CN102094070A

CN102094070A - mRNA in-situ hybridization kit for detecting overexpression of HER2

Info

Publication number: CN102094070A
Application number: CN2009102003770A
Authority: CN
Inventors: 穆海东; 汪宁梅; 穆宇豪; 黎飒
Original assignee: SHANGHAI YULONG CLINICAL TESTING CENTER CO Ltd
Current assignee: SHANGHAI YULONG CLINICAL TESTING CENTER CO Ltd
Priority date: 2009-12-11
Filing date: 2009-12-11
Publication date: 2011-06-15

Abstract

The invention discloses an RNA in-situ hybridization (ISH) kit for detecting overexpression of human epidermal growth factor receptor (EGFR) 2 (HER2) genes of breast cancer patients and belongs to the field of molecular pathological diagnosis. The kit comprises stationary solution, PBS-BufferI, PBS-BufferII, PBS-BufferIII, digestive juice, prehybridization solution, hybridization solution, Washing BufferI, Washing BufferII, buffer solution I, buffer solution II, blocking liquid, development solution I, development solution II, and a positive control tissue glass plate. Reference basis is provided for diagnosing positive breast cancer patients and important clinical value for early diagnosis of breast cancer and formulation of personalized medicines is provided by detecting the expression level of HER2.

Description

The mRNA hybridization in situ detection kit of HER2 overexpression

Technical field

The invention belongs to the molecular pathology diagnostic field, relate in particular to a kind of RNA in situ hybridization (ISH) detection kit that in clinical sample, detects patient with breast cancer human epidermal growth factor receptor 2 (HER2) gene overexpression.

Background technology

Mammary cancer is seriously threatening people's health, nearly all crowd's breast cancer incidence is all rising, raise 1% approximately every year on average, estimate that the whole world annual morbidity patient surpasses 1,000,000, " the national for the third time coroner's inquest main condition " of Ministry of Health's issue in 2008 show, the M ﹠ M of mammary cancer is all in rising trend in worldwide, and the morbidity crowd is more and more younger.Data according to the World Health Organization: the whole world has 1,400,000 women to suffer from mammary cancer every year approximately, has 400,000 women to die from mammary cancer.In China, mammary cancer has become the first place that occupies women's mortality of malignant tumors, and the Shanghai breast cancer incidence ranks first in the whole country, up to 60,/10 ten thousand people.The latest survey report of Ministry of Health's issue simultaneously shows that mammary cancer has become one of the fastest malignant tumour of China's ascensional range, and patient's quantity has risen 96% in the period of 30 in the past, and increasing degree is only second to lung cancer, and the high risk population is based on 45～one's mid-50s women in morbidity.

At present the mammary cancer zooming reason of falling ill is still not fully aware of, it is generally acknowledged relevant with the mode of life of heredity, reproduction factor, spiritual environment factor, westization etc.But pathological study finds that mammary cancer and human epidermal growth factor acceptor-2 (HER2) is in close relations.HER2 is produced by the HER2 expression of proto-oncogenes, is a kind of breast cancer cell surface that is present in.Take place with mammary cancer and develop closely-related protein.As proto-oncogene, what HER2 expressed is a danger signal and factor, and its state has indicated short, easier recurrence of patient of the time of patient's survival and result of treatment etc.If do not treat, HER2 is positive, and the patient with breast cancer is 1～3 year the survival time, and the HER2 negative patients can be survived 4～6 years at least.According to statistics, the positive phenomenon of HER2 (human epidermal growth factor acceptor 2) appears in nearly 20%～30% patient with breast cancer, its HER2 protein expression increases, and that the overexpression of HER2 is often indicating is insensitive to endocrine therapy, tumour progression fast, recurrence takes place easily and shift.

Each patient with breast cancer's progression of disease situation is not exclusively the same, in case be diagnosed as mammary cancer, should carry out the HER2 pathology detection immediately, makes the clinician can judge the state and the type of patient's mammary cancer all sidedly, so that implement effective individuation targeted therapy.Clinically, nearly a fraction of HER2 male breast cancer cell is also expressed oestrogenic hormon and progesterone receptor, yet the quantity of acceptor is less than the breast cancer cell of HER2 feminine gender greatly.Therefore, HER2 male patient is insensitive to endocrine therapy medicines such as tamoxifens, and this has brought trouble not only for the positive patient with breast cancer's of HER2 treatment, and the possibility that the patient is recurred increases greatly.Clinically also confirm that compare with general patient with breast cancer, the positive patient with breast cancer's of HER2 growth of cancer cells is more rapid, occurs the recurrence and the transfer of tumour in a short time easily, shorten lifetime.Therefore, in order to catch best occasion for the treatment, the patient of mammary cancer should carry out HER2 and detect; In American-European countries, all patient with breast cancers make a definite diagnosis all can do the HER2 detection, and to investigate speed of worsening cancer faster, this also is the major reason that external patient with breast cancer's treatment is more reasonable, life quality is higher.

Usually, adopt immunohistochemical method (IHC) clinically, colour developing in situ hybridization method (CISH) or fluorescent dye body in situ hybridization method (FISH) detect the overexpression of HER2.If in the postoperative pathological diagnosis report of patient with breast cancer, indicate immunohistochemical method (IHC) detected result and be (+++), the in situ hybridization method that promptly develops the color (CISH) detected result is positive, or fluorescent dye body in situ hybridization method (FISH) detected result is positive, so, she is exactly the positive patient with breast cancer of HER2.If the IHC detected result is (++), FISH is in suggestion again or CISH detects.For this immunohistochemical method (IHC) detected result is patient's (++) of criticality, must do one time more again to determine whether it is the HER2 positive.But the repeating of same procedure exists the shortcoming that lacks comparability and contrast property, needs more method badly and detects crossing of HER2 and express and help us and make a definite diagnosis the positive patient with breast cancer of HER2, so that the treatment plan of carrying out individuation early.

(In situ hybridization is that molecular biology, histological chemistry and cytology combine and an emerging technology producing ISH) to hybridization in situ technique, starts from the sixties in 20th century.(1969) such as Gall of Yale in 1969 are at first with Xenopus laevis ribosome gene probe and the hybridization of its ovocyte, this gene is positioned, meanwhile Buongiorno-Nardelli and Amaldi etc. (1970) utilize the isotopic labeling nucleic acid probe to carry out the assignment of genes gene mapping of cell or tissue in succession, thereby have created hybridization in situ technique.Henceforth, because the fast development, particularly late 1970s of Protocols in Molecular Biology be to the beginning of the eighties, the successfully constructing of molecular cloning, plasmid and phage DNA is for deep technical foundation has been established in the development of hybridization in situ technique.

The ultimate principle of hybridization in situ technique is to utilize the complementary base sequence is arranged between the nucleic acid molecule strand, DNA to be measured or RNA complementary pairing on radioactivity or inactive exogenous nucleic acid (being probe) and tissue, cell or the karyomit(e) will be arranged, be combined into single-minded nucleic acid hybridization molecules, the position display of determined nucleic acid on tissue, cell or karyomit(e) come out through certain detection means.Can be divided into DNA-DNA again, RNA-DNA, RNA-RNA hybridization according to the used probe and the difference that will detect nucleic acid.RNA in situ hybridization is often used in the distribution situation that detects the mRNA of certain specific gene in the animal or plant tissue, to understand this expression of gene pattern.RNA in situ hybridization mainly is to utilize the base complementrity principle, the mRNA that external synthetic is had specific gene in the strand antisense mRNA of mark and tissue or the cell is hybridized, thereby antisense probe is positioned in the expression zone of specific gene, and determines the expression of gene amount according to the power of color signal.

Also do not utilize the RNA hybridization in situ technique to carry out the product that the HER2 overexpression detects in the market.

Summary of the invention

For a kind of new HER2 overexpression detection method is provided, provide more diagnosis basis for clinical, so that the positive patient with breast cancer of examination HER2 fast and accurately, the invention provides the testing product of the mRNA of a kind of HER2 of detection.

The invention provides the RNA hybridization in situ detection kit of a kind of human epidermal growth factor receptor 2 (HER2) gene overexpression, comprising: stationary liquid, PBS-Buffer I, PBS-Buffer II, PBS-BufferIII, Digestive system, prehybridization solution, hybridization solution, Washing Buffer I, Washing Buffer II, damping fluid I, damping fluid II, confining liquid, colour developing liquid I, colour developing liquid II, positive control are organized slide.

Described hybridization solution is the prehybridization solution that contains specific probe, and described specific probe is the strand antisense RNA probes, is the cDNA that the special primer according to HER2 mRNA sequences Design obtains through RT-PCR, obtains through in-vitro transcription again; Described special primer sequence is as follows:

HER2 forward primer sequence is: GATGCCCAACCAGGCGCAGAT 21bp;

HER2 reverse primer sequence is: ACCAGCTGCACCGTGGATGTCAG 23bp;

Described specific probe sequence is:

CUACGGGUUGGUCCGCGUCUACGCCUAGGACUUUCUCUGCCUCGACUCCUUCCACUUCCACGAACCUAGACCGCGAAAACCGUGUCAGAUGUUCCCGUAGACCUAGGGACUACCCCUCUUACACUUUUAAGGUCACCGGUAGUUUCACAACUCCCUUUUGUGUAGGGGGUUUCGGUUGUUUCUUUAGAAUCUGCUUCGUAUGCACUACCGACCACACCCGAGGGGUAUACAGAGGGCGGAAGACCCGUAGACGGACUGUAGGUGCCACGUCGACCA 276bp。

Described specific probe has mixed the Yeast Nucleic Acid of digoxin (DIG) mark in transcription.

4% the Paraformaldehyde 96 (pH7.4) that described stationary liquid is prepared for the PBS of no RNA enzyme.

Described PBS-Buffer I be through DEPC handle by 140mmol/LNaCl, 2.7mmolKCl, 10mmol/LNa ₂HPO ₄With 1.8mmol/L KH ₂PO ₄The damping fluid of the pH7.4 that forms.

Described PBS-Buffer II is the PBS-Buffer I that contains the 100mmol/L glycine.

Described PBS-BufferIII is the PBS-Buffer I that contains 0.3%TritonX-100.

Described Digestive system is by TE damping fluid (100mmol/L Tris-HCl, 50mmol/LEDTA, pH8.0) Pei Zhi the 20 μ g/ml Proteinase K solution that do not contain the RNA enzyme.

Described prehybridization solution is the solution of being made up of 50% deionized formamide, 20 * SSC, 50 * Denhardt and 0.1mg/mltRNA.

Described Washing Buffer I is for containing the solution of 300mol/LNaCl and 30mol/L Trisodium Citrate (pH7.0).

Described Washing Buffer II is for containing the solution of 150mmol/LNaCl and 15mmol/L Trisodium Citrate (pH7.0).

Described damping fluid I is for containing the solution of 100mmol/LTris-HCl and 150mmol/L NaCl (pH 7.5).

Described damping fluid II is for containing 100mmol/L Tris-HCl, 100mmol/L NaCl and 50mmol/L MgCl ₂(pH9.5) solution.

Described confining liquid is the damping fluid I that contains Trix-100 and NSS.

Described colour developing liquid I is the damping fluid I that contains Trix-100, NSS and anti digoxin antibody alkaline phosphatase enzyme complex.

Described colour developing liquid II is the fast red solution by damping fluid II preparation.

It is that colour developing in situ hybridization method (CISH) or fluorescent dye body in situ hybridization method (FISH) detect the positive patient with breast cancer's pathological section of HER2 that HER2 crosses expression that described positive control is organized slide.

The present invention compared with prior art has the following advantages and effect:

1. the probe in the hybridization solution of the present invention is the strand antisense RNA probes, is to be template with cDNA, under the effect of RNA polymerase, obtains by in-vitro transcription.This probe is compared with the dna probe of nick translation mark, the specificity height, and the hybrid molecule that RNA-RNA forms has thermostability, and the size of probe is also more constant, thereby has increased the susceptibility and the homogeneity of hybridization.This antisense RNA probes does not contain vector sequence, has reduced non-specific hybridization, can also prevent the competitive hybridization of second chain among the dsDNA.The probe that does not hybridize with RNA enzymic digestion strand the hybridization back can obviously reduce background.

2. the probe in the hybridization solution of the present invention is a kind of single-stranded probe, has avoided using the annealing issues between two that exist when double-stranded cDNA probe is done hybridization.The crossbred that forms between cRNA and the RNA is more stable than cDNA-RNA crossbred.The crossbred that forms between the cRNA-RNA is not subjected to the influence of RNA enzyme.Therefore available RNA enzyme is handled behind the hybridization, to remove unconjugated probe.Because the cRNA probe has above these advantages, the hybridization saturated level of cRNA probe exceeds 8 times than double chain DNA probe again.

3. the probe in the hybridization solution of the present invention adopts digoxigenin labeled, compares with the radioisotope labeling probe, and it has safety, "dead" pollution, good stability, and colour developing is easy to characteristics such as observation soon.The probe of digoxigenin labeled not only has biotin labeled advantage, has also overcome biotin labeled probe and has been organized shortcomings such as endogenous vitamin H interference in position in the crossover process, has strengthened the specificity that detects.

4. the choice of location of probe design is at the position of striding intron, and the interference of genome sequence can detect mRNA exactly when having avoided detecting mRNA, but detects less than genome sequence the amount that detects the HER2 gene mRNA that therefore can be special.

5. have high susceptibility and a specificity.

6. test set is simple, need not fluorescent microscope, and simple microscope can carry out microscopy.

The mRNA hybridization in situ technique is highly sensitive in a word, and specificity is good, and detection gene mRNA that can be special promptly detects this expression of gene situation.Can be used as colour developing in situ hybridization method (CISH) or fluorescent dye body in situ hybridization method (FISH) are detected the reference that HER2 crosses detection of expression, enriched HER2 genetic expression detection method, provide reference frame for making a definite diagnosis the positive patient with breast cancer of HER2.

Description of drawings:

Accompanying drawing is the electrophorogram of the HER2 probe fragment of RT-PCR amplification: the left side swimming lane is MARK, and stripe size from top to bottom is 600bp, 500bp, 400bp, 300bp, 200bp, 100bp; The right side swimming lane is the HER2 specific probe fragment of amplification, and size is 276bp.

Embodiment:

Be to be understood that, unaccounted normal condition and method among the following embodiment, usually according to the conventional employing method of affiliated field experimenter: as " molecular cloning experiment guide " third edition of Sa nurse Brooker and Russell chief editor, or the step and the condition of advising according to manufacturer.

Embodiment 1: design of primers and probe synthetic

Be designed for the special primer of RT-PCR according to HER2 gene nucleotide series (NO.M11730), sequence is as follows:

HER2 forward primer sequence is: GATGCCCAACCAGGCGCAGAT 21bp;

HER2 reverse primer sequence is: ACCAGCTGCACCGTGGATGTCAG 23bp.

With the extractive human blood RNA of Trizol method is that template is carried out the RT-PCR amplification, obtains the probe specific fragment, as scheming: the electrophorogram of the HER2 probe fragment of RT-PCR amplification; The specific sequence of RT-PCR amplification gained is as follows:

GATGCCCAACCAGGCGCAGATGCGGATCCTGAAAGAGACGGAGCTGAGGAAGGTGAAGGTGCTTGGATCTGGCGCTTTTGGCACAGTCTACAAGGGCATCTGGATCCCTGATGGGGAGAATGTGAAAATTCCAGTGGCCATCAAAGTGTTGAGGGAAAACACATCCCCCAAAGCCAACAAAGAAATCTTAGACGAAGCATACGTGATGGCTGGTGTGGGCTCCCCATATGTCTCCCGCCTTCTGGGCATCTGCCTGACATCCACGGTGCAGCTGGT 276bp。

And the probe fragment that above-mentioned RT-PCR amplification obtains is cloned in the T carrier, with restriction enzyme linearization plasmid and purifying, with 37 ℃ of in-vitro transcription of RNA polymerase and mix the ribonucleotide of DIG mark.Sequence is as follows:

CUACGGGUUGGUCCGCGUCUACGCCUAGGACUUUCUCUGCCUCGACUCCUUCCACUUCCACGAACCUAGACCGCGAAAACCGUGUCAGAUGUUCCCGUAGACCUAGGGACUACCCCUCUUACACUUUUAAGGUCACCGGUAGUUUCACAACUCCCUUUUGUGUAGGGGGUUUCGGUUGUUUCUUUAGAAUCUGCUUCGUAUGCACUACCGACCACACCCGAGGGGUAUACAGAGGGCGGAAGACCCGUAGACGGACUGUAGGUGCCACGUCGACCA?276bp。

Primer entrusts specialized company's (giving birth to the worker) synthetic, and wherein primer is the PAGE purifying.

Extension increasing sequence such as table 1:

Table 1. specific primer sequence

The sequence title	Oligonucleotide sequence (5 '-3 ')	Base length (bp)
			Reverse transcriptase primer	?TTTTTTTTTTTTTTTTTT	18
The HER2 forward primer	?GATGCCCAACCAGGCGCAGAT	21
			The HER2 reverse primer	?ACCAGCTGCACCGTGGATGTCAG	23

Responsive transcription system such as table 2:

Table 2. probe body is transcribed system outward

Reagent name	The application of sample amount
		Transcription?buffer(5x)	?4μL
DTT(100mM)	?2μL
		Rnase?inhibitor(40U)	?0.5μL
Linear?DNA	?6μL
		10×DIG?Mix	?2μL
SP6?RNA?Polymerase?20U/ul	?1μL
		0.1％DEPC?Millipore?H ₂O	Complement to 20 μ L

Embodiment 2: the reagent preparation

1. 4% the Paraformaldehyde 96 (pH7.4) prepared for the PBS of no RNA enzyme of stationary liquid.

2.PBS-Buffer I be through DEPC handle by 140mmol/LNaCl, 2.7mmolKCl, 10mmol/LNa ₂HPO ₄With 1.8mmol/L KH ₂PO ₄The damping fluid of the pH7.4 that forms.

3.PBS-Buffer II contains the PBS-Buffer I of 100mmol/L glycine.

4.PBS-BufferIII contain the PBS-Buffer I of 0.3%TritonX-100.

5. Digestive system is by TE damping fluid (100mmol/L Tris-HCl, 50mmol/LEDTA, pH8.0) Pei Zhi the 20 μ g/ml Proteinase K solution that do not contain the RNA enzyme.

6. prehybridization solution is the solution of being made up of 50% deionized formamide, 20 * SSC, 50 * Denhardt and 0.1mg/mltRNA.

7.Washing Buffer I is for containing the solution of 300mol/LNaCl and 30mol/L Trisodium Citrate (pH7.0).

8.Washing Buffer II is for containing the solution of 150mmol/LNaCl and 15mmol/L Trisodium Citrate (pH7.0).

9. damping fluid I is for containing the solution of 100mmol/L Tris-HCl and 150mmol/L NaCl (pH 7.5).

10. damping fluid II is for containing 100mmol/L Tris-HCl, 100mmol/L NaCl and 50mmol/L MgCl ₂(pH9.5) solution.

11. confining liquid is the damping fluid I that contains Trix-100 and NSS.

12. colour developing liquid I is the damping fluid I that contains Trix-100, NSS and anti digoxin antibody alkaline phosphatase enzyme complex.

13. colour developing liquid II is the fast red solution by damping fluid II preparation.

14. it is that colour developing in situ hybridization method (CISH) or fluorescent dye body in situ hybridization method (FISH) detect the positive patient with breast cancer's pathological section of HER2 that HER2 crosses expression that positive control is organized slide.

Embodiment 3: the use of test kit

1. tissue slice is handled

1) dimethylbenzene was in 37 ℃ of dewaxings 2 times, each 15 minutes;

2) soaked in absolute ethyl alcohol is 2 times, each 3 minutes;

3) 95% alcohol immersion is 2 times, each 3 minutes;

4) PBS-Buffer I cleans 2 times, each 3 minutes;

5) PBS-Buffer II cleans 2 times, each 3 minutes;

6) add Digestive system, hatched 20 minutes for 37 ℃;

7) PBS-BufferIII cleans 2 times, each 5 minutes;

8) stationary liquid was handled 10 minutes;

9) PBS-Buffer I cleans 2 times, each 5 minutes;

2. prehybridization

Add prehybridization solution, hatched 1 hour for 50 ℃;

3. hybridization

Add hybridization solution, 50 ℃ of overnight incubation.

4. wash-out

1) Washing Buffer I cleans 2 times, each 15 minutes;

2) Washing Buffer II cleans 2 times, each 15 minutes;

3) damping fluid I handles 2 times, each 5 minutes;

4) confining liquid was hatched 15 minutes;

5. colour developing

1) adds colour developing liquid I, handled 2 hours for 37 ℃;

2) damping fluid I handles 2 times, each 5 minutes;

3) damping fluid II handles 2 times, each 5 minutes;

4) add colour developing liquid II, lucifuge was hatched 3 hours;

5) damping fluid II handles 2 times, each 15 minutes;

6. mounting

1) dehydration: with 75% ethanol, 95% ethanol, the dehydration of 100% ethanol gradient;

2) transparent: dimethylbenzene embathes once;

3) the conventional Resin adhesive mounting of using is preserved.

7. microscopy

Sequence table

＜110〉Shanghai Yue Loong Clinical Laboratory center company limited

＜120〉the mRNA hybridization in situ detection kit of HER2 overexpression

<160>3

<210>1

<211>276

<212>RNA

＜213〉Genus Homo (HOMO)

<400>1

cuacggguug?guccgcgucu?acgccuagga?cuuucucugc?cucgacuccu?uccacuucca 60

cgaaccuaga?ccgcgaaaac?cgugucagau?guucccguag?accuagggac?uaccccucuu 120

acacuuuuaa?ggucaccggu?aguuucacaa?cucccuuuug?uguagggggu?uucgguuguu 180

ucuuuagaau?cugcuucgua?ugcacuaccg?accacacccg?agggguauac?agagggcgga 240

agacccguag?acggacugua?ggugccacgu?cgacca 276

<210>2

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to nucleic acid base pairing mechanism and the design of gene chip hybridization condition, to be used as augmentation detection HER2 forward primer in the mRNA hybridization in situ detection kit of HER2 overexpression.

