CN106566840A - Improved pichia pastoris protein expression vector and construction method thereof - Google Patents

Abstract

The invention discloses an improved pichia pastoris protein expression vector and a construction method thereof. A pair of primers pPink alpha-HCM-Fse1-F and pPink alpha-HCM-BamH1-R are designed by selecting a section of sequence of about 300bp according to a pPink alpha-HC sequence of a vector; new unique enzyme cutting sites Sal1, Pst1, PspOM, Nco1, Apa1 and EcoR1 are inserted in sticky end enzymes Fse1 and BamH1 at two ends of the pair of primers; and 6 His tags CATCATCATCATCATCAT are connected to the back ends of the enzyme cutting sites. According to the improved pichia pastoris protein expression vector and the construction method, the number of the enzyme cutting sites of the sticky ends is large, the universality of an endonuclease is high, the price is low, the interval between the enzyme cutting sites is sufficient, and protective bases are suitably provided for double enzyme cutting; and the 6 His tags are further inserted, so that an obtained target protein can be subjected to Western blot verification conveniently.

Description

A kind of pichia pastoris protein expression vector of improvement and its construction method

Technical field

The invention belongs to gene engineering technology field, relates in particular to a kind of pichia pastoris protein expression vector of improvement And its construction method.

Background technology

PPink α-HC be in pichia pastoris protein expression system commonly use carrier, but its multiple clone site only have Stu1, Kpn1, Fse1, Nae1 and Swa1, not only selectable negligible amounts, and containing the relatively low flat end of specificity joint efficiency Restriction enzyme site.These restricted enzyme are less common, and many laboratorys need to separately be bought, and the price corresponding to unit enzyme activity Also costly.Additionally, these restriction enzyme site intervals are too near, shortage is effectively protected the efficiency that base ensures double digestion.

The content of the invention

The purpose of the present invention is for multiple clone site quantity in existing pichia pastoris protein expression vector pPink α-HC The deficiency such as less, many, the used enzyme poor universalities of flat end site, price be high and restriction enzyme site is spaced closely together, there is provided Yi Zhongduo The enzyme versatility that cloning site is more, flat end site is few, used is high, the pichia pastoris protein expression of the high improvement of joint efficiency Carrier and its construction method.

The pichia pastoris protein expression vector of the improvement of the present invention, it builds by the following method, including following step Suddenly：With carrier pPink α-HC as template, with forward primer pPink α-HCM-Fse1-F and downstream primer pPink α-HCM- BamH1-R enters performing PCR amplification as primer, and amplified production Fse1 and BamH1 double digestions obtain the product after double digestion, order Entitled intron；By carrier pPink α-HC Fse1 and BamH1 double digestions, the product after double digestion is obtained, be named as enzyme action load Body, by intron and the connection of enzyme action carrier the pichia pastoris protein expression vector of improvement is obtained；

The nucleotides sequence of described forward primer pPink α-HCM-Fse1-F is classified as：

5’-GTAGGCCGGCCCTGCAGTCGACGGGCCCATGGAATTCATCATCATCATCATCATTGATTTAAATAC AGGCCCC-3’；(as shown in SEQ ID NO.1).

The nucleotides sequence of described downstream primer pPink α-HCM-BamH1-R is classified as:5’-CCGCGGATCCAGCTTGCA- 3 ' (as shown in SEQ ID NO.2)..

The present invention selects the sequential design pair of primers of wherein one section about 300bp according to carrier pPink α-HC sequences PPink α-HCM-Fse1-F and pPink α-HCM-BamH1-R, insert in sticky end the enzyme Fse1 and BamH1 at its two New unique restriction enzyme site Sal1, Pst1, PspOM, Nco1, Apa1, EcoR1, and 6 His labels are connected later CATCATCATCATCATCAT, the restriction enzyme site quantity for realizing sticky end is more, restriction endonuclease versatility is good, cheap, Interval between restriction enzyme site is abundant, be suitably for double digestion provides protection base, while 6 His labels are also inserted, with convenient Target protein to obtaining does Western blot checkings.

Description of the drawings：

Fig. 1 is single endonuclease digestion inspection figure, wherein 1 is pPink α-HC (Fse1 enzyme action), 2 is new support pPink α-HCM (EcoR1 enzyme action)；

Fig. 2 is new support pPink α-HCM sequencing results (reverse complementary sequence)；

Fig. 3 is the multiple clone site schematic diagram of former pPink α-HC；

Fig. 4 is the multiple clone site schematic diagram of new support pPink α-HCM, between the Fse1 and Swa1 after 1214bp For the restriction enzyme site (yellow background) for newly increasing, green background is 6His labels；

Fig. 5 is pPink α-HCM::The Pichia sp. of CsGlu13570 conversions；

Fig. 6 is to be checked in yeast to express in Western blot with the 6His labels in new support pPink α-HCM CsGlu13570 albumen.

Specific embodiment：

Following examples are that the present invention is further illustrated, rather than limitation of the present invention.

Embodiment 1：

A) PCR of Insert Fragment：

Drawn as template, with upstream with carrier pPink α-HC (being purchased from Invitrogen (Life Technologies) company) Thing pPink α-HCM-Fse1-F and downstream primer pPink α-HCM-BamH1-R are primer.PCR amplifications are with Takara's PrimeSTAR Max Premix (2 ×) 20 μ l, forward primer pPink α-HCM-Fse1-F and downstream primer pPink α-HCM- BamH1-R is each 10 μM, the μ l of carrier pPink α-HC templates 0.1, plus distilled water supplies 40 μ l.PCR amplification programs are 98 DEG C of 30sec, 1 circulation；98 DEG C of 15sec, 45 DEG C of 15sec, 72 DEG C of 10sec, 1 circulation；98 DEG C of 15sec, 72 DEG C of 10sec, 32 circulations；72 DEG C 10sec, 1 circulation, obtains the PCR primer of Insert Fragment.

Forward primer pPink α-HCM-Fse1-F：

5’-GTAGGCCGGCCCTGCAGTCGACGGGCCCATGGAATTCATCATCATCATCATCATTGATTTAAATAC AGGCCCC-3’；

Downstream primer pPink α-HCM-BamH1-R:5’-CCGCGGATCCAGCTTGCA-3’.

B) double digestion of Insert Fragment：

By the PCR primer of Insert Fragment Jing after agarose gel electrophoresiies reclaim target stripe, with the restricted enzyme of NEB Do enzyme action.The μ l of reaction system 40, wherein the μ l of Cutsmart buffer 4, the μ l of PCR primer 15, each 0.3 μ l of Fse1 and BamH1, enzyme It is recovered by filtration after cutting two hours, obtains the intron after double digestion.

C) double digestion of carrier：

Carrier pPink α-HC are done into double digestion, the μ l of reaction system 40, wherein the μ l of Cutsmart buffer 4, pPink α- The each 0.3 μ l of the μ l of HC plasmids 15, Fse1 and BamH1, enzyme action is tapped rubber recovery after two hours, obtains the carrier after double digestion.

D) connection conversion：

Carrier after intron and double digestion after double digestion is connected with the T4 ligases of Promega, in 10 μ l systems Containing the μ l of intron 4, the μ l of carrier 1.Ice bath half an hour after DH5a escherichia coli is transformed into after connection, LB culture medium is added after 42 DEG C of heat shocks The 230rpm cultures 1h in 37 DEG C of shaking tables, takes the culture plate that 200 μ l apply ammonia benzyl resistance, positive monoclonal is chosen after 12 hours and send survey mirror It is fixed, thus obtain new support pPink α-HCM (its be by double digestion after intron and the carrier after double digestion be formed by connecting).

E) result verification：

The result that new support pPink α-HCM carry out enzyme action is normal (Fig. 1), and sequence verification result is correct (Fig. 2).

Carrier pPink α-HC (Fig. 3) relatively shows with the multiple clone site region of new support pPink α-HCM (Fig. 4) Between the new multiple clone site for introducing and new mutual alignment relation of the multiple clone site on new support pPink α-HC.

F) application example

Glycosidase genes CsGlu13570 (the NCBI accession number of Folium Camelliae sinensis is screened from transcript profile data base： GBBZ01013516.1), restriction endonuclease when expressing in yeast, needed for the upper limited multiple clone site of old carrier pPink α-HC Comparison is uncommon and expensive, and it is flat terminal enzyme to have several, and joint efficiency is low.And introduce in new support pPink α-HCM Sal1 and EcoR1 are conventional restriction enzyme sites.

Using Tea gene group DNA as template, glycosidase genes CsGlu13570 is obtained by PCR amplifications, two before and after it End respectively have restriction enzyme site Sal1 and EcoR1, PCR primer Jing after Sal1 and EcoR1 double digestions with also pass through Sal1 and The new support pPink α-HCM connections of EcoR1 double digestions, connection product (pPink α-HCM::CsGlu13570) conversion enters ferment Mother, experimental result shows that the yeast after conversion grows fine (Fig. 5, shown in 2 circles), CsGlu13570 albumen Jing induction tables Up to after purification, Jing Western blot detections find, by the 6His labels of insertion in new support pPink α-HCM in Western The successful expression (Fig. 6) of recombiant protein has been arrived in inspection in blot.

Sequence table

<110>South China Botanical Garden Chinese Academy of Sciences

<120>A kind of pichia pastoris protein expression vector of improvement and its construction method

<160>2

<210>1

<211>73

<212>DNA

<213>Artificial sequence

<400>1

GTAGGCCGGC CCTGCAGTCG ACGGGCCCAT GGAATTCATC ATCATCATCA TCATTGATTT 60

AAATACAGGC CCC 73

<210>2

<211>18

<212>DNA

<213>Artificial sequence

<400>2

CCGCGGATCC AGCTTGCA 18

Claims (2)

1. the construction method of the pichia pastoris protein expression vector of a kind of improvement, it is characterised in that comprise the following steps：With carrier PPink α-HC are template, using forward primer pPink α-HCM-Fse1-F and downstream primer pPink α-HCM-BamH1-R as drawing Thing enters performing PCR amplification, and amplified production Fse1 and BamH1 double digestions obtain the product after double digestion, are named as intron；Will Carrier pPink α-HC Fse1 and BamH1 double digestions, obtain the product after double digestion, are named as enzyme action carrier, by intron and The connection of enzyme action carrier obtains the pichia pastoris protein expression vector of improvement；

The nucleotides sequence of described forward primer pPink α-HCM-Fse1-F is classified as：

5’-GTAGGCCGGCCCTGCAGTCGACGGGCCCATGGAATTCATCATCATCATCATCATTGATTTAAATACAGGC CCC-3’；

The nucleotides sequence of described downstream primer pPink α-HCM-BamH1-R is classified as:5’-CCGCGGATCCAGCTTGCA-3’.

2. a kind of construction method according to described in claim 1 builds the pichia pastoris protein expression vector of the improvement for obtaining.