CN108034702A - The expression of detection fusion gene M LL/CBP and the other oligonucleotides of pattern of fusion and application - Google Patents
The expression of detection fusion gene M LL/CBP and the other oligonucleotides of pattern of fusion and application Download PDFInfo
- Publication number
- CN108034702A CN108034702A CN201711101232.6A CN201711101232A CN108034702A CN 108034702 A CN108034702 A CN 108034702A CN 201711101232 A CN201711101232 A CN 201711101232A CN 108034702 A CN108034702 A CN 108034702A
- Authority
- CN
- China
- Prior art keywords
- cbp
- mll
- probe
- detection
- reaction solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Expression and pattern of fusion other oligonucleotides and application of the present invention for detection fusion gene M LL/CBP.Initial survey is first carried out using the multi-primers fluorescent PCR containing three kinds of type primers.If there is the positive, then specific type identification is carried out with specific primer fluorescent PCR, so reduce initial survey cost, and improve detection flux.Kit specificity of the present invention is good, and high sensitivity, flux is big, suitable for high-volume pattern detection.All it is of great significance for leukemia diagnosis, adjustment therapeutic scheme, evaluation therapeutic effect, prediction prognosis, prevention clinical recurrence.
Description
Technical field
The invention belongs to life science and biological technical field, and in particular to a kind of leukemia fusion gene of examination purposes
Primer, probe and the detection kit of MLL/CBP detections.
Background technology
With the extensive use of chemotherapy, radiotherapy and biological gene therapy in malignant tumour is treated, make most of pernicious
Tumour is able to effectively treat and control, or even part is cured.But since change, radiotherapy can also damage normally while treatment
Candidate stem cell and immunocyte, cause gene mutation, so as to induce treatment related leukemia (therapy-related
leukemia).It is a kind of syndrome to treat related leukemia, has the various clinical manifestations of primary leukemias, main hair
After being born in initial cancer (hematologic malignancies, solid carcinoma) treatment, each leukemoid 7% is constituted about.In addition, treatment correlation is white
Blood disease generally existing incubation period is grown, poor to therapeutic response, and the life cycle short special disease of clinic, seriously endangers the life of tumor patient
Deposit.
Mixed lineage leukemia (Mixed-lineage leukemia, MLL) gene is with its fusion partners because chromosome is easy
Position and the fusion that produces is the common type treated in related leukemia, have that grade malignancy is high, it is insensitive to chemotherapy,
The characteristics of remission rate is low.Wherein co-activating set protein gene (CREB, bingding protein, CBP) is combined generation with MLL
Fusion MLL-CBP (t11；16)(q23；P13 it is) a kind of rare fusion type, mainly there is MLLexon8/
CBPexon3, MLLexon9/CBPexon3 and MLLexon10/CBPexon3.Research shows that MLL-CBP fusion proteins can draw
Send out myelosis and strengthen granulocyte and the self-renewing of macrophage leukocyte precursor and multiplication capacity, and these abnormal phenomenon are then
Leukaemia may be further development of.Analyzed through clinical case, MLL-CBP is proved with treating the acute white blood of grain monokaryon of correlation
Sick (therapy-related acute myelomonocytic leukemia, t-AMML), chronic myelomonocytic leukemia
(therapy-related chronic myelomonocytic leukemia, t-CMML) etc. has close ties, and normal companion
There is frequently-occurring myelodysplastic syndrome (therapy-related myelodysplastic syndrome, t-MDS).
Real-time fluorescence PCR integrative biology, zymetology and fluorescence chemical are in one, from amplification to interpretation of result in closed
Carried out in PCR reaction tubes under state, its result is represented with Ct values, compared with regular-PCR, has specificity good, high sensitivity, is grasped
Make it is simple, it is as a result more directly perceived the advantages that.Common method has SYBR GreenI dye methods, double probe hybridization in real-time fluorescence PCR
Method and Taqman technologies etc..Wherein SYBR GreenI due to being non-saturable dye, specificity not as double probe hybrid methods and
Taqman methods, it is necessary to judge its specificity by observing solubility curve, and two probe method hybrid method cost is costly.Cause
This, this kit is carried out using the Taqman sonde methods detection fusion gene M LL/CBP in real-time fluorescence PCR and to its type
Identification.