<400>2

gatgcccaac?caggcgcaga?t 21

<210>3

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to nucleic acid base pairing mechanism and the design of gene chip hybridization condition, to be used as augmentation detection HER2 reverse primer in the mRNA hybridization in situ detection kit of HER2 overexpression.

<400>3

accagctgca?ccgtggatgt?cag 23

Claims

1. the RNA hybridization in situ detection kit of human epidermal growth factor receptor 2's gene overexpression comprises: stationary liquid, PBS-Buffer I, PBS-Buffer II, PBS-Buffer III, Digestive system, prehybridization solution, hybridization solution, Washing BufferI, Washing Buffer II, damping fluid I, damping fluid II, confining liquid, colour developing liquid I, colour developing liquid II, positive control are organized slide.

2. detection kit as claimed in claim 1, it is characterized in that described hybridization solution is the prehybridization solution that contains specific probe, described specific probe is the strand antisense RNA probes, be the cDNA that the special primer according to the HER2mRNA sequences Design obtains through RT-PCR, obtain through in-vitro transcription again; Described special primer sequence is as follows:

The HER2 forward primer is classified as: GATGCCCAACCAGGCGCAGAT 21bp;

HER2 reverse primer sequence is: ACCAGCTGCACCGTGGATGTCAG 23bp;

Described specific probe sequence is:

CUACGGGUUGGUCCGCGUCUACGCCUAGGACUUUCUCUGCCUCGACUCCUUCCACUUCCACG

AACCUAGACCGCGAAAACCGUGUCAGAUGUUCCCGUAGACCUAGGGACUACCCCUCUUACACUUU

UAAGGUCACCGGUAGUUUCACAACUCCCUUUUGUGUAGGGGGUUUCGGUUGUUUCUUUAGAAUC

UGCUUCGUAUGCACUACCGACCACACCCGAGGGGUAUACAGAGGGCGGAAGACCCGUAGACGGA

CUGUAGGUGCCACGUCGACCA 276bp。

3. detection kit as claimed in claim 1 is characterized in that described specific probe is the Yeast Nucleic Acid that has mixed digoxigenin labeled in transcription.

4. detection kit as claimed in claim 1 is characterized in that described stationary liquid prepares for the PBS of no RNA enzyme, 4% the Paraformaldehyde 96 of pH7.4;

Described PBS-Buffer I be through DEPC handle by 140mmol/LNaCl, 2.7mmolKCl, 10mmol/LNa ₂HPO ₄With 1.8mmol/L KH ₂PO ₄The damping fluid of the pH7.4 that forms;

Described PBS-BufferII is the PBS-Buffer I that contains the 100mmol/L glycine;

Described PBS-BufferIII is the PBS-Buffer I that contains 0.3%TritonX-100;

Described Digestive system is the 20 μ g/ml Proteinase K solution that do not contain the RNA enzyme by the preparation of TE damping fluid;

Described prehybridization solution is the solution of being made up of 50% deionized formamide, 20 * SSC, 50 * Denhardt and 0.1mg/mltRNA;

Described Washing Buffer I is for containing 300mol/LNaCl and 30mol/L Trisodium Citrate, the solution of pH7.0;

Described Washing BufferII is for containing 150mmol/LNaCl and 15mmol/L Trisodium Citrate, the solution of pH7.0;

Described damping fluid I is for containing 100mmol/LTris-HCl and 150mmol/LNaCl, the solution of pH 7.5;

Described damping fluid II is for containing 100mmol/L Tris-HCl, 100mmol/L NaCl and 50mmol/L MgCl ₂, the solution of pH9.5;

Described confining liquid is the damping fluid I that contains Trix-100 and NSS;

Described colour developing liquid I is the damping fluid I that contains Trix-100, NSS and anti digoxin antibody alkaline phosphatase enzyme complex;

Described colour developing liquid II is the fast red solution by damping fluid II preparation;

It is that colour developing in situ hybridization method or fluorescent dye body in situ hybridization method detect the positive patient with breast cancer's pathological section of HER2 that HER2 crosses expression that described positive control is organized slide.