CN103667453A

CN103667453A - Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes

Info

Publication number: CN103667453A
Application number: CN201310577447.0A
Authority: CN
Inventors: 周晓犊; 徐建成; 王淑一; 孙翠莲
Original assignee: FUZHOU AIDIKANG MEDICAL INSPECTION CO LTD
Current assignee: Fuzhou Aidikang Medical Laboratory Co ltd
Priority date: 2013-11-18
Filing date: 2013-11-18
Publication date: 2014-03-26
Anticipated expiration: 2033-11-18
Also published as: CN103667453B

Abstract

The invention discloses a method for detecting the relative expression quantity of 4 fusion genes belonging to 11q23/MLL series, and primers and a probe for detecting the relative expression quantity of 4 fusion genes of 16 fusion types in total belonging to 11q23/MLL series. Through test, the primers and the probe are good in specificity, high in sensitivity and simple and convenient to operate, the data which is obtained on the basis of double-standard curve method of house-keeping gene and target gene by utilizing a real-time fluorescence quantification PCR method of the Taqman probe can be used for detecting the relative expression level of the fusion genes belonging to 11q23/MLL series in patients with ALL (Acute Lymphoblastic Leukemia), AML (Acute Myeloblastic Leukemia) and MDS (Myelodysplastic Syndrome), the high-risk groups can be accurately screened, the detection time can be effectively saved, and the detection precision can be enhanced.

Description

Detect method, primer and the probe of 11q23/MLL fusion gene relative expression quantity

Technical field

The invention belongs to life science and biological technical field, particularly a kind of 4 kinds of fusion genes for detection of 11q23/MLL series amount to primer, probe and the detection method of the relative expression quantity of 16 kinds of fused type.

Background technology

MLL (mixed lineage leukemia, MLL) gene is positioned on No. 11 long-armed 2 district's 3 bands (11q23) of karyomit(e), one of gene often being involved in Hematological Malignancies, so the abnormal own important factor being thought widely acute leukemia prognosis of 11q23/MLL.Up to now, be numerously positioned at partner's gene on karyomit(e) 11q23 oneself is determined, formed nearly more than 70 fusion genes of planting, wherein have at least 50 on molecular level, to be cloned.Nearest research shows 11q23/MLL acute leukemia (11q23/MLL acute leukemia, 11q23/MLL AL) different partner's gene, leukemia cell's classification, patient's age and therapeutic strategy prognosis difference are very large, and how not good these patients are to conventional chemotherapy curative effect, the survival rate of 3 years is less than 10%.The scientists Molecular pathogenesis that oneself has to 11q23/MLL acute leukemia understanding is limited, adopts existing methods for the treatment of can not cure 11q23/MLL leukemia, so this disease is an also leukemia hypotype to be captured.In addition, the small residual of fusion gene is the major cause of leukemia relapse, thereby is badly in need of a kind of hypersensitivity, high specific, high automation degree, pollutes the method controlled well to residual detection of the relevant fusion gene mRNA of 11q23/MLL.

MLL-AF4, MLL-AF6, MLL-AF9, MLL-ENL fusion gene are modal 4 kinds of fused type in MLL rearrangement clinically, wherein MLL-AF4 and MLL-AF6 have more in present children acute lymphoblastic leukaemia (ALL) patient, comparatively rare in acute myeloblastic leukemia (AML) patient; And MLL-AF9 has more in present children and adult AML patient; MLL-ENL occurs at children and adult AML and ALL patient.MLL-AF4 is by t (4; 11) (q21; Q23) form, by 8 exons of mll gene of upstream and 4 exons and 7 exons of the AF4 gene in 10 exons and downstream, merged respectively, thus corresponding generation MLLex8-AF4ex4 MLLex10-AF4ex4 MLLex8-AF4ex7 tetra-kinds of common fused type of MLLex10-AF4ex7; MLL-AF6 is by t (6; 11) (q27; Q23) form, 8 exons of mll gene and 2 exons of 10 exons and downstream AF6 gene by upstream merge respectively, thus corresponding generation MLLex8-AF6ex2 two kinds of common fused type of MLLex10-AF6ex2; MLL-AF9 is by t (9; 11) (p21 – 22; Q23) form, 8 exons of mll gene and 4 exons, 5 exons and 9 exons of 10 exons and downstream AF9 gene by upstream merge respectively, thus corresponding generation MLLex8-AF9ex4 MLLex8-AF9ex5 MLLex8-AF9ex9 MLLex10-AF9ex4 MLLex10-AF9ex5 MLLex10-AF9ex9 totally six kinds of common gene fusion types; MLL-ENL is by t (11; 19) (q23; P13.3) form, 8 exons of mll gene and 2 exons and 7 exons of 10 exons and downstream ENL gene by upstream merge respectively, thus corresponding generation MLLex8-ENLex2 MLLex8-ENLex7 MLLex10-ENLex2 tetra-kinds of common fused type of MLLex10-ENLex7.

Detecting at present 11q23/MLL series fusion gene expression level has a variety of methods, respectively has its relative merits.Wherein, 1) traditional dyeing body banding technique visual result, but need good cell metacinesis phase and chromosome morphology, for repetition, disappearance or the inversion of karyomit(e) small segment, small transposition all cannot interpretation, and can not detect series connection and repeat the abnormal of dup11q23.2) fluorescence in situ hybridization technique (fluorescence in situhybridization, FISH), although detection sensitivity is higher, can only know that common chromosome abnormalty detects, and is not suitable for rare and unknown abnormal detection for oneself.3) multiplex nested RT-PCR uses to be widely used in the most the method that detects all kinds of fusion genes now, can detect on a large scale multiple common MLL fusion gene, but can only provide qualitative or rough quantitative result (sxemiquantitative), and sensitivity is limited by methodology, for small residual detection, have undetected possibility, the more important thing is, nido RT-PCR has relatively high expectations for experimental situation, easily produce serious crossed contamination, cause the appearance of false positive results.

Real-Time Fluorescent Quantitative PCR Technique (real time quantitative PCR, RQ-PCR) has higher sensitivity and specificity, and can detect in real time amplified production.Common Real-Time Fluorescent Quantitative PCR Technique has SYBR Green I dye method, two probe hybridization methods and Taqman probe method etc.Wherein SYBR Green I, owing to adopting unsaturation dyestuff, can both produce non-specific binding for any DNA double spirane structure, must judge its specificity by observing solubility curve, thereby specificity is undesirable; Two probe hybridization methods are owing to having used 2 probes, although specificity is very good, cost is too expensive.And Taqman probe method, adopt 1 Taqman probe, utilize reporter group, the interaction of quenching group, both guaranteed the specificity of reaction, well controlled cost simultaneously, this method comprehensive organism is learned, zymetology and fluorescence chemical are in one, from amplification, to interpretation of result, all under PCR reaction tubes closed state, carry out, solve PCR product pollution and caused false-positive problem, also improved susceptibility simultaneously, its result represents with copy number, realized the accurate quantitative analysis to PCR product, be easy to unified standard, compare with qualitative PCR technology, there is specific degree good, highly sensitive, linear relationship is good, simple to operate, level of automation is high, anti-pollution, there are the larger advantages such as linearity range.For great amount of samples, especially high risk population examination there is great realistic meaning.

Summary of the invention

In view of detecting the deficiency of 11q23/MLL series fusion gene mRNA relative expression level in prior art, the present invention has designed detection internal reference/primer, probe sequence for goal gene, and 4 kinds of fusion genes that adopt fluorescent quantitative PCR technique to detect 11q23/MLL amount to the relative expression quantity of 16 kinds of fused type.By adjusting primer and concentration and probe concentration and ratio, the reaction system of optimize PCR and reaction conditions, can make amplification efficiency and speed all reach best.

The oligonucleotide that an object of the present invention is to provide a kind of MLL-AF4 for detection of 11q23/MLL series, MLL-AF6, MLL-AF9 and MLL-ENL4 kind fusion gene relative expression quantity, described oligonucleotide comprises primer and probe, wherein:

(1) detect shared upstream primer MLL-F1, MLL-F2 and shared probe P1, the P2 of 4 kinds of fusion genes of 11q23/MLL series; Wherein

MLL-F1：CAGCACTGGTCATCCCGCCTC

MLL-F2：CAATAAGCAGGAGAATGCAG

P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA

P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；

(2) detect downstream primer AF4-R1, the AF4-R2 of 4 kinds of fused type of MLL-AF4, wherein:

AF4-R1：CTTCGAGCATGGATGACGT

AF4-R2：GCCATGAATGGGTCATTTC

(3) detect the downstream primer AF6-R of 2 kinds of fused type of MLL-AF6, wherein:

AF6-R：CTTTCTCCGCTGACATGCACTTCA

(4) detect downstream primer AF9-R1, AF9-R2, the AF9-R3 of 6 kinds of fused type of MLL-AF9, wherein:

AF9-R1：GATCTGCTGCAGAATGTGTCT

AF9-R2：GGACTGGGTTGTTCAGAAT

AF9-R3：TGCTGCTGCTGCTGCTGGTAT

(5) detect downstream primer AF9-R1, AF9-R2, the AF9-R3 of 4 kinds of fused type of MLL-ENL, wherein:

ENL-R1：TTGGACGGGCTTGACTGGG

ENL-R2：GCTTCTTGCGCAGTTGGG

(6) detect the primer abl-F of reference gene abl, abl-R, probe abl-Probe; Wherein,

abl-F：GCCGTGAAGACCTTGAAGGAG

abl-R：ATGATATAGAACGGGGGCTC

abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。

Further, the mol ratio of MLL-AF4 upstream primer, downstream primer and probe is 2:2:1, that is: the mol ratio of MLL-F1:AF4-R1:P1 or MLL-F1:AF4-R2:P1 or MLL-F2:AF4-R1:P2 or MLL-F2:AF4-R2:P2 is 2:2:1.The mol ratio of LL-AF6 upstream primer, downstream primer and probe is 2:2:1.The mol ratio that is MLL-F1:AF6-R:P1 or MLL-F2:AF4-R:P2 is 2:2:1.The mol ratio of MLL-AF9 upstream primer, downstream primer and probe is 2:2:1.The mol ratio that is MLL-F1:AF9-R1:P1 or MLL-F1:AF9-R2:P1 or MLL-F1:AF9-R3:P1 or MLL-F2:AF9-R1:P2 or MLL-F2:AF9-R2:P2 or MLL-F2:AF9-R3:P2 is 2:2:1.The mol ratio of MLL-ENL upstream primer, downstream primer and probe is 2:2:1.The mol ratio that is MLL-F1:ENL-R1:P1 or MLL-F1:ENL-R2:P1 or MLL-F2:ENL-R1:P2 or MLL-F2:ENL-R2:P2 is 2:2:1.

Further, the mol ratio of reference gene abl-F:abl-R:abl-Probe is 2:2:1.

Further, 4 of described MLL-AF4 kinds of fused type respectively: MLLex8-AF4ex4, MLLex10-AF4ex4, MLLex8-AF4ex7, MLLex10-AF4ex7.

Further, 2 of described MLL-AF6 kinds of fused type respectively: MLLex8-AF6ex2, MLLex10-AF6ex2.

Further, 6 of described MLL-AF9 kinds of fused type respectively: MLLex8-AF9ex4, MLLex8-AF9ex5, MLLex8-AF9ex9, MLLex10-AF9ex4, MLLex10-AF9ex5, MLLex10-AF9ex9.

Further, 4 of described MLL-ENL kinds of fused type respectively: MLLex8-ENLex2, MLLex8-ENLex7, MLLex10-ENLex2, MLLex10-ENLex7.

The present invention also provides a kind of method of MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL4 kind fusion gene of the 11q23/MLL of detection series, comprises the following steps:

(1) in extracting blood, organize RNA;

(2) RNA is reversed to cDNA;

(3) detection system PCR reaction solution configuration;

(4) application of sample;

(5) detect;

(6) result reads;

(7) report the test;

Wherein said detection system PCR reaction solution comprises: THUNDERBIRD Probe qPCR Mix, ROX Reference Dye (50 *), RNase-free dH ₂primer abl-F, abl-R and the probe abl-Probe of O and upstream primer MLL-F1, MLL-F2, probe P1, P2, downstream primer AF4-R1, AF4-R2, AF6-R, AF9-R1, AF9-R2, AF9-R3, AF9-R1, AF9-R2, AF9-R3, detection reference gene abl.

The present invention also provides a kind of test kit of MLL-AF4, MLL-AF6, MLL-AF9 and MLL-ENL4 kind fusion gene of the 11q23/MLL of detection series, comprising:

Erythrocyte cracked liquid;

Trizol；

Chloroform;

Dehydrated alcohol;

Detection system PCR reaction solution, the primer that it comprises and probe are:

4 kinds of fused type of testing goal gene M LL-AF4 comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF4-R1 and AF4-R2, probe P1 and P2;

2 kinds of fused type of testing goal gene M LL-AF6 comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF6-R, probe P1, P2;

6 kinds of fused type of testing goal gene M LL-AF9 comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF9-R1, AF9-R2, AF9-R3, probe P1 and P2;

4 kinds of fused type of testing goal gene M LL-ENL comprise: upstream primer is MLL-F1 and MLL-F2, and downstream primer is ENL-R1 and ENL-R2, probe P1 and P2;

Abl reference gene: upstream primer is abl-F, downstream primer is abl-R, probe abl-Probe.

Further, test kit also comprises for building the required standard substance of reference gene and goal gene " two typical curve " and comprising: (1) comprises the plasmid solution that abl reference gene detects sequence and concentration known; (2) comprise the plasmid solution that 4 kinds of fused type of MLL-AF4 fusion gene detect sequence and concentration known; (3) comprise the plasmid solution that 2 kinds of fused type of MLL-AF6 fusion gene detect sequence and concentration known; (4) comprise the plasmid solution that 6 kinds of fused type of MLL-AF9 fusion gene detect sequence and concentration known; (5) comprise the plasmid solution that 4 kinds of fused type of MLL-ENL fusion gene detect sequence and concentration known.

Beneficial effect of the present invention: the present invention is combined with real-time fluorescence PCR technology with Taqman probe, utilize the method for two typical curves, build respectively the quantitative criterion curve that reference gene abl and 4 kinds of fusion genes of goal gene 11q23/MLL series amount to 16 kinds of fused type, detect interior certain fusion gene of 11q23/MLL of testee's body with respect to the expression level of reference gene.The present invention has included 16 kinds of fused type in 4 common large class fusion genes of 11q23/MLL, like product more on the market, and the type of covering is wider.Except qualitatively screening, the present invention can also quantize the mrna expression situation of fusion gene, makes result more specifically, intuitively, more comprehensive to the guidance of diagnosis.This invention is than the method for traditional dyeing body banding technique, fluorescence in situ hybridization, multiplex nested RT-PCR, has that conformability is strong, broad covered area, accuracy of detection be high, pollute control well, result is convenient to the advantages such as interpretation.Compared to the SYBR Green I dye method that is all quantitative fluorescent PCR, this invention not only promotes detection specificity after adopting Taqman probe greatly, also effectively shortened to about 1 hour detection time by original 2.5-3 hour, thereby greatly improved accuracy and the detection efficiency of detected result.In addition, after having introduced reference gene and goal gene " dual " quantitative criterion curve, with △ △ now ^cTanalytical method is compared, and has both got rid of the error due to different with goal gene amplification efficiency by reference gene, has also weakened environmental factors to resultant uncertainty, thereby has fundamentally improved the stability of test-results.In addition required primer, the probe of reaction system carried out to rational proportioning and optimization, made experiment condition reach best, thereby saved loaded down with trivial details condition, groped link, greatly promoted conventional efficient.This primer and probe after tested specificity are good, highly sensitive, easy and simple to handle.The method contributes to ALL(acute lymphoblastic leukemia clinically), AML(acute myeloblastic leukemia) and MDS(myelodysplastic syndrome) the 11q23/MLL series examination of fusion gene and the detection of mRNA relative expression level thereof in patient body, can also carry out early screening to high risk population simultaneously, can effectively save detection time, improve accuracy of detection.For timely therapeutic intervention, avoid hematology recurrence, adjust treatment plan, evaluate result for the treatment of, predict prognosis, prevent clinical recurrence all significant.

Accompanying drawing explanation

Fig. 1 is sample 1MLL-AF4 examination group fluorescent quantitative PCR curve.

Fig. 2 is sample 1MLL-AF6 examination group fluorescent quantitative PCR curve.

Fig. 3 is sample 1MLL-AF9 examination group fluorescent quantitative PCR curve.

Fig. 4 is sample 1MLL-ENL examination group fluorescent quantitative PCR curve.

Fig. 5 is sample 2MLL-AF4 examination group fluorescent quantitative PCR curve.

Fig. 6 is sample 2MLL-AF6 examination group fluorescent quantitative PCR curve.

Fig. 7 is sample 2MLL-AF9 examination group fluorescent quantitative PCR curve.

Fig. 8 is sample 2MLL-ENL examination group fluorescent quantitative PCR curve.

Fig. 9 is sample 3MLL-AF4 examination group fluorescent quantitative PCR curve.

Figure 10 is sample 3MLL-AF6 examination group fluorescent quantitative PCR curve.

Figure 11 is sample 3MLL-AF9 examination group fluorescent quantitative PCR curve.

Figure 12 is sample 3MLL-ENL examination group fluorescent quantitative PCR curve.

Figure 13 is abl reference gene quantitative criterion curve.

Figure 14 is MLL-AF4 fusion gene quantitative criterion curve.

Figure 15 is MLL-AF6 fusion gene quantitative criterion curve.

Figure 16 is MLL-AF9 fusion gene quantitative criterion curve.

Figure 17 is MLL-ENL fusion gene quantitative criterion curve.

Embodiment

Embodiment 1

For auxiliary ALL(acute lymphoblastic leukemia clinically), AML(acute myeloblastic leukemia) and MDS(myelodysplastic syndrome) test kit of the serial fusion gene MLL-AF4 of 11q23/MLL, MLL-AF6, MLL-AF9 and MLL-ENL4mRNA relative expression level detection in patient body, comprising:

Erythrocyte cracked liquid;

Trizol；

Chloroform;

Dehydrated alcohol;

Detection system PCR reaction solution: ReverTra Ace qPCR RT Kit(TOYOBO company); THNDERBIRD Probe qPCR Mix(2 *).

Primer, probe combinations be divided into MLL-AF4 MLL-AF6 MLL-AF9 MLL-ENL.Wherein:

4 kinds of fused type examination groups of testing goal gene M LL-AF4: each 0.8uM of upstream and downstream primer, probe 0.4uM.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF4-R1 and AF4-R2, and probe is followed upstream primer, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combination.Upstream and downstream primer combination of two, forms MLL-F1/AF4-R1 altogether, MLL-F1/AF4-R2, and MLL-F2/AF4-R1, tetra-kinds of combinations of MLL-F2/AF4-R, wherein:

MLL-F1：CAGCACTGGTCATCCCGCCTC；

MLL-F2：CAATAAGCAGGAGAATGCAG；

AF4-R1：CTTCGAGCATGGATGACGT；

AF4-R2：GCCATGAATGGGTCATTTC；

P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；

P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；

2 kinds of fused type examination groups of testing goal gene M LL-AF6: upstream and downstream primer each 0.8 μ M, probe 0.4 μ M.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF6-R, and probe is followed upstream primer, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combination.Upstream and downstream primer combination of two, forms MLL-F1/AF6-R altogether, two kinds of combinations of MLL-F2/AF6-R.Wherein:

MLL-F1：CAGCACTGGTCATCCCGCCTC；

MLL-F2：CAATAAGCAGGAGAATGCAG；

AF6-R：CTTTCTCCGCTGACATGCACTTCA

P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；

P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；

6 kinds of fused type examination groups of testing goal gene M LL-AF9: upstream and downstream primer each 0.8 μ M, probe 0.4 μ M.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is AF9-R1, AF9-R2, AF9-R3, and probe is followed upstream primer, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combination.Upstream and downstream primer combination of two, forms MLL-F1/AF9-R1, MLL-F1/AF9-R2, MLL-F1/AF9-R3, MLL-F2/AF9-R1, MLL-F2/AF9-R2, six kinds of combinations of MLL-F2/AF9-R3 altogether.Wherein:

MLL-F1：CAGCACTGGTCATCCCGCCTC；

MLL-F2：CAATAAGCAGGAGAATGCAG；

AF9-R1：GATCTGCTGCAGAATGTGTCT

AF9-R2：GGACTGGGTTGTTCAGAAT

AF9-R3：TGCTGCTGCTGCTGCTGGTAT

P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；

P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；

4 kinds of fused type examination groups of testing goal gene M LL-ENL: each 0.8uM of upstream and downstream primer, probe 0.4uM.Wherein upstream primer is MLL-F1 and MLL-F2, and downstream primer is ENL-R1 and ENL-R2, and probe is followed upstream primer, that is: P1 and MLL-F1 combination, P2 and MLL-F2 combination.Upstream and downstream primer combination of two, forms MLL-F1/ENL-R1 altogether, MLL-F1/ENL-R2, MLL-F2/ENL-R1, tetra-kinds of combinations of MLL-F2/ENL-R2.Wherein:

MLL-F1：CAGCACTGGTCATCCCGCCTC；

MLL-F2：CAATAAGCAGGAGAATGCAG；

ENL-R1：TTGGACGGGCTTGACTGGG

ENL-R2：GCTTCTTGCGCAGTTGGG

P1：FAM-ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA；

P2：FAM-AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；

Abl reference gene: upstream and downstream primer each 0.8 μ M, probe 0.4 μ M.Wherein upstream primer is abl-F, and downstream primer is abl-R, probe abl-Probe.Wherein:

abl-F：GCCGTGAAGACCTTGAAGGAG

abl-R：ATGATATAGAACGGGGGCTC

abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。

Positive reference substance: respectively containing 4 kinds of fused type of MLL-AF4 fusion gene, 2 kinds of fused type of MLL-AF6 fusion gene, 6 kinds of fused type of MLL-AF9 fusion gene, the solution of 4 kinds of fused type of MLL-ENL fusion gene;

Negative control product: the solution that does not contain above-mentioned 16 kinds of 11q23/MLL fused type.

Be used for building reference gene and the required standard substance of goal gene " two typical curve " comprise: (1) comprises the plasmid solution that abl reference gene detects sequence and concentration known; (2) comprise the plasmid solution that 4 kinds of fused type of MLL-AF4 fusion gene detect sequence and concentration known; (3) comprise the plasmid solution that 2 kinds of fused type of MLL-AF6 fusion gene detect sequence and concentration known; (4) comprise the plasmid solution that 6 kinds of fused type of MLL-AF9 fusion gene detect sequence and concentration known; (5) comprise the plasmid solution that 4 kinds of fused type of MLL-ENL fusion gene detect sequence and concentration known.

Embodiment 2

Detect operating process:

(1) in extracting blood, organize RNA: in the centrifuge tube of clean 1.5ml, add 1ml erythrocyte cracked liquid, get anticoagulation 0.5ml and mix.The standing 10min of room temperature; The centrifugal 5min of 5000rpm, abandons supernatant, collects the cell of bottom; Again add 0.5ml erythrocyte cracked liquid, the centrifugal 5min of 5000rpm, abandons supernatant, collects the cell of bottom; In cell, add 1mlTrizol, piping and druming is until precipitate dissolving completely, the static 5min of room temperature repeatedly; Add 0.2ml chloroform, concussion evenly; 14000rpm4 ℃ of centrifugal 10min, draws supernatant layer and is transferred in another new centrifuge tube; Add isopyknic Virahol, fully mix up and down, the standing 10min of room temperature; 14000rpm4 ℃ of centrifugal 10min, abandons supernatant, adds 75% ethanol 1ml, and washing tube wall gently turns upside down; 14000rpm4 ℃ of centrifugal 5min, abandons ethanol; Drying at room temperature 10-15min, adds 20 μ lRNase-free water dissolution precipitations.

(2) with reference to the Rever Tra Ace qPCR RT Kit test kit specification sheets of TOYOBO company, RNA is reversed to cDNA.

(3) detection system PCR reaction solution configuration: by detecting each X μ l of people's umber configuration detection system PCR reaction solution, every person-portion 23 μ l packing, composed as follows:

MLL-AF4

MLL-AF9

MLL-AF6

MLL-ENL

X=23ul reaction solution * (part negative control+1, part positive control+1,8 parts of reference genes (typical curve)+8 part goal gene (typical curve)+n part sample+1 part blank);

(4) application of sample: add gained cDNA in 2 μ l steps (2) respectively in MLL-AF4, MLL-AF6, MLL-AF9, MLL-ENL detection system PCR reaction solution; Positive control and negative control directly add 2 μ l positive reference substances and negative control product; Blank adds 2 μ l physiological saline.

(5) detect: detect and carry out on real-time fluorescence PCR instrument, available instrument comprises ABI7300,7500(U.S. Applied Biosystems company) etc.Reaction conditions: 95 ℃ of denaturation 1min; 95 ℃ of 15s, 58 ℃ of 35sec, 40 circulations, fluorescent signal gathers when 58 ℃ of 35sec.

(6) result reads: threshold line is adjusted to background signal and negative amplification more than line, and system calculates copy number automatically according to typical curve and CT value.Before calculating copy number, please first contrast following annotation (1) and (2) validity of result is passed judgment on, further result is qualitatively judged.

1), when internal reference is positive, it is effective that detected result is just thought;

2) positive judging criterion: the Ct<35 of goal gene, positive; 35≤Ct≤38, are the doubtful positive, need to again verify; Ct > 38, negative.

(7) report the test: the goal gene copy number that is judged to the sample of positive findings is made to ratio with the copy number of reference gene, draw fusion gene mRNA relative expression level.

Embodiment 3

Fetch and deliver ALL, AML, each 20 examples of MDS clinical samples of inspection, extract and organize RNA, and be cDNA by the extracted RNA reverse transcription of organizing by method described in embodiment 2, preparation detection system PCR reaction solution also detects.

This reverse transcription of every increment is cDNA, and to the cDNA sample that adds 2 μ l in detection system PCR reaction solution.Do the positive, feminine gender, blank, each 1 part of the typical curve of reference gene/goal gene simultaneously.Each sample repeats for 2 times, 1 part of positive control, 1 part of negative control and 1 part of blank.Be 100 minutes detection time.

Experimental result of the present invention and △ △ ^cTthe result of method is compared, and determines the accuracy rate of pattern detection.Result is as shown in table 1, table 2 and table 3:

Table 1:20 example ALL patient detected result

Table 2:20 example AML patient detected result

Table 3:20 example MDS patient detected result

Table 1-table 3 is detected result of the present invention and popular △ △ now ^cTthe comparison of method detected result, in all 60 routine tested samples, only 1 example (4550) there are differences in result judgement, and after empirical tests, 4550 is the weak positive and for minimal residue, although the detection expression amount result of other samples is numerically variant, by statistics after Epidemiological Analysis, difference is not significantly (P>0.05) all, and for result, judgement can not produce great effect.Therefore, two kinds of whole coincidence rates of method comparison test-results reach more than 98.0%.Detection kit of the present invention and popular △ △ now ^cTanalytical procedure is compared, and not only detected result accuracy is high, and has higher recall rate for the low sample of fusion gene expression amount, has stopped small residual undetected phenomenon, has improved accuracy of detection.In detection time, △ △ ^cTneed to spend about 2.5-3 hour, adopt method of the present invention to shorten to about 1 hour detection time.Therefore on detection efficiency, can meet better the Clinical Laboratory requirement that detection limit increases day by day.With conventional now △ △ ^cTanalytical method is compared, and has both got rid of by reference gene caused errors different from goal gene amplification efficiency, has also weakened environmental factors to resultant uncertainty, thereby has fundamentally improved the stability of test-results.In addition required primer, the probe of reaction system carried out to rational proportioning and optimization, made experiment condition reach best, thereby saved loaded down with trivial details condition, groped link, greatly promoted conventional efficient.

Embodiment 4

Get 3 parts of clinical samples to be checked, by method described in embodiment 2, extract and organize RNA, by the RNA reverse transcription of organizing extracting, be cDNA, and prepare detection system PCR reaction solution.To the cDNA sample that adds 2 μ l in detection system PCR reaction solution.Do the positive, feminine gender, each portion of blank simultaneously.With fluorescent PCR instrument, detect, the time is 100 minutes.

Sample 1 through genetic map analysis, find to exist t (4; 11) (q21; , there is MLL-AF4 fusion gene in q23) chromosome translocation.Utilize the result of the method for the invention detection as shown in Fig. 1～4, during 11q23/MLL series detects, only have MLL-AF4 examination group to occur fluorescent signal, consistent with genetic map analytical results, advise row allotransplantation as early as possible.

Sample 2 through genetic map analysis, find to exist t (11; 19) (q23; , there is MLL-ENL fusion gene in P13.1) chromosome translocation.Utilize the result of the method for the invention detection as shown in Fig. 5～8, during 11q23/MLL series detects, only have MLL-ENL examination group to occur fluorescent signal, consistent with genetic map analytical results, advise row allotransplantation as early as possible.

Sample 3 through genetic map analysis, find to exist t (6; 11) (q27; , there is MLL-AF6 fusion gene in q23) chromosome translocation.Utilize the result of the method for the invention detection as shown in Fig. 9～12, during 11q23/MLL series detects, only have MLL-AF6 examination group to occur fluorescent signal, consistent with genetic map analytical results, advise row allotransplantation as early as possible.From detected result comparative analysis, primer of the present invention, probe, test kit and detection method, acquired results is accurately, reliable, stable, detection efficiency is high.

SEQUENCE LISTING

<110> Foochow company limited of Ai Dikang medical test institute

<120> detects method, primer and the probe of 11q23/MLL fusion gene relative expression quantity

<130>

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> artificial sequence

<400> 1

cagcactggt catcccgcct c 21

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<400> 2

caataagcag gagaatgcag 20

<210> 3

<211> 29

<212> DNA

<213> artificial sequence

<400> 3

actacaggac cgccaagaaa agaagttcc 29

<210> 4

<211> 30

<212> DNA

<213> artificial sequence

<400> 4

agcactctct ccaatggcaa tagttctaag 30

<210> 5

<211> 19

<212> DNA

<213> artificial sequence

<400> 5

cttcgagcat ggatgacgt 19

<210> 6

<211> 19

<212> DNA

<213> artificial sequence

<400> 6

gccatgaatg ggtcatttc 19

<210> 7

<211> 24

<212> DNA

<213> artificial sequence

<400> 7

ctttctccgc tgacatgcac ttca 24

<210> 8

<211> 21

<212> DNA

<213> artificial sequence

<400> 8

gatctgctgc agaatgtgtc t 21

<210> 9

<211> 19

<212> DNA

<213> artificial sequence

<400> 9

ggactgggtt gttcagaat 19

<210> 10

<211> 21

<212> DNA

<213> artificial sequence

<400> 10

tgctgctgct gctgctggta t 21

<210> 11

<211> 19

<212> DNA

<213> artificial sequence

<400> 11

ttggacgggc ttgactggg 19

<210> 12

<211> 18

<212> DNA

<213> artificial sequence

<400> 12

gcttcttgcg cagttggg 18

<210> 13

<211> 21

<212> DNA

<213> artificial sequence

<400> 13

gccgtgaaga ccttgaagga g 21

<210> 14

<211> 20

<212> DNA

<213> artificial sequence

<400> 14

atgatataga acgggggctc 20

<210> 15

<211> 20

<212> DNA

<213> artificial sequence

<400> 15

acctggtgca gctccttggg 20

Claims

1. for detection of primer and the probe of MLL-AF4, MLL-AF6, MLL-AF9 and 4 kinds of fusion gene relative expression quantities of MLL-ENL of 11q23/MLL series, it is characterized in that: described primer and probe comprise:

MLL-F1：CAGCACTGGTCATCCCGCCTC

MLL-F2：CAATAAGCAGGAGAATGCAG

P1：FAM- ACTACAGGACCGCCAAGAAAAGAAGTTCC-TAMRA

P2：FAM- AGCACTCTCTCCAATGGCAATAGTTCTAAG–TAMRA；

AF4-R1：CTTCGAGCATGGATGACGT

AF4-R2：GCCATGAATGGGTCATTTC

AF6-R：CTTTCTCCGCTGACATGCACTTCA

AF9-R1：GATCTGCTGCAGAATGTGTCT

AF9-R2：GGACTGGGTTGTTCAGAAT

AF9-R3：TGCTGCTGCTGCTGCTGGTAT

ENL-R1：TTGGACGGGCTTGACTGGG

ENL-R2：GCTTCTTGCGCAGTTGGG

abl-F：GCCGTGAAGACCTTGAAGGAG

abl-R：ATGATATAGAACGGGGGCTC

abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。

2. primer as claimed in claim 1 and probe, is characterized in that:

The mol ratio of MLL-AF4 upstream primer, downstream primer and probe is 2:2:1, that is: the mol ratio of MLL-F1:AF4-R1:P1 or MLL-F1:AF4-R2:P1 or MLL-F2:AF4-R1:P2 or MLL-F2:AF4-R2:P2 is 2:2:1;

The mol ratio of MLL-AF6 upstream primer, downstream primer and probe is 2:2:1; The mol ratio that is MLL-F1:AF6-R:P1 or MLL-F2:AF4-R:P2 is 2:2:1;

The mol ratio of MLL-AF9 upstream primer, downstream primer and probe is 2:2:1; The mol ratio that is MLL-F1:AF9-R1:P1 or MLL-F1:AF9-R2:P1 or MLL-F1:AF9-R3:P1 or MLL-F2:AF9-R1:P2 or MLL-F2:AF9-R2:P2 or MLL-F2:AF9-R3:P2 is 2:2:1;

The mol ratio of MLL-ENL upstream primer, downstream primer and probe is 2:2:1; The mol ratio that is MLL-F1:ENL-R1:P1 or MLL-F1:ENL-R2:P1 or MLL-F2:ENL-R1:P2 or MLL-F2:ENL-R2:P2 is 2:2:1.

3. primer as claimed in claim 1 and probe, the mol ratio that it is characterized in that reference gene abl-F:abl-R:abl-Probe is 2:2:1.

4. primer as claimed in claim 1 and probe, is characterized in that, 4 kinds of fused type of described MLL-AF4 respectively: MLLex8-AF4ex4, MLLex10-AF4ex4, MLLex8-AF4ex7, MLLex10-AF4ex7.

5. primer as claimed in claim 1 and probe, is characterized in that, 2 kinds of fused type of described MLL-AF6 respectively: MLLex8-AF6ex2, MLLex10-AF6ex2.

6. primer as claimed in claim 1 and probe, it is characterized in that, 6 kinds of fused type of described MLL-AF9 respectively: MLLex8-AF9ex4, MLLex8-AF9ex5, MLLex8-AF9ex9, MLLex10-AF9ex4, MLLex10-AF9ex5, MLLex10-AF9ex9.

7. primer as claimed in claim 1 and probe, is characterized in that, 4 kinds of fused type of described MLL-ENL respectively: MLLex8-ENLex2, MLLex8-ENLex7, MLLex10-ENLex2, MLLex10-ENLex7.

8. a method that detects MLL-AF4, MLL-AF6, MLL-AF9 and 4 kinds of fusion genes of MLL-ENL of 11q23/MLL series, comprises the following steps:

(1) in extracting blood, organize RNA;

(2) RNA is reversed to cDNA;

(3) detection system PCR reaction solution configuration;

(4) application of sample;

(5) detect;

(6) result reads;

(7) report the test;