 365)

<400> 2

gaattcgctc cagttgttga accagctcca ttgattgaag ctagaggcca aactattgct 60

ggtaactaca tcgttaagtt gaaggacacc gccactatgt ctattatgga tgctgcttcc 120

aaggtttcta agccaaagtt tgtctacact gacgtttttc caggttacgc tgcttctttg 180

tctccagaag aggttgaaag attgcgtcat gatccaaacg ttgagtctat tgaacaagac 240

gctatagtct ccattaacgc cattgtcaga caaccaggtg ctccatgggg tttgggtaga 300

atttcttcta cttctccagg tgatactact tacgtctacg attctactgc tggtcaaggt 360

gcttgtgttt acgttattga caccggtgtt gaagctactc atccagaatt tgaaggtaga 420

gccaagcaag ttaagacttt cgttgctggt tctaaggatg gtcatggtca tggtactcat 480

tgtgctggta ctattggttc taagacttac ggtgttgcta agaaggtgtc tattttcggt 540

gtcaaggttt tggaagattc tggttctggt tctttgtctg gtgttattgc tggtatggat 600

tacgttgctc aggatcatag aactcgttcc gaatgtacta agggtgctat tgcttctatg 660

tctttgggtg gtggttactc tgctgctgtt aacaaggctg ctgctaactt gcaagcttct 720

ggtgtttttg ttgctgttgc tgctggtaac gataacagag atgctgctaa cacttctcca 780

gcttctgaac catctgtttg tactgttggt gctactgatt cttctgacag aagatcctcc 840

ttttctaact acggtaaggt cttggatatt tttgctccag gtaccggtat tttgtctact 900

tggatcaacg gtggtactaa cactatttct ggtacctcta tggctactcc acatattgct 960

ggtttgggtg cttacttgtg ggttttgggt agaggtactg ctggtaactt gtgcaaggtt 1020

attcaagact tgtccaccaa gggtgatttg actggtgttc catctggtac tgttaactac 1080

ttggctttta acggtgctac tcaccatcac caccatcact aagcggccgc 1130

<210> 3

<211> 365

<212> PRT

<213> Artificial sequence (Proteinase K)

<220>

<221> CONFLICT

<222> (1)..(365)

<400> 3

Ala Pro Val Val Glu Pro Ala Pro Leu Ile Glu Ala Arg Gly Gln Thr

1 5 10 15

Ile Ala Gly Asn Tyr Ile Val Lys Leu Lys Asp Thr Ala Thr Met Ser

20 25 30

Ile Met Asp Ala Ala Ser Lys Val Ser Lys Pro Lys Phe Val Tyr Thr

35 40 45

Asp Val Phe Pro Gly Tyr Ala Ala Ser Leu Ser Pro Glu Glu Val Glu

50 55 60

Arg Leu Arg His Asp Pro Asn Val Glu Ser Ile Glu Gln Asp Ala Ile

65 70 75 80

Val Ser Ile Asn Ala Ile Val Arg Gln Pro Gly Ala Pro Trp Gly Leu

85 90 95

Gly Arg Ile Ser His Arg Ala Lys Gly Asp Thr Thr Tyr Val Tyr Asp

100 105 110

Ser Thr Ala Gly Gln Gly Ala Cys Val Tyr Val Ile Asp Thr Gly Val

115 120 125

Glu Ala Thr His Pro Glu Phe Glu Gly Arg Ala Lys Gln Val Lys Thr

130 135 140

Phe Val Ser Gly Ser Lys Asp Gly His Gly His Gly Thr His Cys Ala

145 150 155 160

Gly Thr Ile Gly Ser Lys Thr Tyr Gly Val Ala Lys Lys Val Ser Ile

165 170 175

Phe Gly Val Lys Val Leu Glu Asp Ser Gly Ser Gly Ser Leu Ser Gly

180 185 190

Val Ile Ala Gly Met Asp Tyr Val Ala Gln Asp Arg Arg Thr Arg Ser

195 200 205

Glu Cys Thr Lys Gly Ala Ile Ala Ser Met Ser Leu Gly Gly Gly Tyr

210 215 220

Ser Ala Ala Val Asn Lys Ala Ala Ala Asn Leu Gln Ala Ser Gly Val

225 230 235 240

Phe Val Ala Val Ala Ala Gly Asn Asp Asn Arg Asp Ala Ala Asn Thr

245 250 255

Ser Pro Ala Ser Glu Pro Ser Val Cys Thr Val Gly Ala Thr Asp Ser

260 265 270

Ser Asp Arg Arg Ser Ser Phe Ser Asn Tyr Gly Lys Val Leu Asp Ile

275 280 285

Phe Ala Pro Gly Thr Gly Ile Leu Ser Thr Trp Ile Asn Gly Gly Thr

290 295 300

Asn Thr Ile Ser Gly Thr Ser Met Ala Thr Pro His Ile Ala Gly Leu

305 310 315 320

Gly Ala Tyr Leu Trp Val Leu Gly Lys Gly Thr Ala Gly Asn Leu Cys

325 330 335

Lys Val Ile Gln Asp Leu Ser Thr Lys Asn Val Leu Thr Gly Val Pro

340 345 350

Ser Gly Thr Val Asn Tyr Leu Ala Phe Asn Gly Ala Thr

355 360 365

<210> 4

<211> 1130

<212> DNA

<213> Artificial sequence (Proteinase K)

<220>

<221> exon

<222> (1 )..( 1130)

<400> 4

gaattcgctc cagttgttga accagctcca ttgattgaag ctagaggcca aactattgct 60

ggtaactaca tcgttaagtt gaaggacacc gccactatgt ctattatgga tgctgcttcc 120

aaggtttcta agccaaagtt tgtctacact gacgtttttc caggttacgc tgcttctttg 180

tctccagaag aggttgaaag attgcgtcat gatccaaacg ttgagtctat tgaacaagac 240

gctatagtct ccattaacgc cattgtcaga caaccaggtg ctccatgggg tttgggtaga 300

atttctcata gagccaaggg tgatactact tacgtctacg attctactgc tggtcaaggt 360

gcttgtgttt acgttattga caccggtgtt gaagctactc atccagaatt tgaaggtaga 420

gccaagcaag ttaagacttt cgtttccggt tctaaggatg gtcatggtca tggtactcat 480

tgtgctggta ctattggttc taagacttac ggtgttgcta agaaggtgtc tattttcggt 540

gtcaaggttt tggaagattc tggttctggt tctttgtctg gtgttattgc tggtatggat 600

tacgttgctc aggatagaag aactcgttcc gaatgtacta agggtgctat tgcttctatg 660

tctttgggtg gtggttactc tgctgctgtt aacaaggctg ctgctaactt gcaagcttct 720

ggtgtttttg ttgctgttgc tgctggtaac gataacagag atgctgctaa cacttctcca 780

gcttctgaac catctgtttg tactgttggt gctactgatt cttctgacag aagatcctcc 840

ttttctaact acggtaaggt cttggatatt tttgctccag gtaccggtat tttgtctact 900

tggatcaacg gtggtactaa cactatttct ggtacctcta tggctactcc acatattgct 960

ggtttgggtg cttacttgtg ggttttgggt aagggtactg ctggtaactt gtgcaaggtt 1020

attcaagact tgtccaccaa gaacgttttg actggtgttc catctggtac tgttaactac 1080

ttggctttta acggtgctac tcaccatcac caccatcact aagcggccgc 1130

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Proteinase K)

<220>

<221> exon

<222> (1 )..( 21)

<223> primer

<400> 5

gactggttcc aattgacaag c 21

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Proteinase K)

<220>

<221> exon

<222> (1 )..( 20)

<223> primer

<400> 6

ggcaaatggc attctgacat 20

Claims

1. A recombinant Beauveria bassiana protease (b.brucei)Beaveria brongniartii) K mutant PK-M2, characterized in that the amino acid sequence is as shown in SEQ ID NO: 1 is shown.

2. A method for preparing the recombinant beauveria brookfield proteinase K mutant PK-M2 according to claim 1, which is characterized by the following steps:

Synthesizing an M2 coding sequence shown as SEQ ID NO.2 and cloning the M2 coding sequence into a pUC57 plasmid to obtain a pUC57/M2 plasmid; the pUC57/M2 plasmid was amplified with restriction enzymes, respectivelyEcoR I、Not ICutting an M2 coding sequence, connecting with a pPIC9K vector subjected to the same double enzyme digestion, transforming a connecting product into TOP 10 competent cells, selecting and cloning, and amplifying plasmids to obtain a recombinant Beauveria bassiana proteinase K mutant expression vector pPIC 9K-M2;

Using restriction endonucleasesSal IThe recombinant beauveria bassiana proteinase K mutant expression vector pPIC9K-M2 is subjected to enzyme digestion, then TE buffer solution is used for dissolving the recombinant beauveria bassiana proteinase K mutant expression vector pPIC9K-M2 to obtain a linear fragment with the concentration of 2 mu g/mu L, and 1 is takenUniformly mixing the 0 mu L linear segment with GS115 yeast competent cells, transferring the mixture into an electric rotor cup precooled by ice, and carrying out electric shock after ice bath for 5 min; adding 1mL of ice-precooled 1M sorbitol solution into the electric rotating cup, uniformly mixing, transferring into a 1.5mL of EP tube, and standing and incubating for 5h at 30 ℃; coating each 200 mu L of the thallus suspension on an MD (MD) plate, and culturing the MD plate in an environment at 30 ℃ until a single colony appears;

the PCR primers are as follows:

F-AOX1：gactggttccaattgacaagc；

R-AOX1：ggcaaatggcattctgacat；

the PCR system is as follows: