CN104498495A - Prostatic cancer marker lncRNA MALAT-1 and application thereof - Google Patents
Prostatic cancer marker lncRNA MALAT-1 and application thereof Download PDFInfo
- Publication number
- CN104498495A CN104498495A CN201410674678.8A CN201410674678A CN104498495A CN 104498495 A CN104498495 A CN 104498495A CN 201410674678 A CN201410674678 A CN 201410674678A CN 104498495 A CN104498495 A CN 104498495A
- Authority
- CN
- China
- Prior art keywords
- malat
- lncrna
- urine
- chip
- lncrna malat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a long non-coding RNA (lncRNA) MALAT-1, and application thereof as a prostatic cancer marker and application thereof to preparation of chips, preparations or kits for detection of prostatic cancer.
Description
Technical field
The invention belongs to biology field, particularly, the present invention relates to urine long-chain non-coding lncRNA MALAT-1 and the application as prostate cancer marker thereof.
Background technology
Prostate cancer (Prostatic Cancer, PCa) is a kind of malignant tumour of serious threat men's health, and its morbidity and mortality ratio peak, at about 70 years old, account for global tumor incidence second, mortality ratio the 6th.The sickness rate of China PCa is in significant ascendant trend in recent years always.In Beijing, Shanghai, medical science, the economically developed city such as Guangzhou, PCa sickness rate has been positioned at the row of local ten large kinds of tumor.Data from Shanghai City Center for Disease Control shows further, and the sickness rate of PCa leapt to the first place of male genitourinary tract infections malignant tumour from 2002, rose to 2009 32.23/10 ten thousand from nineteen ninety 2.6/10 ten thousand, the 5th that leaps to male malignancy.Epidemic data also showed, and Chinese PCa sickness rate has been increased to 7.9/10 ten thousand male demographic of 2005 from 1.71/10 ten thousand male demographic of 1993, year amplification 13%.
PCa just loses the chance of radical cure once outstanding coating, and its survival time declines greatly, and therefore, the early diagnosis of PCa just seems particularly important.It is the PCa early diagnosis molecular marker be most widely used at present that blood-serum P SA detects, and its application greatly reduces the death of PCa specificity.But PSA is prostate specific but not PCa specific molecular marker thing, and such as prostatitis, benign prostatic hyperplasia etc. can cause the rising of PSA.At " diagnosis gray area " (PSA4-10ng/ml) of PSA, its diagnosis positive rate is only 25-40%, which results in numerous unnecessary punctures, meanwhile, brings economical load and mental burden also to puncture patient.So, need the molecular marker finding and have more Sensitivity and Specificity clinically badly.
Summary of the invention
Object of the present invention is for providing a kind of prostate cancer marker lncRNAMALAT-1 and application thereof, and namely urine long-chain non-coding lncRNA MALAT-1 is as the application of prostate cancer marker.
In a first aspect of the present invention, provide a kind of lncRNAMALAT-1 of separation, described lncRNAMALAT-1 sequence is total length or its fragment of MALAT-1.Described lncRNA MALAT-1 sequence is as shown in SEQ ID NO:1, and its gene I/D is FR077061; GenBank:BK001418.1; Its full length sequence database link is:
http:// www.ncbi.nlm.nih.gov/nuccore/BK001418or
http：//www.ncrna.org/frnadb/detail.html？i_name＝FR077061&i_tab＝seq。
In the present invention, described lncRNA MALAT-1 sequence is total length or its fragment of MALAT-1; Described fragment comprises any one PCR fragment of lncRNA, and this any one PCR fragment is PCR reaction product, because different PCR primer can obtain different PCR primer.
SEQ ID NO:1 is:
GATCAGAGTGGGCCACTGCCAGCCAACGGCCCCCGGGGCTCAGGCGGGGAGCAGCTCTGTGGTGTGGGATTGAGGCGTTTTCCAAGAGTGGGTTTTCACGTTTCTAAGATTTCCCAAGCAGACAGCCCGTGCTGCTCCGATTTCTCGAACAAAAAAGCAAAACGTGTGGCTGTCTTGGGAGCAAGTCGCAGGACTGCAAGCAGTTGGGGGAGAAAGTCCGCCATTTTGCCACTTCTCAACCGTCCCTGCAAGGCTGGGGCTCAGTTGCGTAATGGAAAGTAAAGCCCTGAACTATCACACTTTAATCTTCCTTCAAAAGGTGGTAAACTATACCTACTGTCCCTCAAGAGAACACAAGAAGTGCTTTAAGAGGCGGCGGAAGGTGATCGAATTCCGGTGATGCGAGTTGTTCTCCGTCTATAAATACGCCTCGCCCGAGCTGTGCGGTAGGCATTGAGGCAGCCAGCGCAGGGGCTTCTGCTGAGGGGGCAGGCGGAGCTTGAGGAAACCGCAGATAAGTTTTTTTCTCTTTGAAAGATAGAGATTAATACAACTACTTAAAAAATATAGTCAATAGGTTACTAAGATATTGCTTAGCGTTAAGTTTTTAACGTAATTTTAATAGCTTAAGATTTTAAGAGAAAATATGAAGACTTAGAAGAGTAGCATGAGGAAGGAAAAGATAAAAGGTTTCTAAAACATGACGGAGGTTGAGATGAAGCTTCTTCATGGAGTAAAAAATGTATTTAAAAGAAAATTGAGAGAAAGGACTACAGAGCCCCGAATTAATACCAATAGAAGGGCAATGCTTTTAGATTAAAATGAAGGTGACTTAAACAGCTTAAAGTTTAGTTTAAAAGTTGTAGGTGATTAAAATAATTTGAAGGCGATCTTTTAAAAAGAGATTAAACCGAAGGTGATTAAAAGACCTTGAAATCCATGACGCAGGGAGAATTGCGTCATTTAAAGCCTAGTTAACGCATTTACTAAACGCAGACGAAAATGGAAAGATTAATTGGGAGTGGTAGGATGAAACAATTTGGAGAAGATAGAAGTTTGAAGTGGAAAACTGGAAGACAGAAGTACGGGAAGGCGAAGAAAAGAATAGAGAAGATAGGGAAATTAGAAGATAAAAACATACTTTTAGAAGAAAAAAGATAAATTTAAACCTGAAAAGTAGGAAGCAGAAGAGAAAAGACAAGCTAGGAAACAAAAAGCTAAGGGCAAAATGTACAAACTTAGAAGAAAATTGGAAGATAGAAACAAGATAGAAAATGAAAATATTGTCAAGAGTTTCAGATAGAAAATGAAAAACAAGCTAAGACAAGTATTGGAGAAGTATAGAAGATAGAAAAATATAAAGCCAAAAATTGGATAAAATAGCACTGAAAAAATGAGGAAATTATTGGTAACCAATTTATTTTAAAAGCCCATCAATTTAATTTCTGGTGGTGCAGAAGTTAGAAGGTAAAGCTTGAGAAGATGAGGGTGTTTACGTAGACCAGAACCAATTTAGAAGAATACTTGAAGCTAGAAGGGGAAGTTGGTTAAAAATCACATCAAAAAGCTACTAAAAGGACTGGTGTAATTTAAAAAAAACTAAGGCAGAAGGCTTTTGGAAGAGTTAGAAGAATTTGGAAGGCCTTAAATATAGTAGCTTAGTTTGAAAAATGTGAAGGACTTTCGTAACGGAAGTAATTCAAGATCAAGAGTAATTACCAACTTAATGTTTTTGCATTGGACTTTGAGTTAAGATTATTTTTTAAA TCCTGAGGACTAGCATTAATTGACAGCTGACCCAGGTGCTACACAGAAGTGGATTCAGTGAATCTAGGAAGACAGCAGCAGACAGGATTCCAGGAACCAGTGTTTGATGAAGCTAGGACTGAGGAGCAAGCGAGCAAGCAGCAGTTCGTGGTGAAGATAGGAAAAGAGTCCAGGAGCCAGTGCGATTTGGTGAAGGAAGCTAGGAAGAAGGAAGGAGCGCTAACGATTTGGTGGTGAAGCTAGGAAAAAGGATTCCAGGAAGGAGCGAGTGCAATTTGGTGATGAAGGTAGCAGGCGGCTTGGCTTGGCAACCACACGGAGGAGGCGAGCAGGCGTTGTGCGTAGAGGATCCTAGACCAGCATGCCAGTGTGCCAAGGCCACAGGGAAAGCGAGTGGTTGGTAAAAATCCGTGAGGTCGGCAATATGTTGTTTTTCTGGAACTTACTTATGGTAACCTTTTATTTATTTTCTAATATAATGGGGGAGTTTCGTACTGAGGTGTAAAGGGATTTATATGGGGACGTAGGCCGATTTCCGGGTGTTGTAGGTTTCTCTTTTTCAGGCTTATACTCATGAATCTTGTCTGAAGCTTTTGAGGGCAGACTGCCAAGTCCTGGAGAAATAGTAGATGGCAAGTTTGTGGGTTTTTTTTTTTTACACGAATTTGAGGAAAACCAAATGAATTTGATAGCCAAATTGAGACAATTTCAGCAAATCTGTAAGCAGTTTGTATGTTTAGTTGGGGTAATGAAGTATTTCAGTTTTGTGAATAGATGACCTGTTTTTACTTCCTCACCCTGAATTCGTTTTGTAAATGTAGAGTTTGGATGTGTAACTGAGGCGGGGGGGAGTTTTCAGTATTTTTTTTTGTGGGGGTGGGGGCAAAATATGTTTTCAGTTCTTTTTCCCTTAGGTCTGTCTAGAATCCTAAAGGCAAATGACTCAAGGTGTAACAGAAAACAAGAAAATCCAATATCAGGATAATCAGACCACCACAGGTTTACAGTTTATAGAAACTAGAGCAGTTCTCACGTTGAGGTCTGTGGAAGAGATGTCCATTGGAGAAATGGCTGGTAGTTACTCTTTTTTCCCCCCACCCCCTTAATCAGACTTTAAAAGTGCTTAACCCCTTAAACTTGTTATTTTTTACTTGAAGCATTTTGGGATGGTCTTAACAGGGAAGAGAGAGGGTGGGGGAGAAAATGTTTTTTTCTAAGATTTTCCACAGATGCTATAGTACTATTGACAAACTGGGTTAGAGAAGGAGTGTACCGCTGTGCTGTTGGCACGAACACCTTCAGGGACTGGAGCTGCTTTTATCCTTGGAAGAGTATTCCCAGTTGAAGCTGAAAAGTACAGCACAGTGCAGCTTTGGTTCATATTCAGTCATCTCAGGAGAACTTCAGAAGAGCTTGAGTAGGCCAAATGTTGAAGTTAAGTTTTCCAATAATGTGACTTCTTAAAAGTTTTATTAAAGGGGAGGGGCAAATATTGGCAATTAGTTGGCAGTGGCGTGTTACGGTGGGATTGGTGGGGTGGGTTTAGGTAATTGTTTAGTTTATGATTGCAGATAAACTCATGCCAGAGAACTTAAAGTCTTAGAATGGAAAAAGTAAAGAAATATCAACTTCCAAGTTGGCAAGTAACTCCCAATGATTTAGTTTTTTTCCCCCCAGTTTGAATTGGGAAGCTGGGGGAAGTTAAATATGAGCCACTGGGTGTACCAGTGCATTAATTTGGGCAAGGAAAGTGTCATAATTTGATACTGTATCTGTTTTCCTTCAAAGTATAGAGCTTTTGGGGAAGGAAAGTATTGAACTGGGGGTTGGTCTGGCCTAC TGGGCTGACATTAACTACAATTATGGGAAATGCAAAAGTTGTTTGGATATGGTAGTGTGTGGTTCTCTTTTGGAATTTTTTTCAGGTGATTTAATAATAATTTAAAACTACTATAGAAACTGCAGAGCAAAGGAAGTGGCTTAATGATCCTGAAGGGATTTCTTCTGATGGTAGCTTTTGTATTATCAAGTAAGATTCTATTTTCAGTTGTGTGTAAGCAAGTTTTTTTTTAGTGTAGGAGAAATACTTTTCCATTGTTTAACTGCAAAACAAGATGTTAAGGTATGCTTCAAAAATTTTGTAAATTGTTTATTTTAAACTTATCTGTTTGTAAATTGTAACTGATTAAGAATTGTGATAGTTCAGCTTGAATGTCTCTTAGAGGGTGGGCTTTTGTGATGAGGGAGGGGAAACTTTTTTTTTTTCTATAGACTTTTTTCAGATAACATCTTCTGAGTCATAACCAGCCTGGCAGTATGATGGCCTAGATGCAGAGAAAACAGCTCCTTGGTGAATTGATAAGTAAAGGCAGAAAAGATTATATGTCATACCTCCATTGGGGAATAAGCATAACCCTGAGATTCTTACTACTGATGAGAACATTATCTGCATATGCCAAAAAATTTTAAGCAAATGAAAGCTACCAATTTAAAGTTACGGAATCTACCATTTTAAAGTTAATTGCTTGTCAAGCTATAACCACAAAAATAATGAATTGATGAGAAATACAATGAAGAGGCAATGTCCATCTCAAAATACTGCTTTTACAAAAGCAGAATAAAAGCGAAAAGAAATGAAAATGTTACACTACATTAATCCTGGAATAAAAGAAGCCGAAATAAATGAGAGATGAGTTGGGATCAAGTGGATTGAGGAGGCTGTGCTGTGTGCCAATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAACAGATAAGTTTAACTTGCATCTGCAGTATTGCATGTTAGGGATAAGTGCTTATTTTTAAGAGCTGTGGAGTTCTTAAATATCAACCATGGCACTTTCTCCTGACCCCTTCCCTAGGGGATTTCAGGATTGAGAAATTTTTCCATCGAGCCTTTTTAAAATTGTAGGACTTGTTCCTGTGGGCTTCAGTGATGGGATAGTACACTTCACTCAGAGGCATTTGCATCTTTAAATAATTTCTTAAAAGCCTCTAAAGTGATCAGTGCCTTGATGCCAACTAAGGAAATTTGTTTAGCATTGAATCTCTGAAGGCTCTATGAAAGGAATAGCATGATGTGCTGTTAGAATCAGATGTTACTGCTAAAATTTACATGTTGTGATGTAAATTGTGTAGAAAACCATTAAATCATTCAAAATAATAAACTATTTTTATTAGAGAATGTATACTTTTAGAAAGCTGTCTCCTTATTTAAATAAAATAGTGTTTGTCTGTAGTTCAGTGTTGGGGCAATCTTGGGGGGGATTCTTCTCTAATCTTTCAGAAACTTTGTCTGCGAACACTCTTTAATGGACCAGATCAGGATTTGAGCGGAAGAACGAATGTAACTTTAAGGCAGGAAAGACAAATTTTATTCTTCATAAAGTGATGAGCATATAATAATTCCAGGCACATGGCAATAGAGGCCCTCTAAATAAGGAATAAATAACCTCTTAGACAGGTGGGAGATTATGATCAGAGTAAAAGGTAATTACACATTTTATTTCCAGAAAGTCAGGGGTCTATAAATTGACAGTGATTAGAGTAATACTTTTTCACATTTCCAAAGTTTGCATGTTAACTTTAAATGCTTACAATCTTAGAGTGGTAGGCAATGTTTTACACTATTG ACCTTATATAGGGAAGGGAGGGGGTGCCTGTGGGGTTTTAAAGAATTTTCCTTTGCAGAGGCATTTCATCCTTCATGAAGCCATTCAGGATTTTGAATTGCATATGAGTGCTTGGCTCTTCCTTCTGTTCTAGTGAGTGTATGAGACCTTGCAGTGAGTTTATCAGCATACTCAAAATTTTTTTCCTGGAATTTGGAGGGATGGGAGGAGGGGGTGGGGCTTACTTGTTGTAGCTTTTTTTTTTTTTACAGACTTCACAGAGAATGCAGTTGTCTTGACTTCAGGTCTGTCTGTTCTGTTGGCAAGTAAATGCAGTACTGTTCTGATCCCGCTGCTATTAGAATGCATTGTGAAACGACTGGAGTATGATTAAAAGTTGTGTTCCCCAATGCTTGGAGTAGTGATTGTTGAAGGAAAAAATCCAGCTGAGTGATAAAGGCTGAGTGTTGAGGAAATTTCTGCAGTTTTAAGCAGTCGTATTTGTGATTGAAGCTGAGTACATTTTGCTGGTGTATTTTTAGGTAAAATGCTTTTTGTTCATTTCTGGTGGTGGGAGGGGACTGAAGCCTTTAGTCTTTTCCAGATGCAACCTTAAAATCAGTGACAAGAAACATTCCAAACAAGCAACAGTCTTCAAGAAATTAAACTGGCAAGTGGAAATGTTTAAACAGTTCAGTGATCTTTAGTGCATTGTTTATGTGTGGGTTTCTCTCTCCCCTCCCTTGGTCTTAATTCTTACATGCAGGAACACTCAGCAGACACACGTATGCGAAGGGCCAGAGAAGCCAGACCCAGTAAGAAAAAATAGCCTATTTACTTTAAATAAACCAAACATTCCATTTTAAATGTGGGGATTGGGAACCACTAGTTCTTTCAGATGGTATTCTTCAGACTATAGAAGGAGCTTCCAGTTGAATTCACCAGTGGACAAAATGAGGAAAACAGGTGAACAAGCTTTTTCTGTATTTACATACAAAGTCAGATCAGTTATGGGACAATAGTATTGAATAGATTTCAGCTTTATGCTGGAGTAACTGGCATGTGAGCAAACTGTGTTGGCGTGGGGGTGGAGGGGTGAGGTGGGCGCTAAGCCTTTTTTTAAGATTTTTCAGGTACCCCTCACTAAAGGCACCGAAGGCTTAAAGTAGGACAACCATGGAGCCTTCCTGTGGCAGGAGAGACAACAAAGCGCTATTATCCTAAGGTCAAGAGAAGTGTCAGCCTCACCTGATTTTTATTAGTAATGAGGACTTGCCTCAACTCCCTCTTTCTGGAGTGAAGCATCCGAAGGAATGCTTGAAGTACCCCTGGGCTTCTCTTAACATTTAAGCAAGCTGTTTTTATAGCAGCTCTTAATAATAAAGCCCAAATCTCAAGCGGTGCTTGAAGGGGAGGGAAAGGGGGAAAGCGGGCAACCACTTTTCCCTAGCTTTTCCAGAAGCCTGTTAAAAGCAAGGTCTCCCCACAAGCAACTTCTCTGCCACATCGCCACCCCGTGCCTTTTGATCTAGCACAGACCCTTCACCCCTCACCTCGATGCAGCCAGTAGCTTGGATCCTTGTGGGCATGATCCATAATCGGTTTCAAGGTAACGATGGTGTCGAGGTCTTTGGTGGGTTGAACTATGTTAGAAAAGGCCATTAATTTGCCTGCAAATTGTTAACAGAAGGGTATTAAAACCACAGCTAAGTAGCTCTATTATAATACTTATCCAGTGACTAAAACCAACTTAAACCAGTAAGTGGAGAAATAACATGTTCAAGAACTGTAATGCTGGGTGGGAACATGTAACTTGTAGACTGGAGAAGATAGGCATTTGAGTGGCTGAGAGGGCTTTTGGGTGGGAAT GCAAAAATTCTCTGCTAAGACTTTTTCAGGTGAACATAACAGACTTGGCCAAGCTAGCATCTTAGCGGAAGCTGATCTCCAATGCTCTTCAGTAGGGTCATGAAGGTTTTTCTTTTCCTGAGAAAACAACACGTATTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAAAAAAAAAAAGCAAAAGATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAATCCCTGCGGTGTCTTTGCTTTGACTACTAATCTGTCTTCAGGACTCTTTCTGTATTTCTCCTTTTCTCTGCAGGTGCTAGTTCTTGGAGTTTTGGGGAGGTGGGAGGTAACAGCACAATATCTTTGAACTATATACATCCTTGATGTATAATTTGTCAGGAGCTTGACTTGATTGTATATTCATATTTACACGAGAACCTAATATAACTGCCTTGTCTTTTTCAGGTAATAGCCTGCAGCTGGTGTTTTGAGAAGCCCTACTGCTGAAAACTTAACAATTTTGTGTAATAAAAATGGAGAAGCTCTAAATTGTTGTGGTTCTTTTGGAATAAAAAAATCTTGATTGGGAAAAAAGATGGGTGTTCTGTGGGCTTGTTCTGTTAAATCTGTGGTCTATAAACACAGCACCCATAATTACAGCATAATCTTCAAGTAGGGTACGGACTTTGGGGGATTGGTGCGAGGGTAGTGGGTGAGTGGCCTACTAAAAAGCCCAGTAACCCCCACAGGAAAATAGGGAACTTCTTTTTAAGTAGCCTCCTTTCCACTATTTAGTAATTGGCTGTGAGCTGGGCTGGGGGAGAAATGGGGCGGGGTGTGTGTGTCATTGGAAAGCTCTCTTTTTTGTTTTTTTGAGACAGTCTCACTTTGTCCCCCAGGCTGGAGTGTAGTGGCATGATCTCTGCAAACTGCAACCTCCACTTGTGGGGTCCAAGTGGTTGTCCTGCTTCACCCTCCCTGTAGCTGGGACTACAGGTGCACACCACCACGCCTGGCTAATTTTTGTATT
In another preference, described lncRNA MALAT-1 is separated the urine from people.
In another preference, described urine is urine after massage of prostate.Described urine also comprises urine after non-massage of prostate.
In another preference, described lncRNA MALAT-1 extracts the arena after urine is centrifugal.
In a second aspect of the present invention, provide a kind of MALAT-1 precursor lncRNA of separation, described precursor lncRNA can shear and be expressed as the lncRNA MALAT-1 described in first aspect in people's cell.
In another preference, described MALAT-1 precursor is separated urine after human prostate massage, can also be separated urine after non-massage of prostate.
In a third aspect of the present invention, provide a kind of polynucleotide of separation, described polynucleotide can be become lncRNA MALAT-1 described in first aspect by people's cell transcription.
In another preference, described polynucleotide have the structure shown in examination (I):
Seq
forward-X-Seq
oppositelyformula (I),
In formula (I),
Seq
forwardfor the nucleotide sequence of MALAT-1 described in becoming at people's cells;
Seq
oppositelyfor with Seq
forwardsubstantially the nucleotide sequence of complementation or complete complementary;
X is for being positioned at Seq
forwardand Seq
oppositelybetween intervening sequence, and described intervening sequence and Seq
forwardand Seq
oppositelynot complementary;
Further, the structure shown in formula (I), after proceeding to people's cell, forms the secondary structure shown in formula (II):
In formula (II), Seq
forward, Seq
oppositelywith the definition of X as above-mentioned, Seq
forwardfor the nucleotide sequence of MALAT-1 described in becoming at people's cells; Seq
oppositelyfor with Seq
forwardsubstantially the nucleotide sequence of complementation or complete complementary; X is for being positioned at Seq
forwardand Seq
oppositelybetween intervening sequence, and described intervening sequence and Seq
forwardand Seq
oppositelynot complementary; || represent at Seq
forwardand Seq
oppositelybetween formed base pair complementarity relation.
In a fourth aspect of the present invention, provide a kind of carrier, it contains lncRNA MALAT-1 described in first aspect or the polynucleotide described in the third aspect.
In a fifth aspect of the present invention, provide a kind of chip or test kit, it contains the lncRNA MALAT-1 described in first aspect or the polynucleotide described in the third aspect, for the diagnosis of tumour.Described tumour includes but not limited to prostate cancer, kidney, bladder cancer etc.
In a sixth aspect of the present invention, provide a kind of lncRNAMALAT-1 chip, described chip comprises:
Solid phase carrier; And the oligonucleotide probe be fixed in order on described solid phase carrier, described oligonucleotide probe corresponds to the part or all of sequence shown in lncRNA MALAT-1 specifically.
In a seventh aspect of the present invention, provide the purposes of the lncRNA MALAT-1 chip described in the 6th aspect, for the preparation of the test kit of diagnosing tumor.Described tumour includes but not limited to prostate cancer, kidney, bladder cancer etc.
In the present invention's application, by the content of the lncRNA MALAT-1 in the urine of lncRNAMALAT-1 chip detection object to be measured (such as people).The step of described detection comprises: first obtain the RNA sample be separated from object urine to be measured, described RNA arranges marker; It contacted with described lncRNA MALAT-1 chip, hybridization forms oligonucleotide probe-RNA binary complex; Detection obtains lncRNA MALAT-1 content.
Another aspect of the present invention, provides described lncRNAMALAT-1 and is preparing the application in prostate cancer marker.
Another aspect of the present invention, provides described lncRNA MALAT-1 for the preparation of the application detected in the chip of prostate cancer, preparation or test kit.
Another aspect of the present invention, provides a kind of chip, preparation or test kit, and it is containing, for example lncRNA MALAT-1 according to claim 1 or polynucleotide as claimed in claim 3.Described chip, preparation or test kit are for detecting prostate cancer.
Another aspect of the present invention, provides a kind of test kit, and it contains described lncRNA MALAT-1 chip.Described test kit is for detecting prostate cancer.
Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.
Accompanying drawing explanation
Fig. 1 is that urine MALAT-1 of the present invention scoring is applied to prediction PCa.
Fig. 2 is the differential expression of urine MALAT-1 scoring in tumor group and puncture negative group case; (A) be discovery group general population; (B) be discovery group PSA " diagnosis gray area " crowd; (C) be checking group general population; (D) be checking group PSA " diagnosis gray area " crowd.
Fig. 3 shows different urine MALAT-1 scorings general population with based on the PCa separating capacity in PSA grouping crowd; A is discovery group; B is checking group.
Fig. 4 shows the PCa diagnostic that areal analysis urine MALAT-1 marks under receiver operating curves; (A) diagnostic of urine MALAT-1 scoring in discovery group general population; (B) diagnostic of urine MALAT-1 scoring in checking group general population; (C) diagnostic in discovery group PSA " diagnosis gray area " crowd compares with serum t-PSA and the free ratio of PSA in urine MALAT-1 scoring; (D) diagnostic in checking group PSA " diagnosis gray area " crowd compares with serum t-PSA and the free ratio of PSA in urine MALAT-1 scoring.
Fig. 5 is the PCa predicting function of model in PSA " diagnosis gray area " crowd that decision-making tracing analysis is marked based on urine MALAT-1; (A) discovery group; (B) checking group; Basic model comprises age, prostate volume, the free ratio of PSA and rectal touch; The dark line shows being parallel to transverse axis does not have 1 routine patient to carry out prostate biopsy; Another solid line represents all patients and all carries out prostate biopsy.
Fig. 6 shows areal analysis urine MALAT-1 under receiver operating curves and marks and the PCa diagnostic of other Hazard Factor.
Fig. 7 compares with the PCa diagnostic of basic model based on urine MALAT-1 Rating Model; (A) discovery group general population; (B) discovery group PSA " diagnosis gray area " crowd; (C) checking group general population; (D) checking group PSA " diagnosis gray area " crowd.
Fig. 8 is the PCa predicting function of model in general population that decision-making tracing analysis is marked based on urine MALAT-1; (A) discovery group; (B) checking group; Basic model comprises age, prostate volume, t-PSA, the free ratio of PSA and rectal touch.
Embodiment
The present invention is successfully separated and long-chain non-coding RNA MALAT-1 after have detected massage of prostate in urine first, uses multiple statistical method to demonstrate the usefulness of urine MALAT-1 scoring in prostate cancer diagnosis.Described lncRNA MALAT-1 can be used as an independentpredictor of prostate cancer, and urine MALAT-1 scoring clearly can distinguish the prostate biopsy positive and negative patient; In the patient of PSA " diagnosis gray area ", the diagnostic of urine MALAT-1 scoring is obviously better than the ratio of blood-serum P SA detection and free serum PSA and t-PSA, when clinical puncture risks is decided to be 25%, urine MALAT-1 scoring, under the prerequisite of not failing to pinpoint a disease in diagnosis 1 routine high level prostate cancer, can avoid the unnecessary puncture of 30.2%-46.5%.Therefore, urine MALAT-1 scoring is a kind of novel prostatic cancer early diagnosis molecular marker, can significantly improve diagnostic accuracy.
" urine MALAT-1 scoring " draws by following calculation formula: urine MALAT-1 scoring=MALAT-1mRNA/PSA mRNA × 1000=2
ct (PSA)-Ct (MALAT-1)× 1000.
Long-chain non-coding lncRNA MALAT-1
LncRNA MALAT-1 sequence is SEQ ID NO:1; Its full length gene 8352bp; Gene I/D is FR077061; GenBank:BK001418.1.Full length sequence database link is
http:// www.ncbi.nlm.nih.gov/nuccore/BK001418or
http:// www.ncrna.org/frnadb/detail.html? i_name=FR077061 & i_tab=seq.
Antisense oligonucleotide
As used herein, term " antisense oligonucleotide ", " antisense-oligonucleotides ", " AS-Ons " or " ASO " implication are identical.According to lncRNAMALAT-1 sequence provided by the present invention, can have devised their antisense oligonucleotide, described antisense oligonucleotide can lower the amount of corresponding lncRNA or the expression of lncRNA in vivo.
In the present invention, described " antisense oligonucleotide " also comprises the modified antisense nucleotide adopted as obtained based on means such as nucleic acid lock or nucleic acid chains backbone modification technology, described modification does not change the activity of antisense oligonucleotide substantially, more preferably, described modification can improve the stability of antisense oligonucleotide, activity or result for the treatment of.
Polynucleotide construction
According to people lncRNA MALAT-1 sequence provided by the present invention, can design the polynucleotide construction that can be processed to the lncRNA that can affect corresponding mrna expression after being imported into, also namely described polynucleotide construction can raise the amount of corresponding lncRNA in vivo.Therefore, the invention provides a kind of polynucleotide (construction) of separation, described polynucleotide (construction) can be become lncRNA by people's cell transcription.
As a kind of optimal way of the present invention, described polynucleotide construction contains the structure shown in formula (I):
Seq
forward-X-Seq
oppositelyformula (I),
In formula (I),
Seq
forwardfor the nucleotide sequence of MALAT-1 described in can becoming at cells, Seq
oppositelyfor with Seq
forwardsubstantially complementary nucleotide sequence; Or, Seq
oppositelyfor the nucleotide sequence of MALAT-1 described in can becoming at cells, Seq
forwardfor with Seq
forwardsubstantially complementary nucleotide sequence;
X is for being positioned at Seq
forwardand Seq
oppositelybetween intervening sequence, and described intervening sequence and Seq
forwardand Seq
oppositelynot complementary.
Structure shown in formula (I), after proceeding to cell, forms the secondary structure shown in formula (II):
In formula (II), Seq
forward, Seq
oppositelywith the definition of X as above-mentioned; Seq
forwardfor the nucleotide sequence of MALAT-1 described in can becoming at cells, Seq
oppositelyfor with Seq
forwardsubstantially complementary nucleotide sequence; Or, Seq
oppositelyfor the nucleotide sequence of MALAT-1 described in can becoming at cells, Seq
forwardfor with Seq
forwardsubstantially complementary nucleotide sequence; X is for being positioned at Seq
forwardand Seq
oppositelybetween intervening sequence, and described intervening sequence and Seq
forwardand Seq
oppositelynot complementary; || represent at Seq
forwardand Seq
oppositelybetween formed base pair complementarity relation.
In a specific embodiment, the base pair complementarity of described nucleotide sequence and SEQ ID NO:1.
Usually, described polynucleotide construction is positioned on expression vector.Therefore, the present invention also comprises a kind of carrier, and it contains described lncRNA or described polynucleotide construction.Described expression vector is usually also containing promotor, replication orgin and/or marker gene etc.
Method well-known to those having ordinary skill in the art can be used for building expression vector required for the present invention.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character selecting the host cell transformed, as kalamycin, gentamicin, Totomycin, amicillin resistance.
Chip
Utilize lncRNA MALAT-1 sequence of the present invention, corresponding lncRNA chip can also be prepared, and then study the regulative mode of its express spectra and lncRNA.
Described lncRNA chip of the present invention comprises: solid phase carrier; And the oligonucleotide probe be fixed in order on described solid phase carrier, described oligonucleotide probe corresponds to the part or all of sequence shown in MALAT-1 specifically.
Particularly, according to lncRNA of the present invention, applicable probe can be designed, be fixed on solid phase carrier, be formed " oligonucleotide arrays ".Described " oligonucleotide arrays " refers to the array with addressable point (namely with distinctive, addressable address is the position of feature), and each addressable point is all containing a coupled characteristic oligonucleotide.As required, oligonucleotide arrays can be divided into multiple sub-battle array.
Described solid phase carrier can adopt the various common used materials in gene chip field, such as but not limited to nylon membrane, and the slide, plastic sheet etc. of the slide modified through active group (as aldehyde radical, amino etc.) or silicon chip, unmodified.
The preparation of described lncRNA MALAT-1 chip can adopt the common manufacturing method of biochip known in the art.Such as, if what solid phase carrier adopted is modify slide or silicon chip, 5 ' end of probe is containing amido modified poly-dT string, oligonucleotide probe can be mixed with solution, then point sample instrument is adopted to modify on slide or silicon chip by its point, be arranged in predetermined sequence or array, then being spent the night by placement is fixed, and just can obtain miRNA chip of the present invention.If nucleic acid is not containing amido modified, then its preparation method also can refer to: " the gene diagnosis technology-on-radiation operational manual " of Wang Shenwu chief editor; J.L。erisi，V。R。Iyer，P.O.BROWN。Exploring the metabolic and genetic control of gene expression on a genomic scale。Science, 1997; 278:680 and Ma Li people, Jiang Zhonghua edits.Biochip.Beijing: Chemical Industry Press, 2000,1-130.
On the other hand, present invention also offers a kind of method by lncRNA MALAT-1 in lncRNA MALAT-1 chip detection human urine, comprise step:
(1) RNA sample be separated from human urine is provided, described RNA arranges marker;
(2) RNA of (1) is contacted with described chip, make the oligonucleotide probe generation hybridization on described RNA and solid phase carrier, thus form " oligonucleotide probe-RNA " binary complex on solid phase carrier;
(3) detect the marker of binary complex that (2) are formed, thus determine people organize in the content of corresponding lncRNA MALAT-1.
The method extracting RNA from people's tissue is method well known to those skilled in the art, comprises Trizol method.
Preferred, in step (1), after isolate RNA sample from human urine, RNA sample is suitably processed, there is with enrichment the RNA of certain length, described length one between 150-250.After above-mentioned process, utilize these small fragment RNAs to carry out follow-up hybridization, the accuracy that chip catches lncRNA can be improved like this.
Those skilled in the art can isolate the RNA with certain fragment length easily, such as can adopt gel electrophoresis to be separated.Marking RNA is also method well known to those skilled in the art, and it realizes with the method for the marker of RNA specific binding by adding when hybridizing, and described marker is such as labelling groups.Described labelling groups includes but not limited to: digoxin molecule (DIG), biotin molecule (Bio), fluorescein and derivative biomolecules (FITC etc.) thereof, other fluorescence molecule (as Cy3, Cy5 etc.), alkaline phosphatase (AP), horseradish peroxidase (HRP) etc.These marks and marking method thereof have been routine techniques well-known in the art all.
When being hybridized by above-mentioned RNA and lncRNA MALAT-1 chip, first lncRNA MALAT-1 chip and pre-hybridization buffer can be carried out prehybridization.
Solid-phase hybridization between RNA and lncR NAMALAT-1 chip of the present invention carries out according to the classical way of this area, and one personnel of this area empirically easily determine the optimum condition of related buffers, probe and concentration of specimens, prehybridization temperature, hybridization temperature and time etc.Or also can with reference to described in " Molecular Cloning: A Laboratory guide ".
Then measurement information is treated according to acquisition of informations such as the position of marking signal on lncRNA chip, intensity.If amplified production fluorophor marks, also directly can obtain with fluorescence detection device (as laser confocal scanner Scanarray 3000 etc.) and treat measurement information.
Detection kit
Present invention also offers a kind of test kit, containing chip of the present invention in described test kit.Described test kit can be used for the expression detecting lncRNA MALAT-1 described in urine.The present invention also provides a kind of preparation or the test kit that contain described lncRNA MALAT-1 or described polynucleotide, for detecting the expression of the MALAT-1 of lncRNA described in urine.
Preferably, also containing the marker for labeled rna sample in described preparation or test kit, and the substrate corresponding with described marker.
In addition, also can comprising for extracting the required all ingredients such as RNA, PCR, hybridization, colour developing in described preparation or test kit, including but not limited to: extract, amplification liquid, hybridization solution, enzyme, contrast liquid, nitrite ion, washing lotion, antibody etc.
In addition, working instructions and/or chip image analysis software can also be comprised in described test kit.
Below in conjunction with specific embodiments and the drawings, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.Under the spirit and scope not deviating from inventive concept, the change that those skilled in the art can expect and advantage are all included in the present invention, and are protection domain with appending claims.Implement process of the present invention, condition, reagent, experimental technique etc., except the following content mentioned specially, be universal knowledege and the common practise of this area, the present invention is not particularly limited content.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.
Experimental technique
Experiment sample
This is tested all clinical samples and comes from Shanghai Changhai Hospital, Long March hospital and West China Hospital.The use of all samples signs Informed Consent Form by patient or its consignor.All researchs relating to human body specimen obtain the approval of each Hospital Ethical Committee all in advance.Urine specimen comes from the patient carrying out because of the abnormal rising (PSA > 4ng/ml) of PSA or the rectal touch positive puncturing.Urine specimen is sample after row massage of prostate.All patients did not all carry out the treatment affecting blood-serum P SA before specimen taken.
Research and design
Research is divided into two stages to carry out, and experimental design is shown in Fig. 1: (1) discovery phase.Use the effect that 218 routine sample study urine MALAT-1 mark in prediction PCa, the predictive value particularly in PSA " diagnosis gray area ".(2) Qualify Phase.By multicenter sample, the diagnostic value that discovery phase urine MALAT-1 marks is verified.
The collection of sample and process
Before puncture, after massage prostate gland (according to the method for massage prostatic fluid, from the bottom of prostate gland to tip, press prostate gland from the outside of two lateral lobes to center line respectively, finally press prostate gland median groove.Pressing dynamics is to press 0.5-1.0cm for degree by Prostatic Surface.Press two lateral lobes each 3 times from top to bottom, repeat once, pressing median groove 3 times.) collect first time urine 30-40ml, immediately as 4 degree of refrigerators.2500g, 15min, 4 DEG C centrifugal, isolates arena, sediment is transferred to 1ml and goes in enzyme EP pipe (one uses 1ml to go RNA enzyme PBS to rinse sediment, then be transferred to re-use aforesaid method in EP pipe centrifugal).Preserve for a long time for-80 DEG C.
Real-time quantitative PCR
Use TRIzol method (Invitrogen:No 15596-026, USA) total serum IgE in arena is extracted, NANO Drop 2000 is used to measure concentration and 260/280nm absorbancy total serum IgE good for extracting, 260/280nm absorbance ratio illustrates that between 1.8 ~ 2.0 RNA quality is good, according to the RNA concentration recorded, the RNA of the quantitative 50ng of each sample is used for whole genome amplification (WTA2, Sigma-Aldrich, St.Louis，MO，USA)。
The real-time PCR (AB StepOne Plus) of American AB I company is adopted to detect the cDNA of MALAT-1 in urine, SYBR Green dyestuff incorporation methods detects (Takara:DRR081A TaKaRa, Japan), the cDNA that reverse transcription obtains dilutes ten times, take 20ul as reaction system, use ABI eight to connect PCR pipe.Every hole arranges 3 multiple holes.Amplification condition is: 95 DEG C of denaturation 60sec, afterwards 95 DEG C of sex change 15sec, and 60 DEG C extend 60sec, and totally 40 circulations, obtain the Ct value of target gene and internal reference.PSAKIT upstream primer: GTCTGCGGCGGTGTTCTG, PSAKIT downstream primer: TGCCGACCCAGCAAGATC; MALAT-1 upstream primer: CTTCCCTAGGGGATTTCAGG, MALAT-1 downstream primer: GCCCACAGGAACAAGTCCTA.Reaction system is: 2 μ l cDNA, 10 μ l
premix Ex Taq
tM(Perfect Real Time) (2 ×) (Takara:DRR081A TaKaRa, Japan), 0.4 μ lROX Reference Dye (50 ×) and 5.6 μ l water.All response datas are analyzed by StepOne Software version v2.1 (Applied BioSystems, USA) and are drawn.Sample PSA expression amount is more than 28CT value by disallowable, and reason is that enough prostatic cells do not collected by this routine sample.Urine MALAT-1 score calculation formula is: 2
ct (PSA)-Ct (MALAT-1)× 1000.
Statistical analysis
With SPSS (Statistical Package for the Social Sciences) v.17.0 (SPSS Inc., Chicago, IL, USA), MedCalc is (MedCalc Software bvba v.10.4.7.0, Mariakerke, Belgium) and R software v.3.1.1 (The R Foundation for Statistical Computing) statistical analysis is carried out to data, choose suitable Mann-Whitney U-test, Student ' s t-test, Pearson ' s chi-square test and Fisher ' s exact test carries out statistics detection to each group of continuity and numeration variable, single factor test and multivariate logistic regression analysis is used to predict the independent hazard factor of PCa, use the relation between Spearman rank analysis urine MALAT-1 scoring and other clinical variable, receiver operating curves (ROC) is used to determine best cutoff value (cut off), specific degree, susceptibility, area under curve (AUC), clinical decision curve is used to estimate the clinical value that urine MALAT-1 marks, with P < 0.05 for difference has statistical significance.
Embodiment 1
Clinical samples information summary
Selected clinical continuity case 536 example of this research, wherein 29 examples are disallowable because not isolating enough RNA in arena, 73 examples are disallowable because not collecting enough prostatic cells in arena, therefore, this studies final case load is 434 examples, wherein, discovery group 218 example, checking group 216 example.All case clinical informations are summarized in table 1.As can be seen from Table 1, in discovery group general population, PCa Related Risk Factors (age, t-PSA, prostate volume, the free ratio of PSA and rectal touch) being all significantly higher than in tumor group is punctured negative group.But at PSA " diagnosis gray area ", serum t-PSA can not distinguish tumor group and negative group of puncture.After this, the present inventor also leads to the same conclusion in checking group crowd.
Embodiment 2
Urine MALAT-1 scoring clearly can distinguish tumor group and negative group of puncture and with the recall rate height correlation of PCa
Whether in order to study urine MALAT-1 scoring can as the effective PCa molecular marker of one, this research contriver have detected urine MALAT-1 scoring in discovery group and checking group, and has made further statistical analysis.Research finds, no matter be in general population or in PSA " diagnosis gray area " crowd, the expression amount of urine MALAT-1 scoring in tumor cases is all apparently higher than puncture negative case, the differential expression of urine MALAT-1 scoring as shown in Figure 2 in tumor group and puncture negative group case, (A) discovery group general population, (B) discovery group PSA " diagnosis gray area " crowd, (C) checking group general population, (D) checking group PSA " diagnosis gray area " crowd.
Further correlation analysis finds, urine MALAT-1 scoring is marked with other Hazard Factor clinical and Gleason does not all have dependency, sees supplementary table 1.What is more important, the present inventor have rated urine MALAT-1 scoring general population with based on the PCa separating capacity in PSA grouping crowd.Find, in discovery group general population and PSA " diagnosis gray area " crowd, the recall rate raising PCa along with urine MALAT-1 scoring significantly improves, and meanwhile, have also been obtained same conclusion in checking group, as shown in Figure 3, different urine MALAT-1 marks general population with based on the PCa separating capacity in PSA grouping crowd, wherein, and (A) discovery group, (B) checking group
§pearson chi-square.
TFisher’s exact test。Which illustrate urine MALAT-1 scoring and meet the prerequisite can diagnosing molecular marker as PCa.
Embodiment 3
The PCa diagnostic that Logistic regression analysis urine MALAT-1 marks
The present inventor sets up single factor test and multivariate logistic regression analysis model, demonstrate urine MALAT-1 scoring and other Hazard Factor are all the independentpredictors of general population PCa, but t-PSA can not become the independentpredictor of PCa in PSA " diagnosis gray area " crowd, in the PCa diagnostic of areal analysis urine MALAT-1 scoring and other Hazard Factor under the receiver operating curves shown in table 2, table 3 and Fig. 6.
In single factor test logistic regression model, the PCa diagnostic of urine MALAT-1 scoring in general population does not have statistical significance compared with t-PSA, but in PSA " diagnosis gray area " crowd, be obviously better than t-PSA, see Fig. 4 A, Fig. 4 C and supplementary table 2, simultaneously, no matter in general population or in PSA " diagnosis gray area ", the diagnostic that urine MALAT-1 marks has and is better than PSA and dissociates the trend of ratio.Under the forecasting accuracy of all models and receiver operating curves, area is all summarized in table 3.Can find out, in general population, based on the forecasting accuracy of urine MALAT-1 Rating Model be 77.20% and receiver operating curves under area be 0.840, forecasting accuracy improves 2.59% than basic model, under receiver operating curves, area improves 0.0167, as shown in Figure 7; In PSA " diagnosis gray area " crowd, based on the forecasting accuracy of urine MALAT-1 Rating Model be 79.79% and receiver operating curves under area be 0.853, forecasting accuracy improves 5.32% than basic model, and under receiver operating curves, area improves 0.0318.
Be applied to by this diagnostic model in checking group crowd, the present inventor has drawn same conclusion, is not repeated herein.Please refer to Fig. 4 and table 3.Fig. 4 shows the PCa diagnostic that areal analysis urine MALAT-1 marks under receiver operating curves.Wherein, the diagnostic of (A) urine MALAT-1 scoring in discovery group general population.(B) diagnostic of urine MALAT-1 scoring in checking group general population.(C) diagnostic in discovery group PSA " diagnosis gray area " crowd compares with serum t-PSA and the free ratio of PSA in urine MALAT-1 scoring.(D) diagnostic in checking group PSA " diagnosis gray area " crowd compares with serum t-PSA and the free ratio of PSA in urine MALAT-1 scoring.
Embodiment 4
The accuracy of the prediction PCa that clinical decision tracing analysis urine MALAT-1 marks
Due to the Diagnostic Superiority of urine MALAT-1 scoring in this crowd that clinical importance and the present inventor of PSA " diagnosis gray area " find, therefore the present inventor uses the clinical value of clinical decision curve main detailed analysis urine MALAT-1 scoring in this crowd.Understand the Forecast Clinic Value of urine MALAT-1 scoring in general population as needed and please refer to Fig. 8, supplementary table 3, supplementary table 4.
The PCa predicting function of model in general population that decision-making tracing analysis is as shown in Figure 8 marked based on urine MALAT-1.(A) discovery group.(B) checking group.Basic model comprises age, prostate volume, t-PSA, the free ratio of PSA and rectal touch.
In PSA " diagnosis gray area " crowd, the dlinial prediction ability based on urine MALAT-1 Rating Model is better than basic model (Fig. 5 and table 4).When clinical puncture risks is decided to be 25%, based on urine MALAT-1 Rating Model under the prerequisite of not failing to pinpoint a disease in diagnosis 1 routine high level prostate cancer, the unnecessary puncture of 30.2%-46.5% can be avoided.The PCa predicting function of model in PSA " diagnosis gray area " crowd that decision-making tracing analysis is as shown in Figure 5 marked based on urine MALAT-1, (A) is discovery group, and (B) is checking group.Basic model comprises age, prostate volume, the free ratio of PSA and rectal touch.The dark line shows being parallel to transverse axis does not have 1 routine patient to carry out prostate biopsy.Another solid line represents all patients and all carries out prostate biopsy.
Table 1
Table 2
Table 3
Table 4
Table 5
Supplementary table 1
Supplementary table 2
Supplementary table 3
Supplementary table 4
Claims (11)
1. the lncRNA MALAT-1 be separated, it is characterized in that, its sequence is as shown in SEQ ID NO:1; Described lncRNAMALAT-1 is total length or its fragment of MALAT-1.
2. the lncRNA MALAT-1 as described in claim l, is characterized in that, described lncRNA MALAT-1 is separated the urine from people.
3. the polynucleotide be separated, it is characterized in that, described polynucleotide can be become lncRNA MALAT-1 according to claim 1 by people's cell transcription.
4. a carrier, is characterized in that, it contains lncRNA MALAT-1 according to claim 1 or polynucleotide according to claim 3.
5. lncRNA MALAT-1 according to claim 1 is preparing the application in prostate cancer marker.
6. lncRNA MALAT-1 according to claim 1 is for the preparation of the application detected in the chip of prostate cancer, preparation or test kit.
7. chip, preparation or a test kit, is characterized in that, it is containing, for example lncRNA MALAT-1 according to claim 1 or polynucleotide as claimed in claim 3.
8. a lncRNA MALAT-1 chip, is characterized in that, described lncRNA MALAT-1 chip comprises:
Solid phase carrier; And the oligonucleotide probe be fixed in order on described solid phase carrier, described oligonucleotide probe corresponds to the part or all of sequence shown in lncRNA MALAT-1 described in claim 1 specifically.
9. the application of lncRNA MALAT-1 chip according to claim 7 in the test kit for the preparation of detection prostate cancer.
10., in application as claimed in claim 9, it is characterized in that, by the lncRNA MALAT-1 content in the urine of lncRNA MALAT-1 chip detection object to be measured; Described detecting step comprises: first obtain the RNA sample be separated from object urine to be measured, described RNA arranges marker, it contacted with described lncRNA MALAT-1 chip, hybridization forms oligonucleotide probe-RNA binary complex, detects and obtains lncRNA MALAT-1 content.
11. 1 kinds of test kits, is characterized in that, containing lncRNA MALAT-1 chip according to claim 8 in described test kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410674678.8A CN104498495A (en) | 2014-11-21 | 2014-11-21 | Prostatic cancer marker lncRNA MALAT-1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410674678.8A CN104498495A (en) | 2014-11-21 | 2014-11-21 | Prostatic cancer marker lncRNA MALAT-1 and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104498495A true CN104498495A (en) | 2015-04-08 |
Family
ID=52939947
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410674678.8A Pending CN104498495A (en) | 2014-11-21 | 2014-11-21 | Prostatic cancer marker lncRNA MALAT-1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104498495A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104878008A (en) * | 2015-05-13 | 2015-09-02 | 中国人民解放军总医院 | Long noncoding RNA, primer pair for detecting expression level of long noncoding RNA in cell line and tissue as well as kit |
| CN104971363A (en) * | 2015-05-22 | 2015-10-14 | 浙江大学 | Applications of targeted HOTAIR-inhibiting small RNA in preparation of anti-prostate cancer drugs |
| CN106498062A (en) * | 2016-11-04 | 2017-03-15 | 邱宾涛 | A kind of product of diagnosis of prostate cancer and its application |
| CN108753973A (en) * | 2018-06-25 | 2018-11-06 | 宜兴市人民医院 | A kind of application of long-chain non-coding RNA and biological products |
| WO2018219264A1 (en) * | 2017-06-01 | 2018-12-06 | 上海长海医院 | Use of long-chain non-coding rna as prostatic cancer molecule marker |
| CN111420058A (en) * | 2020-04-23 | 2020-07-17 | 侯本国 | Gene inhibitor for treating prostatic cancer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146688A (en) * | 2012-09-12 | 2013-06-12 | 上海长海医院 | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis |
-
2014
- 2014-11-21 CN CN201410674678.8A patent/CN104498495A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146688A (en) * | 2012-09-12 | 2013-06-12 | 上海长海医院 | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis |
Non-Patent Citations (5)
| Title |
|---|
| EDUARDO M REIS ET AL.: "Antisense intronic non-coding RNA levels correlate to the degree of tumor differentiation in prostate cancer", 《ONCOGENE》 * |
| PING JI ET AL.: "GenBank BK001418.1", 《NCBI》 * |
| PING JI ET AL.: "MALAT-1, a novel noncoding RNA, and thymosin b4 predict metastasis and survival in early-stage non-small cell lung cancer", 《ONCOGENE》 * |
| R LIN ET AL.: "A large noncoding RNA is a marker for murine hepatocellular carcinomas and a spectrum of human carcinomas", 《ONCOGENE》 * |
| SHANCHENG REN ET AL.: "Long non-coding RNA metastasis associated in lung adenocarcinoma transcript 1 derived miniRNA as a novel plasma-based biomarker for diagnosing prostate cancer", 《EUROPEAN JOURNAL OF CANCER》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104878008A (en) * | 2015-05-13 | 2015-09-02 | 中国人民解放军总医院 | Long noncoding RNA, primer pair for detecting expression level of long noncoding RNA in cell line and tissue as well as kit |
| CN104971363A (en) * | 2015-05-22 | 2015-10-14 | 浙江大学 | Applications of targeted HOTAIR-inhibiting small RNA in preparation of anti-prostate cancer drugs |
| CN106498062A (en) * | 2016-11-04 | 2017-03-15 | 邱宾涛 | A kind of product of diagnosis of prostate cancer and its application |
| WO2018219264A1 (en) * | 2017-06-01 | 2018-12-06 | 上海长海医院 | Use of long-chain non-coding rna as prostatic cancer molecule marker |
| CN108753973A (en) * | 2018-06-25 | 2018-11-06 | 宜兴市人民医院 | A kind of application of long-chain non-coding RNA and biological products |
| CN108753973B (en) * | 2018-06-25 | 2022-01-28 | 宜兴市人民医院 | Application of long-chain non-coding RNA and biological product |
| CN111420058A (en) * | 2020-04-23 | 2020-07-17 | 侯本国 | Gene inhibitor for treating prostatic cancer |
| CN111420058B (en) * | 2020-04-23 | 2021-10-15 | 侯本国 | Gene inhibitor for treating prostatic cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yokoi et al. | A combination of circulating miRNAs for the early detection of ovarian cancer | |
| CN103146688B (en) | Application of long-chain non-coding RNA as blood molecular marker for disease diagnosis | |
| Day et al. | PCA3: from basic molecular science to the clinical lab | |
| CN104498495A (en) | Prostatic cancer marker lncRNA MALAT-1 and application thereof | |
| CN105316341B (en) | A kind of LncRNA and its application in marker or prostate cancer prognosis recurrence marker is detected as prostate cancer | |
| CN109055502B (en) | Detection method, detection kit and application of invasive fungal infection | |
| CN109161598B (en) | Prostatic cancer early diagnosis or prognosis evaluation marker lncRNA malat1 and its application | |
| WO2020048518A1 (en) | Group of genes for molecular typing of medulloblastoma and use thereof | |
| JP2016514966A (en) | Composition for prognosis detection and determination of prostate cancer and method for detection and determination | |
| CN115992229B (en) | lncRNA marker and model for pancreatic cancer prognosis risk assessment and application thereof | |
| WO2018219264A1 (en) | Use of long-chain non-coding rna as prostatic cancer molecule marker | |
| CN110229899B (en) | Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer | |
| CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
| CN108624691A (en) | A kind of marker and its application for judging prostatic disorders | |
| CN104611336B (en) | Fusion TTTY15 USP9Y and its application as prostate cancer marker | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| KR102194215B1 (en) | Biomarkers for Diagnosing Gastric Cancer And Uses Thereof | |
| CN105463114B (en) | For detecting probe, primer and the kit of 5 kinds of mankind TP53 gene mutation | |
| CN110331207A (en) | Adenocarcinoma of lung biomarker and related application | |
| CN107299129A (en) | Circle nucleic acid as breast cancer biomarker application | |
| CN109628594B (en) | One kind long-chain non-coding RNA relevant to liver cancer and its application | |
| CN105985955A (en) | Application of fingerprint atlas composed of microRNAs in gastric cancer | |
| CN108728439A (en) | The finger-print of tiny RNA composition and its application in Diagnosis of Bladder | |
| WO2014057279A1 (en) | Micro-rna biomarkers for prostate cancer | |
| CN107475430A (en) | A kind of the glioblastoma auxiliary diagnosis based on IFI30 genes, prognostic evaluation kit and its application method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150408 |
|
| WD01 | Invention patent application deemed withdrawn after publication |