CN102758006A - Kit for detecting relative expression of leukemia BCR/ABL (b3a2, b2a2) fusion gene - Google Patents

Abstract

The invention discloses a kit for detecting a relative expression of a leukemia BCR/ABL (b3a2, b2a2) fusion gene. The kit comprises erythrocyte lysing solution, TRIzol, chloroform, absolute ethyl alcohol, ReverTraAceqPCRRTKit, a detection system PRC solution, a positive reference substance and a negative reference substance. The kit is characterized in that the detection system PCR solution comprises THUNDERBIRDqPCRMIX, upstream and downstream primers for detecting a target gene are b3a2-F, b2a2-F, b3a2/b2a2-R and a b3a2/b2a2-probe, and primers for detecting a reference gene Abl are abl-F, abl-R and an abl-probe.

Description

Be used to detect white blood disease BCR/ABL (b3a2, b2a2) test kit of fusion gene relative expression quantity

Technical field

The invention belongs to life science and biological technical field; Particularly a kind of gene detecting kit; Adopt the probe for real-time fluorescence quantitative PCR technique, can to BCR/ABL in acute myeloblastic leukemia (AML) the patient body of human chronic myelocytic leukemia (CML), acute lymphoblastic leukemia (ALL) and minority (b3a2, b2a2) the fusion gene expression level detects; Can effectively practice thrift detection time, improve accuracy of detection.

Background technology

White blood disease is one type of clone's property malignant disease that hemopoietic stem cell is unusual.Leukemia cell among its clone loses the ability of further differentiation and maturation and is stuck in cytocerastic different steps.The a large amount of hyperplasia of leukemia cell are gathered and are soaked into other organs and tissue in marrow and other hemopoietic tissues, and normal hematopoiesis is suppressed, clinical manifestation be anaemia, hemorrhage, infect and each organ soaks into symptom.According to leukemia cell's maturity and natural history, white blood disease can be divided into acute and chronic two big types.The acute leukemia disease progression is rapid, and natural history only has several weeks to the several months.Generally can be divided into acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) two big classes according to leukemia cell's series ownership.And chronic leukemia is because the cell hyperplasia of differentiation and maturation of function is arranged, so chronic leukemia is a kind of because the signal conduction is bad or uncontrolled cellular proliferation institute illness extremely, but not dysmaturity extremely.Chronic leukemia is common to have chronic myelocytic leukemia (CML), lymphocytic leukemia (CLL).Because type of leukemia is different, regimen and prognosis also are not quite similar, after therefore diagnosis is set up, and further somatotype.About the cause and onset of disease mechanism of human leukemia, not clear fully yet so far.The known cause of disease has infective agent, ionizing rays, chemical substance, inherited genetic factors and immunologic dysfunction etc.Think that at present the white blood disease cause of disease is above various factors results of interaction.

It is long-armed that human abl gene is positioned at No. 9 karyomit(e)s, and 1b, 1a and 2～11 totally 12 exons are arranged.Transcribe and start from 1b or 1a, two kinds of mRNA length of formation are respectively 7kb and 6kb, and two kinds of protein molecular weights of synthetic all are about 145, and the former is positioned cytolemma, and the latter is mainly in nucleus.It is long-armed that the bcr gene is positioned at No. 22 karyomit(e)s, and 23 exons are arranged.The protein product molecular weight is 160.The 1st～63 amino acid of bcr albumen is Dimerized structure, participates in the polymeric formation of bcr albumen.Bcr albumen is participated in Cycle Regulation, but detailed process is also very not clear and definite.Bcr gene break point concentrates on three zones: main (major bcr, M-bcr), less important (minor bcr, m-bcr) and the μ (zone of μ-bcr).The abl gene break is positioned at the 1st or the 2nd intron.Because of breaking point differs, bcr/abl fusion gene and mRNA thereof and protein product are variety.The bcr gene break point of chronic myelocytic leukemia often is positioned at M-bcr, mainly is b2a2 and b3a2, and molecular weight of albumen is 210kb.

In practical application, be used to detect BCR/ABL (b3a2, b2a2) method of fusion gene expression level is mainly fluorescence in situ hybridization; Although this method is comparatively directly perceived, process of the test is too loaded down with trivial details, and the reagent type that needs is various; Waste time and energy; And test-results needs veteran expert come interpretation, and there is bigger subjectivity in interpretation as a result, thus to a certain degree limit the application of this method.

The real-time fluorescence quantitative PCR method has higher sensitivity and specificity, and can detect in real time PCR, can reflect accurately that (b3a2, expression b2a2) have been practiced thrift a large amount of detection times to the interior BCR/ABL of patient's body, have also avoided the generation of residual contamination.Common method has SYBR GreenI dye method, two probe hybridization methods and Taqman technology etc.Wherein SYBR GreenI is owing to be non-saturable dye, and specificity must be judged its specificity through observing solubility curve not as two probe hybridization methods and Taqman method; And two probe method hybrid method cost is comparatively expensive.Therefore this research adopts the real-time fluorescence PCR technology to combine the Taqman probe method to be applied to BCR/ABL (b3a2, gene test b2a2).

Summary of the invention

(the present invention has designed detection confidential reference items/goal gene with primer, probe sequence for b3a2, deficiency b2a2), detects white blood disease BCR/ABL (b3a2, b2a2) fusion gene relative expression quantity with fluorescent quantitative PCR technique in view of detecting BCR/ABL in the prior art.Through adjusting the primer concentration and probe concentration and the ratio of two genes, optimize reaction system and the reaction conditions of PCR, developed a kind of test kit that is used to detect white blood disease BCR/ABL fusion gene relative expression quantity.

Be used to detect white blood disease BCR/ABL (b3a2; B2a2) test kit of fusion gene relative expression quantity; Comprise erythrocyte cracked liquid, TRIzol, chloroform, absolute ethyl alcohol, ReverTraAce qPCRRT Kit, detection architecture PCR reaction solution, positive reference substance and negative control article, it is characterized in that:

Detection architecture PCR reaction solution comprises that THUNDERBIRD qPCR MIX, testing goal gene use downstream primer b3a2-F, b2a2-F, b3a2/b2a2-R; Probe b3a2/b2a2-Probe; Detect internal control gene Abl and use primer abl-F, abl-R, probe abl-Probe; Wherein,

b3a2-F：GATTTAAGCAGAGTTCA

b2a2-F：TGTGTGAAACTCCAGACTGT

b3a2/b2a2-R：TCCTTGGAGTTCCAACGA

b3a2/b2a2-Probe：FAM-AGCCCTTCAGCGGCCAGTAGCATCT-TAMRA

abl-F：GCCGTGAAGACCTTGAAGGAG

abl-R：ATGATATAGAACGGGGGCTC

abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。

Said positive reference substance is respectively the solution that contains b3a2, b2a2 gene; Said negative control article are the solution of no b3a2 and b2a2 gene.

The qPCR that ReverTraAce qPCRRT Kit wherein produces for TOYOBO company is with cDNA test kit product.

The quantitative PCR reagent that THUNDERBIRD qPCR MIX produces for TOYOBO company, product specification is QPS-101.

Use test kit of the present invention, real-time fluorescence PCR technology combined to adopt the Tapman probe, can to BCR/ABL (b3a2, b2a2) expression level of fusion gene detects, accuracy of detection is high, and simple to operate, can reduce the detection cost, practices thrift detection time.Adopt two calibration curve methods; Through make up BCR/ABL (b3a2, b2a2) with the standard quantitative curve of internal control gene abl, the internal control gene copy number of accurate quantification sample and BCR/ABL (b3a2; B2a2) copy number; Than in the past immunohistochemical methods method and Δ CT method now, this test kit has the precision height, and the result is convenient to advantages such as interpretation.This test kit primer, probe that reaction system is required carries out rational proportion and optimization in addition, makes experiment condition reach best, gropes link thereby saved loaded down with trivial details condition, promoted conventional efficient greatly.This test kit is good, highly sensitive, easy and simple to handle through the test specificity.Can be used for auxiliary early diagnosis, early prevention and the high risk population's of the acute myeloblastic leukemia (AML) of chronic myelocytic leukemia (CML), acute lymphoblastic leukemia (ALL) and minority screening clinically.

Description of drawings

Fig. 1: b2a2 positive findings synoptic diagram.

Fig. 2: b2a2 negative findings synoptic diagram.

Fig. 3: b3a2 positive findings synoptic diagram.

Fig. 4: b3a2 negative findings synoptic diagram.

Embodiment

Embodiment 1

Of the present invention be used to detect white blood disease BCR/ABL (b3a2, the b2a2) test kit of fusion gene relative expression quantity comprises:

Erythrocyte cracked liquid;

TRIzol；

Chloroform;

Absolute ethyl alcohol;

ReverTra Ace qPCR RT Kit (TOYOBO company);

Detection architecture PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2 *), b3a2/b2a2 upstream and downstream each 0.8uM of primer, b3a2/b2a2-probe (probe) 0.4uM; Abl upstream and downstream each 0.8uM of primer, abl-probe (probe) 0.4uM; Wherein:

b3a2-F：GATTTAAGCAGAGTTCA；

b2a2-F：TGTGTGAAACTCCAGACTGT；

b3a2/b2a2-R：TCCTTGGAGTTCCAACGA；

b3a2/b2a2-Probe：FAM-AGCCCTTCAGCGGCCAGTAGCATCT-TAMRA；

abl-F：GCCG?TGAAGACC?TTGAAGGAG；

abl-R：ATGATATAGAACGGGGGCTC；

abl-Probe：FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA

Positive reference substance: contain BCR/ABL (b3a2, b2a2) genome solution respectively;

Negative control article: do not contain BCR/ABL (b3a2, b2a2) genome solution.

Embodiment 2

The method of use of test kit of the present invention:

(1) organizes RNA in the extracting blood: in the centrifuge tube of the 1.5ml of cleaning, add the 1ml erythrocyte cracked liquid, get anticoagulation 0.5ml mixing.Room temperature leaves standstill 10min; The centrifugal 5min of 5000rpm abandons supernatant, collects the cell of bottom; Add the 0.5ml erythrocyte cracked liquid once more, the centrifugal 5min of 5000rpm abandons supernatant, collects the cell of bottom; In cell, add 1ml TRIzol, blow and beat repeatedly until deposition dissolving fully, the static 5min of room temperature; Add the 0.2ml chloroform, concussion evenly; 4 ℃ of centrifugal 10min of 14000rpm draw the supernatant layer and are transferred in another new centrifuge tube; Add isopyknic Virahol, abundant up and down mixing, room temperature leaves standstill 10min; 4 ℃ of centrifugal 10min of 14000rpm abandon supernatant, add 75% ethanol 1ml, and washing tube wall gently turns upside down; 4 ℃ of centrifugal 5min of 14000rpm abandon ethanol; Drying at room temperature 10-15min adds 20ulRNase-free water dissolution deposition.

(2) with reference to the Rever Tra Ace qPCR RT Kit test kit specification sheets of TOYOBO company, RNA is reversed to cDNA.

(3) reagent configuration: by detecting each X ul of people's umber configuration detection system PCR reaction solution, everyone part 23ul packing:

X=23ul reaction solution * (8 parts of confidential reference items (typical curve)+8 part goal gene (typical curve)+n part sample+1 part of positive control+1 part negative control+1 part of blank);

(4) application of sample: add 2ulcDNA in the detection architecture PCR reaction solution; Positive control and negative control directly add 2ul positive reference substance and negative control article; Blank adds 2ul saline water or does not add any material.

(5) detect: detect and on the real-time fluorescence PCR appearance, carry out, available instrument comprises ABI7300,7500 (U.S. Applied Biosystems companies) etc.Reaction conditions: 95 ℃ of preparatory sex change 1min; 95 ℃ of 15s, 40 circulations of 58 ℃ of 35sec, fluorescent signal is gathered when 58 ℃ of 35sec.

(6) result judges: threshold line is adjusted to background signal and negative the amplification more than the line, and system calculates copy number automatically according to typical curve and CT value.

When 1) confidential reference items were positive, it is effective that detected result is just thought;

2) positive judgement criteria:, Ct＜36, positive; 35≤Ct≤38 are the doubtful positive, need checking once more; Ct＞38, negative.

Embodiment 3

Adopt kit for detecting nucleic acid of the present invention to detect clinical samples

Fetch and deliver acute myeloblastic leukemia (AML) patient anticoagulation sample 20 examples of chronic myelocytic leukemia (CML), acute lymphoblastic leukemia (ALL) and the minority of inspection, press embodiment 2 said methods and extract geneome RNA, reagent preparation and detection.

Every part of sample adds 2ul in the detection architecture PCR reaction solution.Do the positive simultaneously, feminine gender, blank, each portion of the typical curve of internal control gene/goal gene.The fluorescent PCR appearance in one 96 hole can detect 38 duplicate samples simultaneously, and each sample repeats a positive control, a negative control and a blank 2 times.Be merely 100 minutes detection time.

Experimental result is compared with breadboard the reporting the result of special inspection, confirms the accuracy rate of sample detection.Part positive findings such as following table:

Table 1 is this experimental result and PCR Lab result's contrast.Can find out have 45 examples to conform to the detected result of PCR in the 46 routine samples from last table, coincidence rate reaches 97.8%.Explain that detection kit of the present invention and spy examine and utilize conventional fluorescent quantitation method to compare that not only the detected result accuracy is high, and has shortened detection time, has improved detection efficiency.

Embodiment 4 clinical samples detect

Get 4 parts of clinical samples to be checked, press embodiment 2 said methods and extract genome, reagent preparation and detection.

Every duplicate samples adds 2ul in the detection architecture PCR reaction solution.Do the positive simultaneously, feminine gender, each portion of blank.Detect with the fluorescent PCR appearance, the time is 100 minutes.

The detected result figure of sample 1 is as shown in Figure 1, and the amplified signal of internal control gene abl shows that seized sample genome extracts successfully, and detected result is effective, before b2a2CT value＜36 of sample 1 amplified signal is arranged, so sample 1 is the b2a2 positive.

The detected result figure of sample 2 is as shown in Figure 2, and the amplified signal of internal control gene abl shows that seized sample genome extracts successfully, and detected result is effective, does not have amplified signal after b2a2CT value＞38 of sample 2, so sample 2 is the b2a2 feminine gender.

The detected result figure of sample 3 is as shown in Figure 3, and the amplified signal of internal control gene abl shows that seized sample genome extracts successfully, and detected result is effective, before b3a2CT value＜36 of sample 3 amplified signal is arranged, so sample 3 is the b3a2 positive.

The detected result figure of sample 4 is as shown in Figure 4, and the amplified signal of internal control gene abl shows that seized sample genome extracts successfully, and detected result is effective, does not have amplified signal after b3a2CT value＞38 of sample 4, so sample 4 is the b3a2 feminine gender.

SEQUENCE?LISTING

 

< 110>the limited company of Wuhan Ai Dikang medical test

 

< 120>be used to detect white blood disease BCR/ABL (b3a2, b2a2) test kit of fusion gene relative expression quantity

 

<130>

 

<160> 7

 

<170> PatentIn?version?3.3

 

<210> 1

<211> 17

<212> DNA

< 213>artificial sequence

 

<400> 1

gatttaagca?gagttca 17

 

 

<210> 2

<211> 20

<212> DNA

< 213>artificial sequence

 

<400> 2

tgtgtgaaac?tccagactgt 20

 

 

<210> 3

<211> 18

<212> DNA

< 213>artificial sequence

 

<400> 3

tccttggagt?tccaacga 18

 

 

<210> 4

<211> 25

<212> DNA

< 213>artificial sequence

 

<400> 4

agcccttcag?cggccagtag?catct 25

 

 

<210> 5

<211> 21

<212> DNA

< 213>artificial sequence

 

<400> 5

gccgtgaaga?ccttgaagga?g 21

 

 

<210> 6

<211> 20

<212> DNA

< 213>artificial sequence

 

<400> 6

atgatataga?acgggggctc 20

 

 

<210> 7

<211> 20

<212> DNA

< 213>artificial sequence

 

<400> 7

acctggtgca?gctccttggg 20

 

 

Claims (2)

1. be used to detect white blood disease BCR/ABL (b3a2; B2a2) test kit of fusion gene relative expression quantity; Comprise erythrocyte cracked liquid, TRIzol, chloroform, absolute ethyl alcohol, ReverTra Ace qPCR RT Kit, detection architecture PCR reaction solution, positive reference substance and negative control article, it is characterized in that:

Detection architecture PCR reaction solution comprises that THUNDERBIRD qPCR MIX, testing goal gene use downstream primer b3a2-F, b2a2-F, b3a2/ b2a2-R; Probe b3a2/b2a2-Probe; Detect internal control gene Abl and use primer to be abl-F, abl-R, probe abl-Probe; Wherein,

b3a2-F:?GATTTAAGCAGAGTTCA

b2a2-F:?TGTGTGAAACTCCAGACTGT

b3a2/b2a2-R:?TCCTTGGAGTTCCAACGA

b3a2/b2a2-Probe:?FAM-AGCCCTTCAGCGGCCAGTAGCATCT-TAMRA

abl-F:?GCCGTGAAGACCTTGAAGGAG

abl-R:?ATGATATAGAACGGGGGCTC

abl-Probe:?FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA。

2. test kit as claimed in claim 1 is characterized in that said positive reference substance is respectively the solution that contains b3a2, b2a2 gene; Said negative control article are the solution of no b3a2 and b2a2 gene.

Images