CN111420058A - Gene inhibitor for treating prostatic cancer - Google Patents
Gene inhibitor for treating prostatic cancer Download PDFInfo
- Publication number
- CN111420058A CN111420058A CN202010327021.XA CN202010327021A CN111420058A CN 111420058 A CN111420058 A CN 111420058A CN 202010327021 A CN202010327021 A CN 202010327021A CN 111420058 A CN111420058 A CN 111420058A
- Authority
- CN
- China
- Prior art keywords
- inc01841
- cells
- gene inhibitor
- sirna
- inhibitor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention finds that long-chain non-coding RNA L INC01841 can be used as a drug target for treating the prostatic cancer through experiments, and also finds that the L INC01841 gene inhibitor can inhibit the proliferation rate of prostatic cancer cells, inhibit the migration of the prostatic cancer cells and inhibit the invasion of the prostatic cancer cells.
Description
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a gene inhibitor for treating prostatic cancer.
Background
Prostate cancer is a relatively common malignancy of the male genitourinary system and is one of the major malignancies responsible for male death worldwide. Although the incidence of the prostate cancer in China is far lower than that in developed countries in the West, the incidence of the prostate cancer is gradually increased due to the continuous aging of the population in China, the health of middle-aged and old men is seriously threatened, and the influence on the life style and the life quality of Chinese men is increasingly prominent. Early symptoms of prostate cancer are more insidious, and therefore, many patients are often diagnosed with advanced stages. At present, the traditional treatment methods such as local surgical excision, chemotherapy, radiotherapy and hormone blocking methods have respective defects and shortcomings, such as large side effect after treatment, easy relapse and the like. Therefore, the selection of new treatment modalities and therapeutic drugs is becoming increasingly urgent.
The long-chain non-coding RNA is a type of non-coding RNA with the length of more than 200nt, although the number of the non-coding RNA is far more than that of the coding gene, the non-coding gene is always regarded as some meaningless transcription fragments by scientists for a long time in the past, however, with the emergence of high-throughput gene sequencing technology, the importance of lncRNA is gradually realized, the current research finds that L ncRNA plays an important role in multiple aspects of cell occurrence, development, proliferation, differentiation and the like, meanwhile, the research finds that L ncRNA plays an important role in the occurrence and development of tumors, and the research becomes an important marker and drug for tumor diagnosis and treatment at present, the research of L ncRNA in tumor pathogenesis provides a new idea for the selection of a new tumor treatment target and the research of a new precise treatment drug.
At present, L INC01841 has not been reported to play a role in prostate cancer.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a gene inhibitor which is prepared by using L INC01841 as a function target and has an inhibiting effect on L INC01841, and the gene inhibitor is used for preparing a medicament for treating prostatic cancer.
In order to achieve the purpose, the invention provides the following technical scheme:
the invention provides an application of L INC01841 gene inhibitor in preparing a medicament for treating prostatic cancer, wherein the transcript of L INC01841 is NR _134908.1, and the sequence of L INC01841 is shown in SEQ ID NO. 1.
Preferably, the L INC01841 gene inhibitor is a molecular inhibitor which is prepared by using L INC01841 as an action target and has an inhibiting effect on L INC01841, and the molecular inhibitor is one of nucleic acid molecules, antibodies or small molecular compounds.
Preferably, the nucleic acid molecule comprises shRNA, siRNA, dsRNA and microrna.
Preferably, the nucleic acid molecule is an siRNA.
Preferably, the sequence of the sense strand of the siRNA is shown as SEQ ID NO.6, and the sequence of the antisense strand of the siRNA is shown as SEQ ID NO. 7.
In addition, the invention provides a gene inhibitor which is L INC01841 gene inhibitor, wherein the L INC01841 gene inhibitor is a molecular inhibitor which is prepared by using L INC01841 as an action target and has an inhibiting effect on L INC01841, and the L INC01841 gene inhibitor can be used for preparing a medicament for treating prostatic cancer.
Preferably, the L INC01841 gene inhibitor is siRNA, the sense strand sequence of the siRNA is shown as SEQ ID NO.6, and the antisense strand sequence of the siRNA is shown as SEQ ID NO. 7.
In addition, the invention provides a pharmaceutical composition for treating prostate cancer, which is characterized by comprising L INC01841 gene inhibitor.
Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and/or dressing.
Preferably, the pharmaceutically acceptable carrier and/or dressing comprises: adhesive, diluent, lubricant, surfactant and adsorption carrier.
The invention has the beneficial effects that:
furthermore, the siRNA provided by the invention can inhibit the proliferation, migration and invasion of prostate cancer cells, so that the gene inhibitor provided by the invention can be used for preparing a medicament for treating the prostate cancer and provides a new direction for developing the medicament for treating the prostate cancer.
Drawings
FIG. 1L INC01841 expression profile in normal prostate cancer epithelial cells RWPE-1 and prostate cancer cells DU-145, PC3 and L NCaP.
FIG. 2 Effect of transfection of si-L INC01841 on cell proliferation potency of PC3 cells
FIG. 3 Effect of transfection of si-L INC01841 on the cell proliferation-associated proteins c-myc and cyclinD1 of PC3 cells.
FIG. 4 Effect of transfection of si-L INC01841 on cell migration and cell invasion of PC3 cells.
FIG. 5 Effect of transfected si-L INC01841 on EMT-related proteins E-cadherin and Vimentin of PC3 cells.
Detailed Description
The present invention will now be further described with reference to specific examples, it being understood that the scope of the invention is not limited to the specific examples described below, and it is to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to be limiting of the scope of the invention.
In addition, the test methods described in the following examples, in which specific conditions are not specified, are generally performed under conventional conditions or conditions recommended by each manufacturer. The reagents and drugs mentioned in the examples are all common commercial products unless otherwise specified.
Example 1
L INC01841 expression in normal prostate cancer epithelial cells RWPE-1 and prostate cancer cells DU-145, PC3, and L NCaP.
RNA extraction
(1) Inoculating RWPE-1 cells, DU-145 cells, PC3 cells and L NCaP cells into a six-hole plate, culturing for 48 hours, adding 500 mu l Trizol when the cells are 90% full, fully mixing, transferring the mixed solution into a 2ml centrifuge tube, and standing for 5min at room temperature;
(2) placing the centrifuge tube in a low-temperature high-speed centrifuge, centrifuging at 12000rpm for 5min, and taking the supernatant;
(3) adding 100 μ l chloroform, reversing, mixing, standing at room temperature for 15 min;
(4) placing the centrifugal tube in a low-temperature high-speed centrifuge, and centrifuging at 12000rpm for 5 min;
(5) transferring the supernatant to a new 2ml RNase-free centrifuge tube, adding equal volume of precooled isopropanol, reversing, uniformly mixing, and standing on ice for 10 min;
(6) placing the centrifuge tube in a low-temperature high-speed centrifuge at 12000rpm, centrifuging for 10min, carefully removing supernatant with a pipettor, and keeping white precipitate;
(7) adding 500 μ l of 75% ethanol, reversing, mixing, placing the centrifuge tube in a low-temperature high-speed centrifuge, centrifuging at 4 deg.C and 8000rpm for 5 min;
(8) the supernatant was carefully removed, the tube was dried at room temperature, after drying, DEPC water was added to dissolve the precipitate completely, and the RNA concentration was measured with a Nanodrop 2000 spectrophotometer.
2. Quantitative fluorescence PCR detection of L INC01841 expression
(1) Reverse transcription reaction
Reference takara reverse transcription kit
A: removal of genomic DNA
| Reaction reagent | Adding amount of |
| 5×gDNA Eraser Buffer | 2.0μl |
| gDNA Eraser | 1μl |
| Total RNA | 1μg |
| RNase Free dH2O | up to 10μl |
The reaction conditions were 42 ℃ for 120s, 4 ℃.
B-reverse transcription reaction
| Reaction reagent | Adding amount of |
| Reaction solution of step (A) | 10μl |
| PrimeScript RT Enzyme Mix I | 1.0μl |
| RT Primer Mix | 1.0 |
| 5×PrimeScript |
4.0μl |
| RNase Free dH2O | 4.0μl |
Reaction conditions are as follows: 15min at 37 ℃; 85 ℃ for 5s, 4 ℃.
(2) Fluorescent PCR detection
Primer sequences
LINC01841
Forward 5’- CCGCTAAGCACACAGAGGAA‐3’（SEQ ID NO.2）
Reverse 5’- AACAGCAAGGTGTCAGCAGA‐3’（SEQ ID NO.3）
GAPDH
Forward 5’- GGTGTGAACCATGAGAAGTATGA‐3’（SEQ ID NO.4）
Reverse 5’- GAGTCCTTCCACGATACCAAAG‐3’（SEQ ID NO.5）
Reaction reagent
| Reaction reagent | Adding amount of |
| SYBR Green Premix Ex Taq（2×） | 10μl |
| Forward primer | 0.4μl |
| Reverse primer | 0.4μl |
| cDNA template | 2μl |
| ddH2O | 7.2μl |
Reaction conditions are as follows: 10min at 95 ℃; 12s at 95 ℃, 40s at 59 ℃ and 40 cycles; 5min at 60 ℃.
By using 2-△△CtThe experimental data were processed by the method and the results are shown in fig. 1.
The experimental results are as follows:
as can be seen from FIG. 1, the expression level of L INC01841 in the prostate cancer cells is higher than that of the normal cells, and the difference is statistically significant (P < 0.05), wherein the expression level of L INC01841 in the PC3 cells is the highest (6.503 + -0.116), so the PC3 cells are selected for the subsequent cell experiments.
Example 2
Effect of transfected si-L INC01841 on the cell proliferation potency of PC3 cells as determined by CCK-8
(1) 5 × 103Inoculating PC3 cells transfected with si-NC or si-L INC01841 into a 96-well plate, setting 3 multiple wells in each group, and culturing in a constant-temperature cell incubator, wherein each well is 90 mu l;
(2) detecting the cells for 0h, 24h, 48h and 72h respectively, adding 10 mul of CCK-8 detection solution into each hole during detection, and then putting the cells into a constant-temperature cell incubator to incubate for 4 hours;
(3) the cell culture plate was placed in a microplate reader, absorbance was measured at 450nm, and a growth curve was plotted, with the results shown in Table 1 and FIG. 2.
si-L INC01841 sequence
Sense strand 5'-GGUCAAGAGUUCAAGACCAAU-3' (SEQ ID NO. 6)
Antisense strand 5'-UGGUCUUGAACUCUUGACCUU-3' (SEQ ID NO. 7)
si-L INC01841 is synthesized by the Shanghai Jima gene, si-NC is supplied by the company.
TABLE 1 proliferation Change in PC3 cells after transfection of si-L INC01841 and si-NC
| Time of day | si-NC | si-LINC01841 |
| 0h | 0.096±0.007 | 0.097±0.009 |
| 24h | 0.325±0.046 | 0.186±0.042 |
| 48h | 0.675±0.049 | 0.394±0.041 |
| 72h | 0.986±0.057 | 0.612±0.046 |
Results of the experiment
As can be seen from Table 1 and FIG. 2, after transfection of si-L INC01841, the proliferation rate of PC3 cells was significantly inhibited compared to that of transfected si-NC, suggesting that inhibition of L INC01841 could inhibit the proliferation of prostate cancer cells.
Example 3
Western blot to examine the influence of transfected si-L INC01841 on proliferation-related proteins
（1）2×105The PC3 cells are inoculated on a 6-hole culture plate, after 24 hours of culture, the cells are transfected according to L ipofectin 2000, and the transfection is divided into a si-NC group and a si-L INC01841 group;
(2) after 48 hours of transfection, the cells were washed with PBS, and 150 μ l of RIPA cell lysate was added and placed on ice for 30 minutes;
(3) after full lysis, the cells were transferred to a centrifuge tube, centrifuged at 10000g/min for 15 minutes at 4 ℃;
(4) sucking the supernatant by a pipettor, and transferring the supernatant into a new centrifuge tube;
(5) sucking 2 mul, determining the protein concentration according to the BCA specification, adding 5 × SDS loading buffer solution, and boiling in a boiling water bath for 5min to obtain a protein sample.
(6) Assembling an electrophoresis tank, and preparing 5% of upper layer glue and 10% of lower layer glue;
(7) adding 20 mug protein sample and a protein Marker indicator into each hole, adding a newly configured electrophoresis buffer solution, and carrying out 80V20min and 120V 120 min;
(8) assembling a film transferring clamp, transferring the film transferring clamp into an electric transferring groove, adding electric transferring liquid, and keeping 200mA for 1.5 h;
(9) after the membrane transfer is finished, taking out the NC membrane, transferring the NC membrane into 5% skimmed milk powder, and sealing the NC membrane for 1 hour by a shaking table at room temperature;
(10) the PVDF membrane was removed, washed with TBST 5min each for 3 times, incubated with C-myc, CyclinD1 and β -actin primary anti-diluent, and incubated overnight at 4 ℃ in a shaker.
(11) Absorbing primary antibody, washing the membrane with TBST for 5min each time for 3 times, incubating secondary antibody, incubating at room temperature, and incubating for 1h in a shaking table;
(12) in a dark room, the luminescent solution is quickly dripped on the PVDF membrane for developing.
Results of the experiment
As shown in FIG. 3, it can be seen that the expression levels of C-myc and Cyclin-D1 in si-L INC 01841-transfected cells are significantly lower than those of si-NC-transfected cells, indicating that L INC01841 can inhibit the expression of C-myc and Cyclin-D1 proteins, and the above results further verify that the proliferation of prostate cancer cells can be inhibited by si-L INC 01841.
Example 4
Effect of transfected si-L INC01841 on cell migration of PC3 cells
（1）2×105The PC3 cells are inoculated on a 6-hole culture plate, after 24 hours of culture, the cells are transfected according to L ipofectin 2000, and the transfection is divided into a si-NC group and a si-L INC01841 group;
(2) digesting the cells by pancreatin after 24h of transfection, collecting the cells into a centrifuge tube, washing the cells by PBS and serum-free culture medium, suspending the cells by the serum-free culture medium, and counting;
(3) 600 μ L medium containing 10% serum was added to the lower chamber of the Transwell chamber and 100 μ L5 × 10 was added to the upper chamber4Placing the cells in a cell constant-temperature incubator to be cultured for 24 hours;
(4) carefully remove the chamber with forceps, blot the upper chamber, and transfer the chamber to a plate containing 800. mu. L methanol for 30 min at room temperature;
(5) carefully taking out the chamber by using a pair of tweezers, sucking the fixing solution in the upper chamber, transferring the chamber into a culture plate added with 800 mu L Giemsa dye solution, and dyeing for 20 minutes at room temperature;
(6) the chamber was removed, rinsed with clear water and soaked 3 times, the upper chamber liquid was aspirated, the cells on the membrane surface at the bottom of the upper chamber were carefully wiped off with a cotton swab, and the images were taken under a microscope.
Results of the experiment
The results are shown in FIG. 4 for cell migration, where it can be seen that PC3 cells transfected with si-L INC01841 crossed the Transwell chamber by a significantly reduced number of cells compared to PC3 cells transfected with si-NC, suggesting that inhibitors of the si-L INC01841 gene are capable of inhibiting the cell migration of PC3 prostate cancer cells.
Example 5
Effect of transfected si-L INC01841 on cell invasion of PC3 cells
（1）2×105The PC3 cells are inoculated on a 6-hole culture plate, after 24 hours of culture, the cells are transfected according to L ipofectin 2000, and the transfection is divided into a si-NC group and a si-L INC01841 group;
(2) digesting the cells by pancreatin after 24h of transfection, collecting the cells into a centrifuge tube, washing the cells by PBS and serum-free culture medium, suspending the cells by the serum-free culture medium, and counting;
(3) the BD Matrigel gel frozen at-80 ℃ is kept at 4 ℃ overnight, so that the BD Matrigel is completely liquid;
(4) sucking 200 mu L serum-free medium to a sterile centrifuge tube by using a pipette, adding 40 mu L Matrigel glue, gently mixing on ice, adding 100 mu L Matrigel glue to the upper chamber of a Transwell chamber, putting the chamber into a constant-temperature cell incubator, and incubating until the Matrigel glue is completely changed into a solid state;
(5) 600 μ L medium containing 10% serum was added to the lower chamber of the Transwell chamber and 100 μ L5 × 10 was added to the upper chamber4Placing the cells in a cell constant-temperature incubator to be cultured for 24 hours;
(6) the Transwell chamber was carefully removed with forceps, the liquid in the upper chamber was blotted off, and then the chamber was transferred to a cell culture plate containing 800. mu. L methanol and fixed at room temperature for 30 minutes;
(7) after fixation, the chamber was taken out, the liquid in the upper chamber was blotted, and then the chamber was transferred to a cell culture plate to which 800. mu. L Giemsa staining solution was added, and stained at room temperature for 20 minutes;
(8) the Transwell chamber was rinsed with PBS, the upper chamber fluid was aspirated, the cells in the upper chamber of the Transwell chamber were carefully wiped off, and the image was taken under a microscope.
Results of the experiment
The results of the experiments are shown in FIG. 4 for cell invasion, and it can be seen that the number of cells that were transfected with Si-L INC01841 for PC3 cells across Matrigel glue into the lower chamber is significantly reduced compared to PC3 cells transfected with si-NC, suggesting that inhibitors of the si-L INC01841 gene are capable of inhibiting the migration of PC3 cells from prostate cancer cells.
Example 6
Effect of transfected si-L INC01841 on EMT-related proteins E-cadherin and Vimentin of PC3 cells.
（1）2×105The PC3 cells are inoculated on a 6-hole culture plate, after 24 hours of culture, the cells are transfected according to L ipofectin 2000, and the transfection is divided into a si-NC group and a si-L INC01841 group;
(2) after 48 hours of transfection, the cells were washed with PBS, and 150 μ l of RIPA cell lysate was added and placed on ice for 30 minutes;
(3) after full lysis, the cells were transferred to a centrifuge tube, centrifuged at 10000g/min for 15 minutes at 4 ℃;
(4) sucking the supernatant by a pipettor, and transferring the supernatant into a new centrifuge tube;
(5) sucking 2 mul, determining the protein concentration according to the BCA specification, adding 5 × SDS loading buffer solution, and boiling in a boiling water bath for 5min to obtain a protein sample.
(6) Assembling an electrophoresis tank, and preparing 5% of upper layer glue and 12% of lower layer glue;
(7) adding 20 mug protein sample and a protein Marker indicator into each hole, adding a newly configured electrophoresis buffer solution, and carrying out 80V20min and 120V 120 min;
(8) assembling a film transferring clamp, transferring the film transferring clamp into an electric transferring groove, adding electric transferring liquid, and keeping 200mA for 1.5 h;
(9) after the film transfer is finished, taking out the PVDF film, transferring the PVDF film into 5% skimmed milk powder, and sealing the PVDF film for 1 hour by a shaking table at room temperature;
(10) the PVDF membrane was removed, washed with TBST 5min each for 3 times, incubated with E-cadherin, Vimentin and GAPDH primary antibody dilutions at 4 ℃ overnight in a shaker.
(11) Absorbing primary antibody, washing the membrane with TBST for 5min each time for 3 times, incubating secondary antibody, incubating at room temperature, and incubating for 1h in a shaking table;
(12) in a dark room, the luminescent solution is quickly dripped on the PVDF membrane for developing.
The experimental results are as follows:
as can be seen from FIG. 5, the expression of E-cadherin is up-regulated and the expression level of Vimentin is down-regulated in the cells transfected with si-L INC01841, which indicates that inhibition of L INC01841 can inhibit EMT of PC3 prostate cancer cells, and the above results further verify that migration and invasion of prostate cancer cells can be inhibited by si-L INC 01841.
In conclusion, the gene inhibitor si-L INC01841 provided by the invention can inhibit the proliferation, migration and invasion of prostate cancer cells, so that si-L INC01841 can be used for preparing medicines for treating prostate cancer.
Sequence listing
<110> Hou Home
<120> A gene inhibitor for treating prostate cancer
<160>7
<170>SIPOSequenceListing 1.0
<210>1
<211>573
<212>DNA
<213> Human source (Human)
<400>1
acgagcgggg gtggggaaga gaagagggca cagaggccag cggatgagag agacaccagg 60
gagcctggga tgcctgcccg aggctctggc cacgcccatg ccctgcctgt cccgctaagc 120
acacagagga aaggccatgt gaggacacag caagaaggcg gccatctgca agccaagaag 180
agagtcctca ccaggaacca actctgctga caccttgctg ttggacttcc agcctctata 240
aatgttcaca agcacaccac tgtttacacc catctagaag gcccctccca gctgacatct 300
ttctgcctac ctttcaggaa gacagacgaa actctctgcc ttcaggtggg gcaagactgc 360
tgatggctgg aacaggagct tggcacctcc accctgaccc agacacaagc ctgtctgtcc 420
cactcaaatc gagctggcca gagactacaa ctgtgttggt tcccaagaca tagaaaagcc 480
agaagaggtc gggcgcagtg gctcacgcct gtcagcactt tgggaagccg aggcaggcag 540
attacctaag gtcaagagtt caagaccaat ctg 573
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
<210>3
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
<210>4
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ggtgtgaacc atgagaagta tga 23
<210>5
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
gagtccttcc acgataccaa ag 22
<210>6
<211>21
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ggucaagagu ucaagaccaa u 21
<210>7
<211>21
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
uggucuugaa cucuugaccu u 21
Claims (10)
1. L INC01841 gene inhibitor is used for preparing medicine for treating prostatic cancer.
2. The use as claimed in claim 1, wherein the L INC01841 gene inhibitor is a molecular inhibitor prepared from L INC01841 as an action target and having an inhibiting effect on L INC01841, wherein the molecular inhibitor is one of a nucleic acid molecule, an antibody or a small molecular compound.
3. The use according to claim 2, wherein the nucleic acid molecule comprises shRNA, siRNA, dsRNA and microrna.
4. The use according to claim 3, wherein the nucleic acid molecule is an siRNA.
5. The use according to claim 4, wherein the sense strand sequence of said siRNA is shown as SEQ ID No.6 and the antisense strand sequence of said siRNA is shown as SEQ ID No. 7.
6. A gene inhibitor is L INC01841 gene inhibitor, wherein the L INC01841 gene inhibitor is a molecular inhibitor which is prepared by using L INC01841 as an action target and has an inhibiting effect on L INC01841, and the L INC01841 gene inhibitor can be used for preparing a medicament for treating prostatic cancer.
7. The L INC01841 gene inhibitor according to claim 6, wherein the L INC01841 gene inhibitor is siRNA, the sequence of the sense strand of the siRNA is shown as SEQ ID No.6, and the sequence of the antisense strand of the siRNA is shown as SEQ ID No. 7.
8. A pharmaceutical composition for treating prostate cancer, comprising the L INC01841 gene inhibitor of claim 6 or 7.
9. The pharmaceutical composition of claim 8, further comprising a pharmaceutically acceptable carrier and/or dressing.
10. The pharmaceutical composition according to claim 9, wherein the pharmaceutically acceptable carrier and/or dressing comprises: adhesive, diluent, lubricant, surfactant and adsorption carrier.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010327021.XA CN111420058B (en) | 2020-04-23 | 2020-04-23 | Gene inhibitor for treating prostatic cancer |
| CN202111140608.0A CN113750237A (en) | 2020-04-23 | 2020-04-23 | Pharmaceutical composition for treating prostate cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010327021.XA CN111420058B (en) | 2020-04-23 | 2020-04-23 | Gene inhibitor for treating prostatic cancer |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111140608.0A Division CN113750237A (en) | 2020-04-23 | 2020-04-23 | Pharmaceutical composition for treating prostate cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111420058A true CN111420058A (en) | 2020-07-17 |
| CN111420058B CN111420058B (en) | 2021-10-15 |
Family
ID=71554457
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010327021.XA Active CN111420058B (en) | 2020-04-23 | 2020-04-23 | Gene inhibitor for treating prostatic cancer |
| CN202111140608.0A Withdrawn CN113750237A (en) | 2020-04-23 | 2020-04-23 | Pharmaceutical composition for treating prostate cancer |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111140608.0A Withdrawn CN113750237A (en) | 2020-04-23 | 2020-04-23 | Pharmaceutical composition for treating prostate cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN111420058B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112813166A (en) * | 2021-02-03 | 2021-05-18 | 山东第一医科大学附属省立医院(山东省立医院) | Prostate cancer marker and therapeutic drug thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498495A (en) * | 2014-11-21 | 2015-04-08 | 上海长海医院 | Prostatic cancer marker lncRNA MALAT-1 and application thereof |
| CN105316341A (en) * | 2015-12-08 | 2016-02-10 | 浙江理工大学 | LncRNA and application thereof as prostatic cancer detection marker or prostatic cancer prognosis recurrence marker |
| WO2017047102A1 (en) * | 2015-09-16 | 2017-03-23 | Riken | Biomarker for cancer and use thereof |
| US20170166972A1 (en) * | 2013-11-26 | 2017-06-15 | Sanford-Burnham Medical Research Institute | Long non-coding rna as a diagnostic and therapeutic agent |
-
2020
- 2020-04-23 CN CN202010327021.XA patent/CN111420058B/en active Active
- 2020-04-23 CN CN202111140608.0A patent/CN113750237A/en not_active Withdrawn
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170166972A1 (en) * | 2013-11-26 | 2017-06-15 | Sanford-Burnham Medical Research Institute | Long non-coding rna as a diagnostic and therapeutic agent |
| CN104498495A (en) * | 2014-11-21 | 2015-04-08 | 上海长海医院 | Prostatic cancer marker lncRNA MALAT-1 and application thereof |
| WO2017047102A1 (en) * | 2015-09-16 | 2017-03-23 | Riken | Biomarker for cancer and use thereof |
| CN105316341A (en) * | 2015-12-08 | 2016-02-10 | 浙江理工大学 | LncRNA and application thereof as prostatic cancer detection marker or prostatic cancer prognosis recurrence marker |
Non-Patent Citations (3)
| Title |
|---|
| HUA ET AL.: "Landscape of Noncoding RNA in Prostate Cancer", 《TRENDS IN GENETICS》 * |
| NCBI REFERENCE SEQUENCE：NR_134908.1: "Homo sapiens long intergenic non-protein coding RNA 1841(LINC01841)，long non-coding RNA", 《GENBANK》 * |
| 郭辉等: "长链非编码RNA与前列腺癌", 《上海医学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112813166A (en) * | 2021-02-03 | 2021-05-18 | 山东第一医科大学附属省立医院(山东省立医院) | Prostate cancer marker and therapeutic drug thereof |
| CN113350508A (en) * | 2021-02-03 | 2021-09-07 | 山东第一医科大学附属省立医院(山东省立医院) | Application of reagent for down-regulating gene expression in preparation of prostate cancer medicine |
| CN112813166B (en) * | 2021-02-03 | 2021-10-22 | 山东第一医科大学附属省立医院(山东省立医院) | Prostate cancer marker and therapeutic drug thereof |
| CN113350508B (en) * | 2021-02-03 | 2022-02-08 | 山东第一医科大学附属省立医院(山东省立医院) | Application of reagent for down-regulating gene expression in preparation of prostate cancer medicine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113750237A (en) | 2021-12-07 |
| CN111420058B (en) | 2021-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107881241B (en) | Application of gene marker in diagnosis and treatment of breast cancer | |
| Ma et al. | MicroRNA-129-5p inhibits hepatocellular carcinoma cell metastasis and invasion via targeting ETS1 | |
| CN107805663B (en) | Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent | |
| CN111893120B (en) | Application of long-chain non-coding RNA LINC01141 in preparation of pharmaceutical composition for treating liver cancer | |
| CN111254146B (en) | Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer | |
| CN111118013B (en) | Leukemia biomarker LINC02033 and application thereof | |
| CN112266961B (en) | Application of TSG-6 gene in predicting colorectal cancer metastasis and prognosis | |
| CN113621690B (en) | Application of interleukin 32 as target in screening and targeting medicine for treating esophageal squamous carcinoma | |
| Wang et al. | Oestrogen up-regulates DNMT1 and leads to the hypermethylation of RUNX3 in the malignant transformation of ovarian endometriosis | |
| CN111420058B (en) | Gene inhibitor for treating prostatic cancer | |
| CN111743912B (en) | Gene inhibitor for promoting colon cancer cell apoptosis and inhibiting colon cancer cell migration | |
| CN111235275B (en) | Gene marker of lung cancer and application thereof | |
| CN108721316B (en) | Application of marker miR-652-5p in medicines and kits for metastasis, prognosis and treatment of esophageal squamous carcinoma | |
| CN114522179B (en) | Application of gene preparation in preparation of colorectal cancer cell proliferation and metastasis inhibitor | |
| CN111349706B (en) | Application of gene inhibitor in preparation of medicine for treating liver cancer | |
| CN110577952B (en) | Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer | |
| CN107937523B (en) | Lung cancer diagnosis marker microRNA-3607-3p and application thereof in medicines and diagnosis kit | |
| CN107881237B (en) | Lung cancer diagnosis marker microRNA-4317 and application thereof in medicines and diagnosis kit | |
| CN112301030B (en) | Gene inhibitor for inhibiting Hippo signal pathway and gastric cancer | |
| CN113832155B (en) | Liver cancer-related tumor marker and application thereof | |
| Peng et al. | LINC01376 promotes nasopharyngeal carcinoma tumorigenesis by competitively binding to the SP1/miR‐4757/IGF1 axis | |
| LU501763B1 (en) | SMALL INTERFERING RNAs (siRNAs) FOR INTERFERING WITH ZINC FINGER PROTEIN 24 (ZNF24) GENE EXPRESSION AND USE THEREOF IN INHIBITING CELL PROLIFERATION AND MIGRATION | |
| CN111118154B (en) | Application of LINC01272 in preparation of tumor detection reagent and/or treatment drug | |
| Wang et al. | miR-29b regulates cell proliferation and invasion in human ovarian clear cell carcinoma by targeting Lysyl oxidase (LOX) | |
| Zhang et al. | FOXA3: A Novel Tumor Suppressor in Esophageal Squamous Cell Carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |