CN103613651A - Rice plant morphogenesis regulating gene PTH1 and applications thereof - Google Patents
Rice plant morphogenesis regulating gene PTH1 and applications thereof Download PDFInfo
- Publication number
- CN103613651A CN103613651A CN201310602467.9A CN201310602467A CN103613651A CN 103613651 A CN103613651 A CN 103613651A CN 201310602467 A CN201310602467 A CN 201310602467A CN 103613651 A CN103613651 A CN 103613651A
- Authority
- CN
- China
- Prior art keywords
- gene
- pth1
- rice
- plant
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of plant genetic engineering. Specifically, the invention relates to a gene PTH1 (Panicle size, Plant height, Tiller number, Days to heading) which is cloned by using a map-based cloning technique, simultaneously affects the height, tillering, heading period and spike development of rice plants and then affects the whole morphological characteristics of rice plants, and a function of authenticating the gene by using a genetically modified complementation test; the invention also relates to the application of the gene product in regulating the morphology of rice plants so as to obtain ideal plants of crops, thereby improving the yield of rice.
Description
Technical field
The invention belongs to plant genetic engineering field.Specifically, the present invention relates to a kind ofly to utilize that one of map-based cloning clone affects Plant Height of Rice simultaneously, tillers, heading stage and fringe grow, and then affect gene PTH1 (the Panicle size of the whole morphological specificity of rice plant, Plant height, Tiller number, and utilize transgene complementation test to identify the function of this gene Days to heading); Also relate to simultaneously and utilize this gene product to regulate and control rice plant form, in order to obtain the ideotype of farm crop, improve the output of paddy rice
Background technology
Paddy rice is one of important food crop of China, is also monocotyledonous idealized model plant.From plant forms, form, plant height, tiller etc. has material impact for building up of Ideal Rice Plant Type.Suitable plant height keeps the tall and straight of plant when can make paddy rice individual plant obtain maximum production, Sd1 gene is as the rice green revolution gene of the sixties in 20th century, in the breakthrough of rice yield with in improving, has played conclusive effect; Tiller number especially available tillering is determining that rice yield has decisive role in forming.In theory, rice varieties, within certain breeding time, forms effective tillering more, and output is higher; But there are some researches show, appropriate effective tillering is more conducive to rice high yield, makes the middle and later periods of paddy growth can have more " source " energy " stream " to enter take in " storehouse " that spike of rice is point of destination, rather than be used to form too much tillering.The IPA1 ideotype gene of having cloned at present just regulates plant to have the plant height of a little higher than general kind, less tillering and large fringe, has obvious yield increasing effect; The gene of controlling Plant Height of Rice, heading stage and grain number per spike while meanwhile, also having Ghd7, Ghd8/DTH8 to be equal to is also cloned.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of protein and gene thereof that can affect rice plant morphogenesis, and thus obtained transgenic plant cells, and the method for utilizing this gene pairs plant type of rice to transform.
In order to solve the problems of the technologies described above, the invention provides a kind of protein of rice plant morphogenesis regulatory gene PTH1 coding, this protein has the aminoacid sequence shown in SEQ ID NO:2.
Protein improvement as rice plant morphogenesis regulatory gene PTH1 coding of the present invention: above-mentioned aminoacid sequence is also included in the derivative that add, replace, insert or delete one or more amino acid generations in the aminoacid sequence shown in SEQ ID No:2.
The present invention also provides a kind of gene of the above-mentioned protein of encoding, and this gene has the nucleotide sequence shown in SEQ ID No:1.
Improvement as gene of the present invention: above-mentioned nucleotide sequence is also included in mutant, allelotrope or the derivative that add, replace, insert or delete one or more Nucleotide generations in the nucleotide sequence shown in SEQ ID No:1.
The plant expression vector that the present invention also provides the plasmid that contains said gene simultaneously and contained said gene.
The present invention also provides a kind of host cell simultaneously, and this host cell contains said gene sequence.This host cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.
The present invention also provides the method for improvement rice plant form simultaneously: comprise with the gene transformation rice cell with the nucleotide sequence shown in SEQ ID No:1, then the rice cell after transforming is cultivated into plant.
Further illustrate: the object of this invention is to provide a kind of new gene PTH1 cloning from rice mutant pth1, DNA sequence dna as shown in Fig. 7 and SEQ ID No:1, also comprises the gene order that has 70% homology with the DNA sequence dna shown in SEQ ID No:1 at least.SEQ ID No:2 and the protein shown in Fig. 8 in the present invention belong to a class expressing protein, wherein carry out the functional analogue that one or several amino acid whose replacement, insertion or disappearance obtain.In addition, be also included within the mutant, allelotrope or the derivative that in SEQ ID No:1, add, replace, insert or delete one or more Nucleotide and generate, the sequence with identical function also can reach object of the present invention.
Another object of the present invention is to provide a kind of method of carrying out efficient Plant Transformation with PTH1 gene, specifically, the invention provides and there is the gene of the sequence shown in SEQ ID No:1 and Fig. 7 or the carrier of Gene Partial fragment, wherein, pCAMBIA1300-PTH1 as shown in Figure 4, this carrier can be expressed above-mentioned nucleotide sequence coded polypeptide or its homology analogue.
The present invention also provides a kind of method of utilizing plant expression vector transformed plant cells to affect rice plant form.Utilize specifically plant expression vector transformed plant cells affecting farm crop plant height, tiller, the method for heading stage and fringe portion form.
Realize concrete technological step of the present invention as follows:
One, the separation of mutant pth1 and genetic analysis:
Of the present inventionly affect Plant Height of Rice simultaneously, tiller, the mutant pth1 of heading stage and fringe portion form is from japonica rice variety Japan fine (Nipponbare) group training mutagenesis.By testing with the reciprocal cross of wild-type, prove that this mutant is subject to recessive Dominant gene, as shown in Figure 1.
Two, map based cloning PTH1:
1) Primary Location of PTH1:
For separated PTH1 gene, first the present invention sets up Liao Yige target group, and in pth1 and rice variety platform, local No. 1 hybridization combo obtains F
2target group, then by the method for map based cloning, utilize STS, SSR equimolecular mark to carry out Primary Location to PTH1 site, on the 1st karyomit(e), and between WY7 and WE20 two STS marks, sees Fig. 2 by its Primary Location.
2) Fine Mapping of PTH1:
By the BAC sequential analysis between WY7 and two marks of WE20, developing new SSR, STS mark is accurately positioned PTH1 on BAC OSJNBa0052O12, between WY4 and WY5 mark within 24.5kb scope (Fig. 3), by analyzing this section open reading frame (ORF), infers candidate gene.
3) evaluation of PTH1 gene and functional analysis:
Pass through transgenic technology, result shows that the present invention has obtained the transgenic paddy rice (Fig. 5,6) that makes mutant recover normal phenotype, proved that the present invention has correctly cloned PTH1 gene (Fig. 7), amino acid sequence analysis shows the expressing protein (Fig. 8) of a Unknown Function of PTH1 coding.
Rice plant form is the emphasis that current Rice Breeding for Super High Yield is paid close attention to, by north crop corn ideotype, improve the raising that biosynthesizing amount realizes rice yield, the Components of Ideal Rice Plant Type comprises: a little higher than general kind of plant height, less tiller, thicker stem stalk i.e. stronger lodging tolerance and first and second times more branch stalks etc.And PTH1 gene can affect Plant Height of Rice, tillers, heading stage and fringe are grown simultaneously, the clone of this gene and application, significant to the improvement of plant type of rice.
In sum, the present invention utilizes rice plant morphological mutant, by map-based cloning, in paddy rice, be cloned into first PTH1 gene, by the function of PTH1 gene is understood, plant particularly genetic mechanism and the mechanism of action thereof of grass morphogenesis have further been illustrated, for plant type of rice breeding, create paddy rice new germ plasm and lay the first stone.Effect gene Plant Height of Rice of the present invention, tiller, heading stage and fringe grow, and then affect the whole morphological specificity of rice plant.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the phenotypic map of mutant pth1 and wild-type material;
Fig. 2 is the Primary Location figure of PTH1 gene on paddy rice the 1st karyomit(e);
Fig. 3 is the Fine Mapping figure of PTH1 gene;
Fig. 4 is pCAMBIA1300-PTH1 carrier collection of illustrative plates;
Fig. 5 is function complementation experiment T
1the phenotypic map of transgenic rice plant;
Fig. 6 is the complementary T of pth1 and transgenosis
1fringe portion phenotype comparison diagram for rice plant;
Fig. 7 is the DNA nucleotide sequence of PTH1 gene;
Fig. 8 is the aminoacid sequence of PTH1 genes encoding.
Embodiment
Embodiment 1:
1, rice material:
The original wild-type of paddy rice (Oryza sativa L.) mutant pth1 (Panicle size, Plant height, Tiller number, Days to heading) is japonica rice variety Japan fine (Nipponbare).
The procurement process of paddy rice (Oryza sativa L.) mutant pth1 is specific as follows:
We utilize the callus of Japanese fine rataria induction, through inducing culture, cultivate after 3 weeks, select eugonic callus as the acceptor transforming.With the EHA105 bacterial strain that contains double base plasmid vector, infect Japanese fine callus, under dark, 25 ℃ of conditions, cultivate altogether after 3 days, cultivate containing in the screening culture medium of 40mg/LHygromycin.Screening kanamycin-resistant callus tissue is cultivated about 10 days containing on the pre-division culture medium of 50mg/L.The callus of differentiation is in advance gone on division culture medium, under illumination condition, cultivate.About one month, obtain resistant transgenic plant.In transgenosis garden, land for growing field crops, we find a routine plant height become short, tiller increase, postpone and the dysplastic material of fringe portion heading stage, through this phenotype of checking, is not that importing by foreign gene causes.This material is planted through inbreeding of more generation, proterties energy genetic stability.Therefore, by thisly showing simultaneously " that plant height becomes is short, tiller increase, heading stage postpones and fringe portion heteroplasia " material called after pth1 (Panicle size, Plant height, Tiller number, Days to heading).
Mutant pth1 and wild-type are carried out to reciprocal cross, take mutant pth1 as maternal, Japan is fine hybridizes for male parent; Take simultaneously Japan fine be female parent, pth1 is that male parent is hybridized.Positive and negative hybridization F
1for plant, all show the fine phenotype of normal similar Japan, illustrate that this proterties is controlled by recessive gene.The F of positive and negative hybridization
1the F obtaining for plant selfing
2in colony, the individual plant that shows Japanese fine phenotype meets 3:1 with the separated ratio of individual plant heredity that shows pth1 phenotype, illustrates that this proterties is subject to Dominant gene.From analyzing above, this mutation type surface is subject to recessive Dominant gene.
2, analysis and target group:
Local hybridization for No. 1 in the pth1 mutant isozygotying and rice variety platform, F
1for selfing, obtain 8247 strain F
2colony; And from 8247 strain F
2in colony, select the individuality that 1888 strains have pth1 mutant phenotype (show as of short stem, many tillers, heading stage is slow, fringe portion heteroplasia; Belong to recessive individual) as target group.The tender leaf of 1 gram of left and right is got in every strain in the watery stage, is used for extracting total DNA.
3, SSR and STS mark location PTH1 gene
Adopt the rapid extracting method of paddy rice minim DNA from rice leaf, to extract the genomic dna for the assignment of genes gene mapping.Get about 0.2g rice leaf, through liquid nitrogen freezing, pulverize in the little mortar of diameter 5cm, transfers in 1.5ml centrifuge tube and extracts DNA, and the DNA of acquisition is precipitated and dissolved in 200 μ l ultrapure waters.Each PCR 2 μ l DNA samples for reaction.
The Primary Location of PTH1 gene: the F of local No. 1 cross combination from pth1 and platform
2in 1888 recessive individualities of colony, choose at random 147 recessive individualities, the microcommunity forming is carried out ssr analysis, according to the molecular genetic linkage map of the japonica rice of announcing and long-grained nonglutinous rice establishment, choose the approximate SSR primer on each karyomit(e) that is uniformly distributed in, according to known reaction conditions, carry out pcr amplification, specific as follows:
The SSR primer chain with target gene is:
RM3482F：GCCGCTAATGTTGTTGTCAAGC，
RM3482R：CGAAGCCAACGTAGTCCAATCC；
PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 * PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul(is each 1ul of above-mentioned primer), 5U/ul Taq archaeal dna polymerase 0.3ul, ddH2O10.7ul, total system 20ul.
Pcr amplification condition is specially: 94 ℃ of denaturations 4 minutes; 94 ℃ of sex change 40 seconds, 55 ℃ of annealing 40 seconds, 72 ℃ are extended 40 seconds, 35 circulations; 72 ℃ of polishings 10 minutes;
Separated and Ethidum Eremide (EB) dyeing through 5% agarose gel electrophoresis, the polymorphism of detection PCR product, by PTH1 Primary Location on No. 1 karyomit(e) is long-armed between STS mark WY7 and WE20.
The Fine Mapping of PTH1 gene: the F that utilizes local No. 1 combination in pth1 and platform
2in colony, amount to 1741 strains recessive individual, on the basis of first location, continue design STS mark, the most at last PTH1 be accurately positioned on BAC OSJNBa0052O12, between WY4 and WY5 mark within 24.5kb scope.
STS labeled primer sequence is:
WY4F:5’-TCAACAACTGCTATAAGCGAAAG-3’
WY4R:5’-GCTAGCTCCAAGGTCTCATCT-3’；
WY5F:5’-ACTACACTAGGGCTAGGGATC-3’
WY5R:5’-TTTAGACCAGCGAATGGCAAG-3’.
Specific as follows:
PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 * PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.3ul, ddH2O10.7ul, total system 20ul.
Pcr amplification condition is specially: 94 ℃ of denaturations 4 minutes; 94 ℃ of sex change 50 seconds, 55 ℃ of annealing 50 seconds, 72 ℃ are extended 50 seconds, 38 circulations; 72 ℃ of polishings 10 minutes.
Product detects: containing 5.0% the agarose gel electrophoresis of 0.5%ug/ul EB, under ultraviolet lamp, observe and Taking Pictures recording result.
4, predictive genes and comparative analysis:
According to the result of Fine Mapping, within the scope of 24.5kb according to the prediction of Rice Automated Annotation System (http://RiceGAAS.dna.affrc.go.jp), discovery has 2 candidate genes in this interval, according to the remaining restructuring number of individuals of two marks and common separation marking, we have designed the sequencing primer of 2 genes, adopt PCR method from pth1 and wild-type kind genome, to amplify respectively these two candidate genes and carry out sequencing analysis.Specific as follows:
The sequence of target gene sequencing primer:
S1F：TCTGCTGTTGCGACCTGGA
S1R：AGAGCAGCAACTGTGGGAAGG
S2F:CGAAGACTGCCCATTGCTC
S2R:ACGGCTTCAGTTCTGGATTG
S3F:GGTGGATAACTCCCAATGCT
S3R:GGAGAAATAAACTTGTGCGAGATA
S4F:AGTAAGGTAAAGCCTGGCAAAT
S4R:TAGCGGTTCAATACGGTAAGTT
S5F:ATCCTTTCAACAGAGAACAAC
S5R:CTTGAGAAACAGGTGAGATAAT
S6F:CAAAAGAAAAACTGTAGTGAGAAC
S6R:GCCCTATGCCAAACTATGT
S7F:GCGATTAAGATTTCGGACG
S7R:TGGTCAATCGGAAGTCAA
S8F:TTGAGCGGACAGTAGGA
S8R:CTTCCCACTTCTCAACCT。
Pcr amplification system: 20ng/ul oryza sativa genomic dna 1ul, 10 * PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.3ul, ddH2O10.7ul, total system 20ul.
Pcr amplification condition: 94 ℃ of denaturations 4 minutes; 94 ℃ of sex change 1 minute, 55 ℃ of annealing 1 minute, 72 ℃ are extended 1 minute, 40 circulations; 72 ℃ of polishings 10 minutes.
Find that in the genomic DNA fragment of 1 gene wherein, product and the wild-type kind of mutant pth1 amplification relatively have 26 base deletions.By this result repeated authentication three times, find that mutant pth1 gene and wild-type more all exist 26 base deletions.According to the gene annotation information (RiceGAAS) of BAC clone OSJNBa0052O12 sequence, predict expressing protein of this genes encoding.
This gene has the nucleotide sequence shown in SEQ ID No:1.
Remarks explanation; The Nucleotide for 570 amino acid of coding (SEQ ID No:2) correspondence of underscore mark in SEQ ID No:1 (gray shade mark in Fig. 7), the i.e. exon of gene.
Embodiment 2:
Plant Transformation:
BAC is cloned to SacI and EcoRI complete degestion for OSJNBa0052O12, after electrophoretic separation, the DNA fragmentation that extracts 9.6kb is connected in pCAMBIA1300, and this clone has covered the genome area of whole goal gene ORF, also comprises ATG upstream 2.2kb sequence and TAG downstream 800bp sequence.Method by electric shock proceeds to plasmid in Agrobacterium (Agrobacterium tumefaciens) strain EHA105, then by agrobacterium mediation converted rice callus.We utilize the callus of mutant rataria induction, through inducing culture, cultivate after 3 weeks, select eugonic callus as the acceptor transforming.With the EHA105 bacterial strain that contains double base plasmid vector, infect rice callus, under dark, 25 ℃ of conditions, cultivate altogether after 3 days, cultivate containing in the screening culture medium of 40mg/LHygromycin.Screening kanamycin-resistant callus tissue is cultivated about 10 days containing on the pre-division culture medium of 50mg/L.The callus of differentiation is in advance gone on division culture medium, under illumination condition, cultivate.About one month, obtain resistant transgenic plant.To transgenosis T
0and T
1for plant, identify and continuous observation, find plant forms, comprise plant height, tiller, heading stage and fringe portion form all recovered normal.
Embodiment 3:
By in gene Introduced into Rice mutant pth1 of the present invention, " plant height, tiller, heading stage and fringe grow " of the transgenic paddy rice of final gained with contrast Japanese fine the comparing of rice varieties, all return to standard state.
What more than enumerate is only several specific embodiments of the present invention.Be necessary to point out, the present invention is not limited to above embodiment, and the content disclosed by the invention of all distortion can directly derive or associate from to(for) those of ordinary skill in the art, all should think protection scope of the present invention.
Claims (9)
1. the protein of rice plant morphogenesis regulatory gene PTH1 coding, is characterized in that: this protein has the aminoacid sequence shown in SEQ ID No:2.
2. the protein of rice plant morphogenesis regulatory gene PTH1 according to claim 1 coding, is characterized in that: described aminoacid sequence is also included in aminoacid sequence or the derivative that add, replace, insert or delete the homologous sequence of one or more amino acid or other species in the aminoacid sequence shown in SEQ ID No:2 and generate.
3. the gene of protein as claimed in claim 1 or 2 of encoding, is characterized in that: this gene has the nucleotide sequence shown in SEQ ID No:1.
4. gene according to claim 3, it is characterized in that: described nucleotide sequence is also included in the nucleotide sequence shown in SEQ ID No:1 and adds, to replace, insert or lack one or more Nucleotide and the mutant, allelotrope or the derivative that generate.
5. a plasmid that contains gene described in claim 3 or 4.
6. a plant expression vector that contains gene described in claim 3 or 4.
7. a host cell, is characterized in that: this host cell contains the gene order described in claim 3 or 4.
8. host cell according to claim 7, is characterized in that: this host cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.
9. the purposes of gene as described in claim 3 or 4, is characterized in that: for building transgenic paddy rice, the plant forms of described transgenic paddy rice is improved.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310602467.9A CN103613651B (en) | 2013-11-21 | 2013-11-21 | Rice plant morphogenesis regulating gene PTH1 and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310602467.9A CN103613651B (en) | 2013-11-21 | 2013-11-21 | Rice plant morphogenesis regulating gene PTH1 and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103613651A true CN103613651A (en) | 2014-03-05 |
| CN103613651B CN103613651B (en) | 2015-04-08 |
Family
ID=50164379
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310602467.9A Expired - Fee Related CN103613651B (en) | 2013-11-21 | 2013-11-21 | Rice plant morphogenesis regulating gene PTH1 and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103613651B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811478A (en) * | 2015-11-27 | 2017-06-09 | 华南农业大学 | A kind of method of adjusting and controlling rice plant plant height |
| CN109721649A (en) * | 2019-03-14 | 2019-05-07 | 中国水稻研究所 | A kind of plant type of rice regulation related gene, protein and application |
-
2013
- 2013-11-21 CN CN201310602467.9A patent/CN103613651B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| INTERNATIONAL RICE GENOME SEQUENCING PROJECT: "The map-based sequence of the rice genome", 《NATURE》 * |
| ITOH,T.ET AL.: "Os01g0928100 [Oryza sativa Japonica Group]", 《GENBANK DATABASE》 * |
| SASAKI,T.ET AL.: "Oryza sativa Japonica Group genomic DNA, chromosome 1, BAC clone:OSJNBa0052O12", 《GENBANK DATABASE》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811478A (en) * | 2015-11-27 | 2017-06-09 | 华南农业大学 | A kind of method of adjusting and controlling rice plant plant height |
| CN106811478B (en) * | 2015-11-27 | 2020-02-04 | 华南农业大学 | Method for regulating and controlling plant height of rice plant |
| CN109721649A (en) * | 2019-03-14 | 2019-05-07 | 中国水稻研究所 | A kind of plant type of rice regulation related gene, protein and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103613651B (en) | 2015-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN104946661B (en) | Rice grain shape controlling gene GL7 and application thereof | |
| CN103290027A (en) | Protein for regulating and controlling chloroplast growth and gene and application thereof | |
| CN103555711A (en) | Non-transgenic genome directed molecule improvement method and application of main crops | |
| CN104450711B (en) | OsmiR156f genes are increasing paddy rice effective tillering and the application in improving paddy rice single plant yield | |
| CN107353332B (en) | Protein and the application of a kind of rice chloroplast developmental regulation Gene A HS1 and its coding | |
| CN103114076A (en) | Rice leaf color control gene heme oxygenase2 (HO2) and application thereof | |
| CN102268081B (en) | Rice lateral root control gene OsIAAII and use thereof | |
| CN103613651B (en) | Rice plant morphogenesis regulating gene PTH1 and applications thereof | |
| CN102212122A (en) | Mutant lethal gene for controlling development of rice chloroplasts and application thereof | |
| CN104593380A (en) | Gene ZmHKT1;1a coding corn HKT transportprotein for improving plant salt-tolerance as well as application of gene | |
| CN104962532B (en) | A kind of Senescence of Rice controlling gene OsNaPRT1 and its coding protein and application | |
| CN102219839B (en) | Gene SRL-1 for controlling leaf shape of paddy rice and application thereof | |
| CN105524933B (en) | OsJMJ714 influences the function and its application of rice grain size and salt stress patience | |
| CN104593381A (en) | Corn salt-tolerant gene and applications thereof | |
| CN104087605B (en) | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases | |
| CN104372019B (en) | Turn cultivation, authentication method and the application of CmWRKY48 gene Cut Flower Chrysanthemum Morifoliums | |
| CN110791487A (en) | Rice receptor kinase gene LOC _ Os11g47290, and coding protein and application thereof | |
| Li et al. | Rapid generation of selectable marker-free transgenic rice with three target genes by co-transformation and anther culture | |
| CN102226187B (en) | Method for cultivating selective marker-free transgenic rice | |
| CN109456396A (en) | A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding | |
| CN104805100B (en) | Paddy gene OsS μ 2 applications in plant leaf blade aging is delayed of BP | |
| CN115305252A (en) | Receptor kinase gene OsIFBR1 for regulating and controlling rice resistance | |
| CN104558132B (en) | Peanut DELLA gene families and its encoding gene and application | |
| CN112301034B (en) | Rice low light response gene RLL1, mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150408 Termination date: 20211121 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |