CN104561373B - Kit for detecting goldfish haematopoietic necrosis virus and application thereof - Google Patents
Kit for detecting goldfish haematopoietic necrosis virus and application thereof Download PDFInfo
- Publication number
- CN104561373B CN104561373B CN201410773825.7A CN201410773825A CN104561373B CN 104561373 B CN104561373 B CN 104561373B CN 201410773825 A CN201410773825 A CN 201410773825A CN 104561373 B CN104561373 B CN 104561373B
- Authority
- CN
- China
- Prior art keywords
- primer
- goldfish
- kit
- hematopoietic necrosis
- quantitative pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for detecting goldfish haematopoietic necrosis virus. The invention provides a real-time fluorescence quantitative PCR (Polymerase Chain Reaction) primer and a probe for detecting goldfish haematopoietic necrosis virus at first, wherein the sequences are respectively represented by SEQ ID NO2, SEQ ID NO3 and SEQ ID NO4. The invention further provides a method for detecting goldfish haematopoietic necrosis virus by using the primer and the probe through fluorescence quantitative PCR. The detection method and the detection kit disclosed by the invention have the advantages of being accurate to detect, high in sensitivity and specificity, simple, convenient and rapid, and have good clinical sample detection capability.
Description
Technical field
The present invention relates to biology field, more particularly to it is used for detecting the glimmering of goldfish Hematopoietic Necrosis disease virus
Light quantitation pcr primer and probe, the invention still further relates to carry out goldfish Hematopoietic Necrosis disease virus inspection using this primer and probe
The method surveyed and kit.
Background technology
Goldfish Hematopoietic Necrosis disease virus (goldfish haematopoietic necrosis virus, gfhnv),
Also referred to as carp herpesviral -2 (cyprinid herpesvirus 2, cyhv-2), is goldfish Hematopoietic Necrosis disease
The cause of disease of (goldfish haematopoietic necrosis, gfhn), is a kind of infection goldfish (carassius
Auratus), the highly pathogenic double-strand dna virus of crucian carp (carassius auratus) and its mutation.This virus is once in Japan, Australia
Big Leah, New Zealand, Britain, Hungary and China's Taiwan outburst epidemic disease, the morbidity goldfish death rate is up to 100%.
At present, lack the antibody of the clone sensitive to gfhnv and anti-gfhnv both at home and abroad, therefore cannot be using virus
Separate and immunological method detects this virus.The research of the detection method viral to this focuses primarily upon sets up molecular biology inspection
Survey method detects viral nucleic acid, including the detection of pcr method, fluorescent quantitation pcr method and loop-mediated isothermal amplification technique (lamp)
Method.
The at present pcr detection method for gfhnv of report, its test limit be less than fluorescent quantitation pcr detection method and
Lamp detection method, and need to carry out gel electrophoresis to amplified production to observe result, easily cause ethidium bromide pollution；
If the lamp detection method reaction time is long, easily produce false positive, and because product is excessive, also easily cause nucleic acid dirty
Dye；Some fluorescent quantitation pcr detection methods of report are unstable at present, and testing result produces false negative sometimes.
Content of the invention
It is an object of the invention to provide for the specific primer and the probe that detect goldfish Hematopoietic Necrosis disease virus.
Further object is that providing the fluorescent quantitation pcr method of detection goldfish Hematopoietic Necrosis disease virus
And its kit.
For achieving the above object, the present invention enters to the dna sequence of known goldfish Hematopoietic Necrosis disease virus specific gene
Row compares, and filters out the distinguished sequence of goldfish Hematopoietic Necrosis' disease virus genes, i.e. gfhnv main capsid protein (mcp) gene
In one section of conserved sequence (2307-2464), its nucleotide sequence is as shown in seq id no.1.
The present invention is provided to the primer of the detection goldfish Hematopoietic Necrosis viral above-mentioned distinguished sequence of disease, and with described
The fluorescence probe that primer uses cooperatively.Wherein, probe 5 ' mark fluorescent group fam, 3 ' mark tamran.This special primer expands
The nucleotide sequence of product is as shown in seq id no.1.
In an embodiment of the invention, preferred primer sequence is:
Upstream primer: caaacccagcaccgtcagatggt (seq id no.2)
Downstream primer: atccggcacaggtggcgtgt (seq id no.3).
Fluorescence probe sequence is:
5’-fam-ttggatctgctgcgccctgtttgacag-tamran(seq id no.4).
The invention provides above-mentioned primer and fluorescence probe are in preparation detection goldfish Hematopoietic Necrosis disease virus agent box
In application.
The present invention provides a kind of goldfish Hematopoietic Necrosis the real time fluorescent quantitative pcr detection method of disease virus, including with
The total dna of sample is template, and using the present invention, the primer providing and probe carry out real time fluorescent quantitative pcr, set up no template simultaneously
Comparison and positive control, according to amplification curve result of determination.
The real time fluorescent quantitative pcr amplification reaction system of the present invention, when for 25 μ l reaction system, it is preferably configured to:
The response procedures of the real time fluorescent quantitative pcr of the present invention are: 95 DEG C of denaturations 3min, 1 circulation；95 DEG C of denaturation
30s, 55～65 DEG C of annealing 30s, 40 circulations.
The response procedures of currently preferred real time fluorescent quantitative pcr are: 95 DEG C of denaturations 3min, 1 circulation；95 DEG C of changes
Property 30s, 59 DEG C annealing 30s, 40 circulation.
The present invention detects every time and must set up negative control and positive control during sample, and two kinds compare as effective expansion in the detection
During increasing, sample results criterion is as follows:
During ct value≤38.0, sample result is the positive；The sample result of ct value ＞ 38.0 is feminine gender.
The invention provides a kind of kit for goldfish Hematopoietic Necrosis disease Viral diagnosis, it is special that it includes above-mentioned energy
Strange land amplifies as shown in the seq id no.1 primer of nucleotide sequence or its specific fragment and cooperation primer uses
Taqman probe.
The primer sequence of kit of the present invention is:
Upstream primer: caaacccagcaccgtcagatggt (seq id no.2)
Downstream primer: atccggcacaggtggcgtgt (seq id no.3).
Fluorescence probe sequence is:
5’-fam-ttggatctgctgcgccctgtttgacag-tamran(seq id no.4).
The kit that the present invention provides, also includes dna lysate, fluorescent quantitation reactant liquor, negative template and positive template,
Described feminine gender template is distilled water, and described positive template is goldfish Hematopoietic Necrosis' disease virus genes group dna.
The invention provides for the specific primer and the probe that detect goldfish Hematopoietic Necrosis disease virus, establishing inspection
Survey the fluorescent quantitation pcr method of goldfish Hematopoietic Necrosis disease virus, there is very high detection sensitivity, 100 can be detected
The goldfish Hematopoietic Necrosis disease virus dna of individual copy；The method high specificity, it is reproducible, can be used as the clinical mark of detection
This means, improve the positive rate of goldfish Hematopoietic Necrosis disease Viral diagnosis, simple to operate, detection process only needs 90 minutes,
Greatly shorten detection cycle, testing result is directly observed using fluorescent quantitation pcr instrument, not there is a problem of that ethidium bromide pollutes.
The detection kit that the present invention provides, its reaction system contains above-mentioned primer, probe and feminine gender, positive control, this kit
Popularization and application will be preventing and treating and monitoring goldfish Hematopoietic Necrosis disease virosis provide technical support.
Brief description
Fig. 1 is goldfish Hematopoietic Necrosis disease FLuorescent quantitative pcr Evaluation on specificity, and in figure curve is goldfish hematopoiesis device
The response curve of official's IPNV；
Fig. 2 is that goldfish Hematopoietic Necrosis disease FLuorescent quantitative pcr test limit measures (1), in figure 4-10 curve, point
Not being corresponding in turn to dna template amount is 104Copy -1010The response curve that the reaction system of copy amplifies.
Fig. 3 is goldfish Hematopoietic Necrosis disease FLuorescent quantitative pcr calibration curve (1)
Fig. 4 is that goldfish Hematopoietic Necrosis disease FLuorescent quantitative pcr test limit measures (2), in figure 1-5 curve, point
Not being corresponding in turn to dna template amount is 101Copy -105The response curve that the reaction system of copy amplifies.
Fig. 5 is goldfish Hematopoietic Necrosis disease FLuorescent quantitative pcr calibration curve (2)
Specific embodiment
Following examples further illustrate present disclosure, but should not be construed as limitation of the present invention.Without departing substantially from
In the case of present invention spirit and essence, the modification that the inventive method, step or condition are made or replacement, belong to the present invention
Scope.
If not specializing, the conventional meanses that in embodiment, technological means used is well known to those skilled in the art.
Embodiment 1 goldfish Hematopoietic Necrosis disease virus specific primers and the design of probe
The dna sequence of known goldfish Hematopoietic Necrosis disease virus specific gene is compared, filters out goldfish hematopoiesis
The distinguished sequence of organ necrosis disease virus genes, i.e. one section of conserved sequence (2307- in gfhnv main capsid protein (mcp) gene
2464), its nucleotide sequence is as shown in seq id no.1.When design primer is with probe, note avoiding the catastrophe point of sequence, warp
Repeated screening and checking, obtain a pair for detect goldfish Hematopoietic Necrosis disease virus fluorescent quantitation pcr primer and with draw
The probe that thing uses cooperatively,
Upstream primer: caaacccagcaccgtcagatggt (seq id no.2)
Downstream primer: atccggcacaggtggcgtgt (seq id no.3).
Fluorescence probe sequence is:
5’-fam-ttggatctgctgcgccctgtttgacag-tamran(seq id no.4).
Embodiment 2 detects the foundation of the fluorescent quantitation pcr detection method of goldfish Hematopoietic Necrosis disease virus
1st, as the construction of recombinant plasmid of positive control.
Genes of interest is connected into t carrier, connection product is transformed into Escherichia coli dh5 α competent cell, by blue hickie
Technology screening recombinant plasmid.Using commercialization plasmid purification kit purification recombinant plasmid.
Every group of sample all sets up 1 positive control sample and negative control sample.Positive control sample is above-mentioned restructuring matter
Grain；Negative control sample is deionized water.
2nd, the power according to ct value and fluorescence signal to be judging optimal conditions, optimal conditions in combination as final
Optimization system.
Annealing temperature is optimized between 55 DEG C～65 DEG C；mg2+Concentration is optimized between 1.5～5mm；dntps
Concentration is optimized between 2～5.8mm.The final goldfish Hematopoietic Necrosis disease FLuorescent quantitative 25 μ l pcr determining is anti-
System is answered to be shown in Table 1:
Table 1 goldfish Hematopoietic Necrosis disease FLuorescent quantitative pcr reaction system
3rd, real time fluorescent quantitative pcr reaction condition
Set up no template control and positive control, according to amplification curve result of determination simultaneously.
4th, after reaction terminates, show that picture judges testing result according to fluorescent quantitation pcr instrument:
Negative sample does not have amplification curve to occur, and positive has obvious amplification curve, and ct value is less than 25.Now negative
Comparison and positive control are all set up, and testing sample can be played with comparison effect；If testing sample amplification curve ct value is less than or waits
In 38, then illustrate that sample is that gfhnv nucleic acid is positive；If testing sample no amplification curve, or amplification curve ct value is more than 38, then sample
Product are that gfhnv nucleic acid is negative.
The evaluating characteristics of embodiment 3 goldfish Hematopoietic Necrosis disease FLuorescent quantitative pcr detection method
1st, sensitivity evaluation, sensitivity is the LDL of real-time pcr.
Positive reference dna original liquid concentration is 1010copies/μl.First by its 10 times of gradient dilutions to 10copies/ μ l, then
Respectively with each dilution solution as template, expanded using the fluorescent quantitation pcr method that the embodiment of the present invention 2 is set up,
Determine the minimum template amount that can detect of the method.According to testing result, this fluorescent quantitation pcr method is minimum to be can detect that
The dna template of 100 copies.
2nd, specificity evaluation.
The fluorescent quantitation pcr method set up using the embodiment of the present invention 2, to goldfish hematopoietic necrosis virus, bright and beautiful carp blister
Exanthema virus (khv), infectious hematopoietic necrosis' poison (ehnv), Shelled Turtle Trionyx Sinensis irido virus (stiv), channel catfish virus
And the prawn white spot disease virus aquatic products virus such as (wssv) is detected, result is shown in Fig. 1 (ccv).Fig. 1 shows only gfhnv sample
(arrow indication) has curve, other viral dna no curves, illustrates the inventive method to khv, ehnv, stiv, ccv and wssv no
Cross reaction, assumes the positive to goldfish Hematopoietic Necrosis disease Viral diagnosis result.Illustrate that the inventive method has excellent spy
The opposite sex.
Embodiment 4 detects the clinical practice of goldfish Hematopoietic Necrosis disease virus
1st, the extraction of sample dna to be picked up
Sick goldfish to be checked, takes liver,spleen,kidney, brain and the gill.
Fish tissues are mixed, after grinding to form pasty state, using phenol chloroform or commercialization tissue dna extracts kit, extracts sample
The total dna of product.
Using the total dna extracting as template, using the gfhnv fluorescent quantitation pcr detection method detection of the embodiment of the present invention 2
Whether infect gfhnv.
2nd, using traditional pcr method detection gfhnv, above-mentioned measuring samples are verified.Primer sequence: upstream primer:
cccagcaacatgtgcgacgg；Downstream primer: ccgtartgagagttggcgca；Genes of interest length 362bp.
Result shows the gfhnv fluorescent quantitation pcr detection that the testing result of this conventional method is set up with the embodiment of the present invention 2
The positive findings of method detection is all consistent with negative findings, and the gfhnv fluorescent quantitation pcr detection method that the present invention sets up is described
Have compared with high-accuracy.
Although, above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to the scope of protection of present invention.
Claims (7)
1. a kind of specific primer for detecting goldfish Hematopoietic Necrosis disease virus, the nucleotide sequence of its amplified production is such as
Shown in seq id no.1；
Its nucleotides sequence is classified as:
Upstream primer: caaacccagcaccgtcagatggt,
Downstream primer: atccggcacaggtggcgtgt.
2. the fluorescence probe using cooperatively with specific primer described in claim 1, its nucleotides sequence is classified as:
5’-fam-ttggatctgctgcgccctgtttgacag-tamran.
3. the primer described in claim 1 and the fluorescence probe described in claim 2 are in preparation detection goldfish Hematopoietic Necrosis
Application in sick virus agent box.
4. the kit containing the primer described in claim 1 and the fluorescence probe described in claim 2.
5. kit as claimed in claim 4 is it is characterised in that with the total dna of sample as template, using described in claim 1
Primer and probe described in claim 2 carry out real time fluorescent quantitative pcr, according to amplification curve result of determination.
6. kit as claimed in claim 5 is it is characterised in that its 25 μ l real time fluorescent quantitative pcr work system is:
7. kit as claimed in claim 5 is it is characterised in that the response procedures of real time fluorescent quantitative pcr are: 95 DEG C of pre- changes
Property 3min, 1 circulation；95 DEG C of denaturation 30s, 59 DEG C of annealing 30s, 40 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410773825.7A CN104561373B (en) | 2014-12-12 | 2014-12-12 | Kit for detecting goldfish haematopoietic necrosis virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410773825.7A CN104561373B (en) | 2014-12-12 | 2014-12-12 | Kit for detecting goldfish haematopoietic necrosis virus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104561373A CN104561373A (en) | 2015-04-29 |
| CN104561373B true CN104561373B (en) | 2017-01-18 |
Family
ID=53078447
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410773825.7A Expired - Fee Related CN104561373B (en) | 2014-12-12 | 2014-12-12 | Kit for detecting goldfish haematopoietic necrosis virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104561373B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110218815B (en) * | 2018-03-02 | 2022-11-01 | 深圳出入境检验检疫局食品检验检疫技术中心 | Kit for detecting koi herpesvirus |
| CN110592273A (en) * | 2018-06-13 | 2019-12-20 | 杭州众测生物科技有限公司 | RAA constant-temperature fluorescence detection method and reagent for cyprinid herpesvirus II (CyHV-2) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045764A (en) * | 2013-01-18 | 2013-04-17 | 中国水产科学研究院长江水产研究所 | CyHV-2 (Cyprinid herpesvirus II) LAMP (loop-mediated isothermal amplification) detection kit and detection method |
-
2014
- 2014-12-12 CN CN201410773825.7A patent/CN104561373B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104561373A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103966358B (en) | A kind of mandarin fish infectious spleen and kidney necrosis virus fluorescent quantificationally PCR detecting kit and detection method | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN106947838A (en) | African swine fever virus nonstructural gene real-time fluorescence LAMP detection primer group, kit and detection method | |
| CN103382507B (en) | 1 type and 3 type duck hepatitis A virus (HAV) single stage method dual RT-PCR detection kit, primer pair and method | |
| CN110205407A (en) | Quickly the RAA amplimer and probe of detection carp edema virus and detection kit and application method | |
| CN107828914B (en) | RAA constant temperature fluorescence detection method and reagent for Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) | |
| CN105039586A (en) | Primer and kit for detecting duck type-II adenovirus | |
| CN106048022A (en) | Kit for detecting enterocytozoonhepatopenaei | |
| CN108866244A (en) | Detect RPA primer and probe, kit and its method of prawn irido virus | |
| CN105002298B (en) | A kind of fluorescent quantitative PCR detection method of huichun viremia virus | |
| CN107988326A (en) | Prawn Acute Hepatic pancreatic necrosis（AHPND）RAA constant temperature fluorescence detection method and reagent | |
| CN101240351A (en) | Real time quantitative PCR determination method for lymphatic cyst virus | |
| CN103509880A (en) | LAMP detection kit of highly-pathogenic porcine reproductive and respiratory syndrome viruses | |
| CN110592268A (en) | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) | |
| CN113913543B (en) | EHP real-time fluorescence quantitative PCR detection primer probe combination, kit and method | |
| CN104561373B (en) | Kit for detecting goldfish haematopoietic necrosis virus and application thereof | |
| CN109913583A (en) | A kind of primer and its method of quick detection Koi herpesvirus | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN105567874A (en) | Porcine delta coronavirus fluorogenic quantitative PCR detection kit and non-diagnostic detection method | |
| CN110257561B (en) | Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application | |
| CN104561383A (en) | Influenza A virus and B virus joint detection primer, probe, kit and application | |
| CN110964848A (en) | RAA amplification primer and probe for rapidly detecting carp herpesvirus II, detection kit and use method | |
| CN101831508B (en) | Quantitative detection method of tea-geometrid-type polyhedrosis viruses | |
| CN105779443B (en) | The Primer composition of identification or auxiliary identification oyster herpetovirus | |
| CN102676697A (en) | Primers and probe for detecting peste des petits ruminants virus and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170118 Termination date: 20201212 |