The content of the invention
The present invention devises detection internal reference/target gene primer, probe, using real-time fluorescence PCR, detects reference gene
The expression of ABL, target gene MLL/CBP, identification of M LL/CBP fusion types.Kit is by adjusting internal reference/target gene
Primed probe ratio, and PCR reaction conditions make amplification efficiency and speed reach optimal.
For in the test kit of MLL/CBP contain erythrocyte cracked liquid, TRIzol, chloroform, absolute ethyl alcohol,
ReverTra Ace qPCR RT Kit (TOYOBO companies), detection architecture PCR reaction solution 1, detection architecture PCR reaction solution 2, inspection
Survey system PCR reaction solution 3, detection architecture PCR reaction solution 4, positive reference substance 1, positive reference substance 2, positive reference substance 3, the positive
Reference substance 4, negative controls and internal reference ABLPCR reaction solutions, it is characterised in that：
Detection architecture PCR reaction solution 1 includes THUNDERBIRD qPCR MIX (TOYOBO, QPS-101), testing goal base
Because being respectively with upstream and downstream primer：MLL/CBP-8-F、MLL/CBP-8-R、MLL/CBP-9-F、MLL/CBP-10-F、MLL/
CBP-9-10-R, probe MLL/CBP-Probe, are merged for initial survey with the presence or absence of MLL/CBP.Probe, primer sequence are as follows,
MLL/CBP-8-F:CCGCCCAAGTATCCCTGTAA
MLL/CBP-8-R:ATTTGGCACGTTGGTGACTG
MLL/CBP-9-F:CCAATGGCAATAGTTCTAAGCAA
MLL/CBP-10-F:GGCAGTAGTGGGCATGTAGAGAT
MLL/CBP-9-10-R:CTGTAGGGAAGGTGGGCAA
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA–TAMRA
Detection architecture PCR reaction solution 2 includes THUNDERBIRD qPCR MIX (TOYOBO, QPS-101), for differentiating
Primer MLL/CBP-8-F, MLL/CBP-8-R and probe MLL/CBP-Probe of MLL/CBP-8.Probe, primer sequence are such as
Under,
MLL/CBP-8-F:CCGCCCAAGTATCCCTGTAA
MLL/CBP-8-R:ATTTGGCACGTTGGTGACTG
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA-TAMRA detection architectures PCR reaction solution 3
Including THUNDERBIRD qPCR MIX (TOYOBO, QPS-101), for differentiate MLL/CBP-9 primer MLL/CBP-9-F,
MLL/CBP-9-10-R and probe MLL/CBP-Probe.Probe, primer sequence are as follows,
MLL/CBP-9-F:CCAATGGCAATAGTTCTAAGCAA
MLL/CBP-9-10-R:CTGTAGGGAAGGTGGGCAA
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA–TAMRA
Detection architecture PCR reaction solution 4 includes THUNDERBIRD qPCR MIX (TOYOBO, QPS-101), for differentiating
Primer MLL/CBP-10-F, MLL/CBP-9-10-R and probe MLL/CBP-Probe of MLL/CBP-10.Probe, primer sequence
Row are as follows,
MLL/CBP-10-F:GGCAGTAGTGGGCATGTAGAGAT
MLL/CBP-9-10-R:CTGTAGGGAAGGTGGGCAA
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA–TAMRA
Internal reference ABLPCR reaction solutions include THUNDERBIRD qPCR MIX (TOYOBO, QPS-101), detect drawing for ABL
Thing ABL-F, ABL-R and probe ABL-Probe.Probe primer sequence is as follows,
ABL-F:GATACGAAGGGAGGGTGTACCA
ABL-R:CTCGGCCAGGGTGTTGAA
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA
In addition, solution of the negative controls for no MLL/CBP fusions.The positive reference substance 1 is containing MLL/
CBP-8, MLL/CBP-9, MLL/CBP-10 fusion plasmid solution；Positive reference substance 2 is MLL/CBP-8 fusion plasmids
Solution；Positive reference substance 3 is MLL/CBP-9 fusion plasmid solutions；Positive reference substance 4 is respectively MLL/CBP-10 fusion bases
Because of plasmid solution.
The present invention mentality of designing be：
1. primer, probe design
For MLL/CBP higher MLLexon8/CBPexon3, MLLexon9/CBPexon3 of fusion probability and
MLLexon10/CBPexon3 designs primer and probe.According to MLLexon8, exon9, exon10 sequence design sense primer, then
With reference to CBPexon3 sequence design anti-sense primers, wherein MLLexon9/CBPexon3 and MLLexon10/CBPexon3 are shared together
One anti-sense primer, but in order to ensure the reaction efficiency and specificity in multi-primers fluorescence reaction system, MLLexon8/
An anti-sense primer is used alone in CBPexon3.Further, since fusion downstream is CBPexon3, therefore probe design exists
On CBPexon3, three kinds of fusions share same probe.It may be said that the invention is considering reaction efficiency and spy to greatest extent
While different in nature, and significantly reduce cost.
2. detection and identification System Design
Since the generation probability of MLL/CBP is low, thus the present invention first using multi-primers (in a reaction system containing pair
Answer 3 kinds of other primers of pattern of fusion) real-time fluorescence PCR is combined, Preliminary detection is carried out to sample.If occurs sun in initial survey result
Property, then (reacted respectively with specific primer in a reaction system containing only a kind of other primer of pattern of fusion, primer for multi-primers
One kind in system) specific type is identified.
The present invention provides the expression and the other oligonucleotides of pattern of fusion of a kind of detection fusion gene M LL/CBP, bag
Include primer MLL/CBP-8-F, MLL/CBP-8-R, MLL/CBP-9-F, MLL/CBP-10-F, MLL/CBP-9-10-R and probe is
MLL/CBP-Probe, the primer and probe sequence are as follows：
MLL/CBP-8-F:CCGCCCAAGTATCCCTGTAA
MLL/CBP-8-R:ATTTGGCACGTTGGTGACTG
MLL/CBP-9-F:CCAATGGCAATAGTTCTAAGCAA
MLL/CBP-10-F:GGCAGTAGTGGGCATGTAGAGAT
MLL/CBP-9-10-R:CTGTAGGGAAGGTGGGCAA
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA–TAMRA
Further, for differentiating primer MLL/CBP-8-F, MLL/CBP-8-R and probe MLL/ of MLL/CBP-8
CBP-Probe；Primer MLL/CBP-9-F, MLL/CBP-9-10-R and probe MLL/CBP-Probe of MLL/CBP-9；For
Differentiate primer MLL/CBP-10-F, MLL/CBP-9-10-R and probe MLL/CBP-Probe of MLL/CBP-10.
Further, primer ABL-F, ABL-R and probe ABL-Probe for reference gene ABL detections are further included,
The primer and probe sequence is：
ABL-F:GATACGAAGGGAGGGTGTACCA
ABL-R:CTCGGCCAGGGTGTTGAA
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA
Present invention also offers the expression and the other oligonucleotides of pattern of fusion of a kind of detection fusion gene M LL/CBP
Kit, including primer MLL/CBP-8-F, MLL/CBP-8-R, MLL/CBP-9-F, MLL/CBP-10-F, MLL/CBP-9-10-
R and probe are MLL/CBP-Probe, and the primer and probe sequence is as follows：
MLL/CBP-8-F:CCGCCCAAGTATCCCTGTAA
MLL/CBP-8-R:ATTTGGCACGTTGGTGACTG
MLL/CBP-9-F:CCAATGGCAATAGTTCTAAGCAA
MLL/CBP-10-F:GGCAGTAGTGGGCATGTAGAGAT
MLL/CBP-9-10-R:CTGTAGGGAAGGTGGGCAA
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA–AMRA
Further, erythrocyte cracked liquid is also contained.
Further, positive reference substance and negative controls are further included.
A kind of method for reducing fusion MLL/CBP testing costs, comprises the following steps：
(1) total serum IgE in blood sample is extracted；
(2) it is cDNA by the RNA reverse transcriptions extracted in step 1；
(3) real-time fluorescence PCR is combined using detection architecture PCR reaction solution 1, Preliminary detection is carried out to sample, if preliminary inspection
The results show is surveyed as feminine gender, then stops detection；
(4) if the testing result in step 3 is shown as positive, respectively with detection architecture PCR reaction solution 2, detection architecture PCR
Reaction solution 3, detection architecture PCR reaction solution 4 combine real-time fluorescence PCR and carry out that particular type is other identifies to detection sample；
(5) result judges：Threshold line is adjusted to more than background signal and negative amplification line, draws Ct values；1) internal reference sun
During property, testing result just thinks effective；2) positive criterion：Ct<36, for the positive；35≤Ct≤38, are the doubtful positive, are needed
To verify again；Ct ＞ 38, for feminine gender.
Present invention also offers a kind of expression and pattern of fusion method for distinguishing of detection fusion gene M LL/CBP, including：
(1) total serum IgE in blood sample is extracted；
(2) it is cDNA by the RNA reverse transcriptions extracted in step 1；
(3) real-time fluorescence PCR is combined using detection architecture PCR reaction solution 1, Preliminary detection is carried out to sample, if preliminary inspection
The results show is surveyed as feminine gender, then stops detection；It is judged as MLL/CBP fusions if Preliminary detection the results show is the positive
Type；
(4) be optional step, if the testing result in step 3 is shown as positive, respectively with detection architecture PCR reaction solution 2,
It is other to detection sample progress particular type that detection architecture PCR reaction solution 3, detection architecture PCR reaction solution 4 combine real-time fluorescence PCR
Identified；
(5) result judges：Threshold line is adjusted to more than background signal and negative amplification line, draws Ct values；1) internal reference sun
During property, testing result just thinks effective；2) positive criterion：Ct<36, for the positive；35≤Ct≤38, are the doubtful positive, are needed
To verify again；Ct ＞ 38, for feminine gender.
The beneficial effects of the invention are as follows：The present invention uses real-time fluorescence PCR Tapman sonde methods, detects and differentiates tested
Fusion MLL/CBP in person's body, compared to conventional fluorescence in situ hybridization and traditional reverse transcription PCR method, kit tool
Have the advantages that full name monitors, susceptibility is high, anti-pollution, result is easy to interpretation.Again since the kit uses multi-primers system
The method that initial survey and specific primer are combined, detection flux is improved while initial survey cost is reduced again.In addition the reagent
Primer needed for reaction system, probe are carried out rational proportion and optimization by box, experiment condition is reached optimal, so as to eliminate numerous
Trivial condition gropes link, greatly improves conventional efficient.Therefore the kit can be detected rapidly and accurately in great amount of samples
MLL/CBP, has for leukemia diagnosis, adjustment therapeutic scheme, evaluation therapeutic effect, prediction prognosis, prevention clinical recurrence
Significance.
Brief description of the drawings
Fig. 1 multi-primers fluorescent PCRs No. 11 sample legends of MLL/CBP, wherein 1 positive control；2 internal references；3 negative controls；
4 No. 11 sample multi-primers fluorescence curves.
No. 11 sample legends of Fig. 2 MLL/CBP-8 fluorescent PCRs, wherein 1MLL/CBP-8 positive controls；2 internal references；3 is negative right
According to；4 No. 11 sample MLL/CBP-8 fluorescence curves.
No. 11 sample legends of Fig. 3 MLL/CBP-9 fluorescent PCRs, 1MLL/CBP-9 positive controls；2 internal references；3 negative controls；4
No. 11 sample MLL/CBP-9 fluorescence curves.
No. 11 sample legends of Fig. 4 MLL/CBP-10 fluorescent PCRs, 1MLL/CBP-10 positive controls；2 internal references；3 is negative right
According to；4 No. 11 sample MLL/CBP-10 fluorescence curves.
Embodiment
Embodiment 1
The operating process of this method：
(1) total serum IgE in blood is extracted:1ml erythrocyte cracked liquids are added in the centrifuge tube of clean 1.5ml, are taken anti-
Blood coagulation 0.5ml is mixed.It is stored at room temperature 10min；5000rpm centrifuges 5min, abandons supernatant, collects the cell of bottom；Add again
0.5ml erythrocyte cracked liquids, 5000rpm centrifugation 5min, abandon supernatant, collect the cell of bottom；1ml is added into cell
TRIzol, repeatedly piping and druming are completely dissolved until precipitating, and are stored at room temperature 5min；0.2ml chloroforms are added, concussion is uniform；14000rpm
4 DEG C of centrifugation 10min, draw supernatant layer and are transferred in another new centrifuge tube；Isometric isopropanol is added, it is fully mixed up and down
It is even, it is stored at room temperature 10min；4 DEG C of centrifugation 10min of 14000rpm, abandon supernatant, add 75% ethanol 1ml, gently turn upside down and wash
Wash tube wall；4 DEG C of centrifugation 5min of 14000rpm, abandon ethanol；Drying at room temperature 10-15min, adds the dissolving of 20 μ lRNase-free water
Precipitation.
(2) the Rever Tra Ace qPCR RT Kit kit specifications of TOYOBO companies are referred to, RNA is reversed to
cDNA。
(3) preparation of reagents：As needed for initial survey or type identification, detection architecture PCR reaction solution X ul are prepared, per 23 μ l of person-portion
Packing：
X=23 μ l reaction solutions × (+1 part of blank control of n parts of+1 part of sample+1 part of positive control negative controls)；
(4) it is loaded：2 μ lcDNA are added into detection architecture PCR reaction solution；When positive control or negative control detect, to
2 μ l positive reference substances or negative controls are added in detection reaction system PCR reaction solution；It is anti-to detection when blank control detects
Answer and 2 μ l physiological saline are added in system PCR reaction solution or are not added with any material.
The detection reaction system PCR reaction solution is selected from detection architecture PCR reaction solution 1, detection architecture PCR reaction solution 2, inspection
Survey system PCR reaction solution 3, detection architecture PCR reaction solution 4 are a kind of (concrete composition is shown in Table 1) therein.
The positive reference substance is selected from positive reference substance 1, positive reference substance 2, positive reference substance 3, positive reference substance 4 wherein
One kind.
1. detection architecture PCR reaction solution formulation components of table
(5) detect：Detection carries out on real-time fluorescence PCR instrument, can include ABI7300, the 7500 (U.S. with instrument
Applied Biosystems companies) etc..Reaction condition：95 DEG C of pre-degeneration 1min；95 DEG C of 15s, 58 DEG C of 35s, react 40
Circulation, fluorescence signal gather when 58 DEG C of 35s.
If only needing to obtain the expression of fusion MLL/CBP in detection sample, identified without type, using detection body
It is PCR reaction solution 1.
The specific type of fusion MLL/CBP in sample is detected to obtain, using 1 knot of detection architecture PCR reaction solution
Real-time fluorescence PCR is closed, Preliminary detection is carried out to sample.If Preliminary detection the results show is feminine gender, stop detection.If preliminary inspection
Survey in result and be shown as positive, then respectively with detection architecture PCR reaction solution 2, detection architecture PCR reaction solution 3, detection architecture PCR
Reaction solution 4 combines real-time fluorescence PCR and carries out that particular type is other identifies to detection sample.
(6) result judges：Threshold line is adjusted to more than background signal and negative amplification line, draws Ct values.
1) when internal reference is positive, testing result just thinks effective；
2) positive criterion：Ct<36, for the positive；35≤Ct≤38, are the doubtful positive, it is necessary to verify again；Ct ＞
38, for feminine gender.
2 leukaemia sample initial survey of embodiment
Leukaemic's anti-freezing blood specimen totally 10 of inspection is fetched and delivered, by 1 the method for embodiment extraction geneome RNA, is matched somebody with somebody
Reagent processed simultaneously detects.
Every part of sample adds 2 μ l into detection architecture PCR reaction solution 1.The positive is done at the same time, negative, blank control.Due to fusion
Gene M LL/CBP is more rare among leukaemic, and 10 leukaemia samples are negative findings.As a result such as table 1 below：
Table 1
3 clinical sample initial survey of embodiment
11 parts of clinical sample to be checked is taken at random, by 1 the method for embodiment extraction genome, reagent preparation and is detected.
Every part of sample adds 2 μ l into detection architecture PCR reaction solution 1.The positive is done at the same time, negative, each portion of blank control.As a result such as following table
2。
Table 2
Embodiment 4MLL/CBP types are identified
5 parts of clinical sample after random 3 initial survey of embodiment of learning from else's experience, by 1 the method for embodiment extraction genome, prepares and tries
Agent simultaneously detects.Every part of sample adds 2 μ l into identification detection architecture PCR reaction solution 2-4 respectively.The positive is done at the same time, negative, blank pair
According to each portion.As a result consistent with embodiment 3 since the probability of happening of MLL/CBP is low, none is positive.As a result such as table 3 below
Table 3
Sequence table
<110>Jinan Adicon Clinical Laboratories, lnc.
<120>The expression of detection fusion gene M LL/CBP and the other oligonucleotides of pattern of fusion and application
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ccgcccaagt atccctgtaa 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
atttggcacg ttggtgactg 20
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ccaatggcaa tagttctaag caa 23
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ggcagtagtg ggcatgtaga gat 23
<210> 5
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ctgtagggaa ggtgggcaa 19
<210> 6
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
agccagcaaa cagagcatgg tcaaca 26
<210> 7
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
gatacgaagg gagggtgtac ca 22
<210> 8
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
ctcggccagg gtgttgaa 18
<210> 9
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
gcttctgatg gcaagctcta cgtctcct 28
Claims (10)
1. the expression and the other oligonucleotides of pattern of fusion of detection fusion gene M LL/CBP, it is characterised in that including primer
MLL/CBP-8-F, MLL/CBP-8-R, MLL/CBP-9-F, MLL/CBP-10-F, MLL/CBP-9-10-R and probe are MLL/
CBP-Probe, the primer and probe sequence are as follows：
MLL/CBP-8-F:CCGCCCAAGTATCCCTGTAA
MLL/CBP-8-R:ATTTGGCACGTTGGTGACTG
MLL/CBP-9-F:CCAATGGCAATAGTTCTAAGCAA
MLL/CBP-10-F:GGCAGTAGTGGGCATGTAGAGAT
MLL/CBP-9-10-R:CTGTAGGGAAGGTGGGCAA
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA–TAMRA。
2. oligonucleotides according to claim 1, it is characterised in that for differentiating the primer MLL/CBP- of MLL/CBP-8
8-F, MLL/CBP-8-R and probe MLL/CBP-Probe；Primer MLL/CBP-9-F, MLL/CBP-9-10- of MLL/CBP-9
R and probe MLL/CBP-Probe；For differentiate primer MLL/CBP-10-F, MLL/CBP-9-10-R of MLL/CBP-10 with
And probe MLL/CBP-Probe.
3. oligonucleotides according to claim 1, it is characterised in that further include the primer for reference gene ABL detections
ABL-F, ABL-R and probe ABL-Probe, the primer and probe sequence are：
ABL-F:GATACGAAGGGAGGGTGTACCA
ABL-R:CTCGGCCAGGGTGTTGAA
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
4. the expression of detection fusion gene M LL/CBP and the kit of the other oligonucleotides of pattern of fusion, it is characterised in that bag
Include primer MLL/CBP-8-F, MLL/CBP-8-R, MLL/CBP-9-F, MLL/CBP-10-F, MLL/CBP-9-10-R and probe is
MLL/CBP-Probe, the primer and probe sequence are as follows：
MLL/CBP-8-F:CCGCCCAAGTATCCCTGTAA
MLL/CBP-8-R:ATTTGGCACGTTGGTGACTG
MLL/CBP-9-F:CCAATGGCAATAGTTCTAAGCAA
MLL/CBP-10-F:GGCAGTAGTGGGCATGTAGAGAT
MLL/CBP-9-10-R:CTGTAGGGAAGGTGGGCAA
MLL/CBP-Probe:FAM-AGCCAGCAAACAGAGCATGGTCAACA–TAMRA。
5. kit according to claim 4, it is characterised in that also contain erythrocyte cracked liquid.
6. kit according to claim 4, it is characterised in that further include positive reference substance and negative controls.
7. a kind of method for reducing fusion MLL/CBP testing costs, comprises the following steps：
(1) total serum IgE in blood sample is extracted；
(2) it is cDNA by the RNA reverse transcriptions extracted in step 1；
(3) real-time fluorescence PCR is combined using detection architecture PCR reaction solution 1, Preliminary detection is carried out to sample, if Preliminary detection knot
Fruit is shown as negative, then stops detection；
(4) if the testing result in step 3 is shown as positive, reacted respectively with detection architecture PCR reaction solution 2, detection architecture PCR
Liquid 3, detection architecture PCR reaction solution 4 combine real-time fluorescence PCR and carry out that particular type is other identifies to detection sample；
(5) result judges：Threshold line is adjusted to more than background signal and negative amplification line, draws Ct values；1) when internal reference is positive,
Testing result just thinks effective；2) positive criterion：Ct<36, for the positive；35≤Ct≤38, are the doubtful positive, it is necessary to again
Verification；Ct ＞ 38, for feminine gender.
It is 8. the method according to the description of claim 7 is characterized in that described
Detection architecture PCR reaction solution 1 includes：MLL/CBP-8-F、MLL/CBP-8-R、MLL/CBP-9-F、MLL/CBP-10-F、
MLL/CBP-9-10-R, probe MLL/CBP-Probe；
Detection architecture PCR reaction solution 2 includes MLL/CBP-8-F, MLL/CBP-8-R and probe MLL/CBP-Probe；
Detection architecture PCR reaction solution 3 includes MLL/CBP-9-F, MLL/CBP-9-10-R and probe MLL/CBP-Probe；
Detection architecture PCR reaction solution 4 includes MLL/CBP-10-F, MLL/CBP-9-10-R and probe MLL/CBP-Probe.
9. the expression and pattern of fusion method for distinguishing of detection fusion gene M LL/CBP, including
(1) total serum IgE in blood sample is extracted；
(2) it is cDNA by the RNA reverse transcriptions extracted in step 1；
(3) real-time fluorescence PCR is combined using detection architecture PCR reaction solution 1, Preliminary detection is carried out to sample, if Preliminary detection knot
Fruit is shown as negative, then stops detection；It is judged as MLL/CBP fusion types if Preliminary detection the results show is the positive；
(4) it is optional step, if the testing result in step 3 is shown as positive, respectively with detection architecture PCR reaction solution 2, detection
System PCR reaction solution 3, detection architecture PCR reaction solution 4 combine real-time fluorescence PCR and carry out the other progress of particular type to detection sample
Identification；
(5) result judges：Threshold line is adjusted to more than background signal and negative amplification line, draws Ct values；1) when internal reference is positive,
Testing result just thinks effective；2) positive criterion：Ct<36, for the positive；35≤Ct≤38, are the doubtful positive, it is necessary to again
Verification；Ct ＞ 38, for feminine gender.
10. according to the method described in claim 9,
Detection architecture PCR reaction solution 1 includes：MLL/CBP-8-F、MLL/CBP-8-R、MLL/CBP-9-F、MLL/CBP-10-F、
MLL/CBP-9-10-R, probe MLL/CBP-Probe；
Detection architecture PCR reaction solution 2 includes MLL/CBP-8-F, MLL/CBP-8-R and probe MLL/CBP-Probe；
Detection architecture PCR reaction solution 3 includes MLL/CBP-9-F, MLL/CBP-9-10-R and probe MLL/CBP-Probe；
Detection architecture PCR reaction solution 4 includes MLL/CBP-10-F, MLL/CBP-9-10-R and probe MLL/CBP-Probe.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711101232.6A CN108034702B (en) | 2017-11-10 | 2017-11-10 | Oligonucleotide for detecting expression condition and fusion type of fusion gene MLL/CBP and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711101232.6A CN108034702B (en) | 2017-11-10 | 2017-11-10 | Oligonucleotide for detecting expression condition and fusion type of fusion gene MLL/CBP and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108034702A true CN108034702A (en) | 2018-05-15 |
| CN108034702B CN108034702B (en) | 2021-09-17 |
Family
ID=62092802
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711101232.6A Active CN108034702B (en) | 2017-11-10 | 2017-11-10 | Oligonucleotide for detecting expression condition and fusion type of fusion gene MLL/CBP and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108034702B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113684261A (en) * | 2021-09-02 | 2021-11-23 | 济南艾迪康医学检验中心有限公司 | Primer, probe and kit for detecting ZNF384 gene rearrangement by using fluorescent quantitative PCR |
| CN114410783A (en) * | 2022-01-06 | 2022-04-29 | 合肥艾迪康医学检验实验室有限公司 | Oligonucleotide for detecting fusion type of fusion gene FNDC3B/RARA and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876799A (en) * | 2012-10-18 | 2013-01-16 | 北京大学人民医院 | Multiple real-time quantitative polymerase chain reaction (PCR) kit for detecting mixed lineage leukemia (MLL) relative fuse genes |
| CN103667453A (en) * | 2013-11-18 | 2014-03-26 | 福州艾迪康医学检验所有限公司 | Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes |
| CN105969866A (en) * | 2016-05-20 | 2016-09-28 | 武汉艾迪康医学检验所有限公司 | Primer, probe, composition and method for screening and identifying MLL rearrangement correlated fusion genes by utilizing multi-fluorescent polymerase chain reaction (PCR) technology |
-
2017
- 2017-11-10 CN CN201711101232.6A patent/CN108034702B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876799A (en) * | 2012-10-18 | 2013-01-16 | 北京大学人民医院 | Multiple real-time quantitative polymerase chain reaction (PCR) kit for detecting mixed lineage leukemia (MLL) relative fuse genes |
| CN103667453A (en) * | 2013-11-18 | 2014-03-26 | 福州艾迪康医学检验所有限公司 | Method, primers and probe for detecting relative expression quantity of 11q23/MLL fusion genes |
| CN105969866A (en) * | 2016-05-20 | 2016-09-28 | 武汉艾迪康医学检验所有限公司 | Primer, probe, composition and method for screening and identifying MLL rearrangement correlated fusion genes by utilizing multi-fluorescent polymerase chain reaction (PCR) technology |
Non-Patent Citations (2)
| Title |
|---|
| OLATOYOSI M.SOBULO ET AL: "MLL is fused to CBP, a histone acetyltransferase, in therapy-related acute myeloid leukemia with a t(11;16)(q23;p13.3)", 《PNAS》 * |
| 曹婷婷等: "应用多重巢式RT-PCR检测骨髓增生异常综合征中MLL基因相关的10种融合基因", 《中国实验血液学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113684261A (en) * | 2021-09-02 | 2021-11-23 | 济南艾迪康医学检验中心有限公司 | Primer, probe and kit for detecting ZNF384 gene rearrangement by using fluorescent quantitative PCR |
| CN113684261B (en) * | 2021-09-02 | 2024-04-30 | 济南艾迪康医学检验中心有限公司 | Primer, probe and kit for detecting ZNF384 gene rearrangement by utilizing fluorescence quantitative PCR |
| CN114410783A (en) * | 2022-01-06 | 2022-04-29 | 合肥艾迪康医学检验实验室有限公司 | Oligonucleotide for detecting fusion type of fusion gene FNDC3B/RARA and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108034702B (en) | 2021-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200370127A1 (en) | Biomarkers in Peripheral Blood Mononuclear Cells for Diagnosing or Detecting Lung Cancers | |
| US20230366034A1 (en) | Compositions and methods for diagnosing lung cancers using gene expression profiles | |
| CN110050075B (en) | Digital analysis of blood samples for determining efficacy of cancer therapies for specific cancers | |
| WO2010005991A2 (en) | Circulating tumor and tumor stem cell detection using genomic specific probes | |
| US7507534B2 (en) | Rapid efficacy assessment method for lung cancer therapy | |
| CN107523647A (en) | Detect the LncRNA combinations of early stage cancer of the esophagus prognosis situation and the kit containing the combination | |
| KR20190077309A (en) | Diagnosis and treatment of esophageal cancer | |
| CN108034702A (en) | The expression of detection fusion gene M LL/CBP and the other oligonucleotides of pattern of fusion and application | |
| CN107475363A (en) | Biomarker combination, the screening and its application of biomarker combination of a kind of non-small cell lung cancer | |
| CN109609634B (en) | Circulating miRNA marker related to endometrial cancer auxiliary diagnosis and application thereof | |
| US20110091482A1 (en) | Expression of kir in human cancer cells as a biomarker for immuno-escape and cancer metastasis | |
| CN115044676A (en) | Application of exosome miRNA in predicting immunotherapy effect of non-small cell lung cancer patient | |
| CN102109525B (en) | Kit for detecting free breast cancer cell marker in blood | |
| CN109136373A (en) | It is a kind of for early diagnosing the lncRNA detection kit and its application of lung cancer metastasis | |
| US20230014092A1 (en) | Materials and methods for monitoring inflammation | |
| CN111172285A (en) | miRNA group for early diagnosis and/or prognosis monitoring of pancreatic cancer and application thereof | |
| CN109957609A (en) | Utilize the kit of PCR- fluorescence probe method detection 155 nucleic acid quantification of MicroRNA | |
| CN1216291C (en) | Kit for real time fluorescence quantitative RT-RCR detection of human cancer embryoantigen | |
| CN109321640A (en) | Detect oligonucleotides, method and the kit of PSF-TFE3 fusion in sample | |
| CN108998528A (en) | Pulmonary cancer diagnosis molecular marked compound lncRNA LINC00516 and kit and its application | |
| CN102758006A (en) | Kit for detecting relative expression of leukemia BCR/ABL (b3a2, b2a2) fusion gene | |
| CN107475419A (en) | The application of KNDC1 genes and its expression product in oophoroma detection | |
| CN118272533A (en) | Marker for predicting effect of radiotherapy and chemotherapy on esophageal cancer and application thereof | |
| CN102121048A (en) | POOL FQ-PCR (Fluorescence Quantitive Polymerase Chain Reaction) combined detection method of tumor drug resistance genes and kit thereof | |
| Lakhotia et al. | Clinical applications of circulating tumor DNA in indolent B-cell lymphomas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |