CN103613651B - Rice plant morphogenesis regulating gene PTH1 and applications thereof - Google Patents
Rice plant morphogenesis regulating gene PTH1 and applications thereof Download PDFInfo
- Publication number
- CN103613651B CN103613651B CN201310602467.9A CN201310602467A CN103613651B CN 103613651 B CN103613651 B CN 103613651B CN 201310602467 A CN201310602467 A CN 201310602467A CN 103613651 B CN103613651 B CN 103613651B
- Authority
- CN
- China
- Prior art keywords
- pth1
- rice
- gene
- plant
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention belongs to the field of plant genetic engineering. Specifically, the invention relates to a gene PTH1 (Panicle size, Plant height, Tiller number, Days to heading) which is cloned by using a map-based cloning technique, simultaneously affects the height, tillering, heading period and spike development of rice plants and then affects the whole morphological characteristics of rice plants, and a function of authenticating the gene by using a genetically modified complementation test; the invention also relates to the application of the gene product in regulating the morphology of rice plants so as to obtain ideal plants of crops, thereby improving the yield of rice.
Description
Technical field
The invention belongs to plant genetic engineering field.Specifically, the present invention relates to one utilize map-based cloning to clone one affects Plant Height of Rice simultaneously, tillers, heading stage and fringe grow, and then affect gene PTH1 (the Panicle size of the whole morphological specificity of rice plant, Plant height, Tiller number, Days to heading), and utilize transgene complementation test to identify the function of this gene; Also relate to simultaneously and utilize this gene product to regulate and control rice plant form, in order to obtain the ideotype of farm crop, improve the output of paddy rice
Background technology
Paddy rice is one of important food crop of China, is also monocotyledonous idealized model plant.From plant forms composition, plant height, tiller etc. has material impact for building up of Ideal Rice Plant Type.Suitable plant height keeps the tall and straight of plant while paddy rice individual plant can be made to obtain maximum production, and Sd1 gene, as the rice green revolution gene of the sixties in 20th century, serves conclusive effect in the breakthrough and raising of rice yield; Tiller number especially available tillering has decisive role in decision rice yield is formed.In theory, rice varieties is within certain breeding time, and form effective tillering more, output is higher; But there are some researches show, appropriate effective tillering is more conducive to rice high yield, makes the middle and later periods of paddy growth that more " source " energy " stream " can be had to enter in " storehouse " on ground for the purpose of spike of rice, instead of tiller for the formation of too much.The IPA1 ideotype gene of having cloned at present just regulates plant to have the plant height of a little higher than general kind, less tillering and large fringe, has obvious yield increasing effect; Meanwhile, also have Ghd7, Ghd8/DTH8 to control Plant Height of Rice when being equal to, the gene of heading stage and grain number per spike is also cloned.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of protein and the gene thereof that can affect rice plant morphogenesis, and thus obtained transgenic plant cells, and utilizes this gene pairs plant type of rice to carry out the method transformed.
In order to solve the problems of the technologies described above, the invention provides the protein that a kind of rice plant morphogenesis regulatory gene PTH1 encodes, this protein has the aminoacid sequence shown in SEQ ID NO:2.
Protein improvement as rice plant morphogenesis regulatory gene PTH1 of the present invention encodes: above-mentioned aminoacid sequence is also included in the aminoacid sequence shown in SEQ ID No:2 the derivative that add, replace, insert or delete one or more amino acid and generate.
The present invention also provides a kind of gene of above-mentioned protein of encoding, and this gene has the nucleotide sequence shown in SEQ ID No:1.
Improvement as gene of the present invention: above-mentioned nucleotide sequence is also included in the nucleotide sequence shown in SEQ ID No:1 the mutant, allelotrope or the derivative that add, replace, insert or delete one or more Nucleotide and generate.
The present invention also provides the plasmid containing said gene and the plant expression vector containing said gene simultaneously.
The present invention also provides a kind of host cell simultaneously, and this host cell contains said gene sequence.This host cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.
The present invention also provides the method for improvement rice plant form simultaneously: comprise the gene transformation rice cell with having the nucleotide sequence shown in SEQ ID No:1, then the rice cell after transforming is cultivated into plant.
Illustrate further: the object of this invention is to provide a kind of new gene PTH1 cloned from rice mutant pth1, DNA sequence dna as shown in Fig. 7 and SEQ ID No:1, also comprises the gene order having 70% homology with the DNA sequence dna shown in SEQ ID No:1 at least.The protein shown in SEQ ID No:2 and Fig. 8 in the present invention belongs to a class expressing protein, wherein carries out the functional analogue that one or several amino acid whose replacement, insertion or disappearance obtain.In addition, be also included within and add, replace, insert or delete one or more Nucleotide in SEQ ID No:1 and the mutant, allelotrope or the derivative that generate, the sequence with identical function also can reach object of the present invention.
Another object of the present invention is to provide a kind of method that PTH1 gene carries out efficient Plant Transformation, specifically, the invention provides and there is the gene of the sequence shown in SEQ ID No:1 and Fig. 7 or the carrier of Gene Partial fragment, wherein, pCAMBIA1300-PTH1 as shown in Figure 4, this carrier can express above-mentioned nucleotide sequence coded polypeptide or its homologs.
Present invention also offers a kind of method utilizing plant expression vector transformed plant cells to affect rice plant form.Utilize plant expression vector transformed plant cells affecting farm crop plant height specifically, tiller, the method for heading stage and fringe portion form.
Realize concrete technological step of the present invention as follows:
One, the separation of mutant pth1 and genetic analysis:
Of the present inventionly affect Plant Height of Rice simultaneously, tiller, the mutant pth1 of heading stage and fringe portion form is from japonica rice variety Japan fine (Nipponbare) group training mutagenesis.By testing with the reciprocal cross of wild-type, prove that this mutant controls by Recessive genes, as shown in Figure 1.
Two, map based cloning PTH1:
1) Primary Location of PTH1:
In order to be separated PTH1 gene, first the present invention has set up a target group, hybridizes combo obtain F by No. 1, this locality in pth1 and rice variety platform
2target group, then by the method for map based cloning, utilize STS, SSR equimolecular to mark and Primary Location is carried out to PTH1 site, by its Primary Location on the 1st karyomit(e), and between WY7 and WE20 two STS marks, see Fig. 2.
2) Fine Mapping of PTH1:
By to WY7 and WE20 two mark between BAC sequential analysis, develop that PTH1 is accurately positioned BAC OSJNBa0052O12 on by new SSR, STS mark, WY4 and WY5 mark between within 24.5kb scope (Fig. 3), infer candidate gene by analyzing this section open reading frame (ORF).
3) qualification of PTH1 gene and functional analysis:
Pass through transgenic technology, result shows present invention obtains the transgenic paddy rice (Fig. 5,6) making mutant recover normal phenotype, demonstrate the present invention and correctly cloned PTH1 gene (Fig. 7), amino acid sequence analysis shows that PTH1 encodes the expressing protein (Fig. 8) of a Unknown Function.
Rice plant form is the emphasis that current Rice Breeding for Super High Yield is paid close attention to, improve biosynthesizing amount by north crop corn ideotype and realize the raising of rice yield, the Components of Ideal Rice Plant Type comprises: a little higher than general kind of plant height, less to tiller, lodging tolerance and more first and second branch stalks etc. that thicker stem stalk is namely stronger.And PTH1 gene can affect Plant Height of Rice, tillers, heading stage and fringe are grown, the clone of this gene and application simultaneously, significant to the improvement of plant type of rice.
In sum, the present invention utilizes rice plant morphological mutant, in paddy rice, PTH1 gene has been cloned into first by map-based cloning, by understanding the function of PTH1 gene, further illustrate the plant particularly genetic mechanism of grass morphogenesis and the mechanism of action thereof, for plant type of rice breeding, create paddy rice new germ plasm and lay the first stone.Effect gene Plant Height of Rice of the present invention, tiller, heading stage and fringe grow, and then affect the whole morphological specificity of rice plant.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the phenotypic map of mutant pth1 and wild-type material;
Fig. 2 is the Primary Location figure of PTH1 gene on paddy rice the 1st karyomit(e);
Fig. 3 is the Fine Mapping figure of PTH1 gene;
Fig. 4 is pCAMBIA1300-PTH1 Vector map;
Fig. 5 is function complementation experiment T
1the phenotypic map of transgenic rice plant;
Fig. 6 is the complementary T of pth1 and transgenosis
1for the fringe portion phenotype comparison diagram of rice plant;
Fig. 7 is the DNA nucleotide sequence of PTH1 gene;
Fig. 8 is the aminoacid sequence of PTH1 genes encoding.
Embodiment
Embodiment 1:
1, rice material:
The original wild type of paddy rice (Oryza sativa L.) mutant pth1 (Panicle size, Plant height, Tiller number, Days to heading) is japonica rice variety Japan fine (Nipponbare).
The procurement process of paddy rice (Oryza sativa L.) mutant pth1 is specific as follows:
We utilize the callus of Japanese fine rataria induction, after inducing culture cultivates 3 weeks, select the acceptor that eugonic callus is used as to transform.Infect Japanese fine callus with the EHA105 bacterial strain containing binary plasmid carrier, under dark, 25 DEG C of conditions, Dual culture is after 3 days, is cultivating containing in the screening culture medium of 40mg/LHygromycin.Screening kanamycin-resistant callus tissue is being cultivated about 10 days containing on the pre-division culture medium of 50mg/L.The callus of breaking up in advance is gone on division culture medium, cultivates under illumination condition.Within about one month, obtain resistant transgenic plant.In transgenosis garden, land for growing field crops, we find a routine plant height become short, tiller increase, heading stage postpones and the dysplastic material in fringe portion, through verifying that this phenotype is not caused by the importing of foreign gene.This material is planted through inbreeding of more generation, proterties energy genetic stability.Therefore, by thisly showing simultaneously " plant height becomes short, tiller increase, heading stage postpones and fringe portion heteroplasia " material designation be pth1 (Panicle size, Plant height, Tiller number, Daysto heading).
Mutant pth1 and wild-type are carried out reciprocal cross, namely with mutant pth1 for female parent, Japan is fine hybridizes for male parent; Simultaneously fine with Japan is maternal, and pth1 is that male parent is hybridized.Positive and negative hybridization F
1all show the fine phenotype of normal similar Japan for plant, illustrate that this proterties controls by recessive gene.The F of positive and negative hybridization
1for the F that plant selfing obtains
2in colony, the individual plant showing Japanese fine phenotype meets 3:1 with the individual plant heredity segregation ratio showing pth1 phenotype, illustrates that this proterties is by Dominant gene.From analyzing above, this mutation type surface controls by Recessive genes.
2, analysis and target group:
Hybridize for local No. 1 in the pth1 mutant isozygotied and rice variety platform, F
1for selfing, obtain 8247 strain F
2colony; And from 8247 strain F
2select 1888 strains in colony to there is the individuality of pth1 mutant phenotype (namely show as of short stem, many tillers, heading stage is slow, fringe portion heteroplasia; Belong to recessive individual) as target group.The tender leaf of about 1 gram is got in every strain in the watery stage, is used for extracting STb gene.
3, SSR and STS mark location PTH1 gene
Adopt the rapid extracting method of paddy rice minim DNA from rice leaf, extract the genomic dna being used for the assignment of genes gene mapping.Get about 0.2g rice leaf, through liquid nitrogen freezing, pulverize in the little mortar of diameter 5cm, transfers in 1.5ml centrifuge tube and extracts DNA, and the DNA of acquisition is precipitated and dissolved in 200 μ l ultrapure waters.Each PCR reacts by 2 μ l DNA sample.
The Primary Location of PTH1 gene: the F of local No. 1 cross combination from pth1 and platform
2in colony's 1888 recessive individualities, random selecting 147 is recessive individual, the microcommunity of composition carries out ssr analysis, according to the molecular genetic linkage map that the japonica rice of announcing and long-grained nonglutinous rice create, choose approaches uniformity and be distributed in SSR primer on each bar karyomit(e), pcr amplification is carried out according to known reaction conditions, specific as follows:
The SSR primer chain with target gene is:
RM3482F：GCCGCTAATGTTGTTGTCAAGC，
RM3482R：CGAAGCCAACGTAGTCCAATCC；
PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul(and each 1ul of above-mentioned primer), 5U/ul Taq archaeal dna polymerase 0.3ul, ddH2O10.7ul, total system 20ul.
Pcr amplification condition is specially: 94 DEG C of denaturations 4 minutes; 94 DEG C of sex change 40 seconds, 55 DEG C of annealing 40 seconds, 72 DEG C extend 40 seconds, 35 circulations; 72 DEG C of polishings 10 minutes;
Be separated and Ethidum Eremide (EB) dyeing through 5% agarose gel electrophoresis, detect the polymorphism of PCR primer, PTH1 Primary Location STS on No. 1 chromosome long arm is marked between WY7 and WE20.
The Fine Mapping of PTH1 gene: utilize local No. 1 F combined in pth1 and platform
2amount to 1741 strains in colony recessive individual, design STS mark continued on the basis of first location, the most at last PTH1 be accurately positioned BAC OSJNBa0052O12 on, WY4 and WY5 mark between within 24.5kb scope.
STS labeled primer sequence is:
WY4F:5’-TCAACAACTGCTATAAGCGAAAG-3’
WY4R:5’-GCTAGCTCCAAGGTCTCATCT-3’；
WY5F:5’-ACTACACTAGGGCTAGGGATC-3’
WY5R:5’-TTTAGACCAGCGAATGGCAAG-3’.
Specific as follows:
PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.3ul, ddH2O10.7ul, total system 20ul.
Pcr amplification condition is specially: 94 DEG C of denaturations 4 minutes; 94 DEG C of sex change 50 seconds, 55 DEG C of annealing 50 seconds, 72 DEG C extend 50 seconds, 38 circulations; 72 DEG C of polishings 10 minutes.
Product detects: containing 0.5%ug/ul EB 5.0% agarose gel electrophoresis, observe also Taking Pictures recording result under ultraviolet lamp.
4, predictive genes and comparative analysis:
According to the result of Fine Mapping, according to the prediction of Rice Automated Annotation System (http://RiceGAAS.dna.affrc.go.jp) within the scope of 24.5kb, find in this interval, have 2 candidate genes, according to the two remaining restructuring number of individuals of mark and common separation markings, we devise the sequencing primer of 2 genes, adopt PCR method from pth1 and wild-type variety genome, amplify these two candidate genes respectively and carry out sequencing analysis.Specific as follows:
The sequence of target gene sequencing primer:
S1F：TCTGCTGTTGCGACCTGGA
S1R：AGAGCAGCAACTGTGGGAAGG
S2F:CGAAGACTGCCCATTGCTC
S2R:ACGGCTTCAGTTCTGGATTG
S3F:GGTGGATAACTCCCAATGCT
S3R:GGAGAAATAAACTTGTGCGAGATA
S4F:AGTAAGGTAAAGCCTGGCAAAT
S4R:TAGCGGTTCAATACGGTAAGTT
S5F:ATCCTTTCAACAGAGAACAAC
S5R:CTTGAGAAACAGGTGAGATAAT
S6F:CAAAAGAAAAACTGTAGTGAGAAC
S6R:GCCCTATGCCAAACTATGT
S7F:GCGATTAAGATTTCGGACG
S7R:TGGTCAATCGGAAGTCAA
S8F:TTGAGCGGACAGTAGGA
S8R:CTTCCCACTTCTCAACCT。
PCR amplification system: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.3ul, ddH2O10.7ul, total system 20ul.
Pcr amplification condition: 94 DEG C of denaturations 4 minutes; 94 DEG C of sex change 1 minute, 55 DEG C of annealing 1 minute, 72 DEG C extend 1 minute, 40 circulations; 72 DEG C of polishings 10 minutes.
Find that, in the genomic DNA fragment of wherein 1 gene, the product that mutant pth1 increases compares with wild-type variety 26 base deletions.By this result repeated authentication three times, find that mutant pth1 gene more all exists 26 base deletions with wild-type.Clone the gene annotation information (RiceGAAS) of OSJNBa0052O12 sequence according to BAC, predict this genes encoding expressing protein.
This gene has the nucleotide sequence shown in SEQ ID No:1.
Remarks explanation; In SEQ ID No:1, underscore mark (in Fig. 7 gray shade mark) is the Nucleotide that coding 570 amino acid (SEQ ID No:2) are corresponding, i.e. the exon of gene.
Embodiment 2:
Plant Transformation:
BAC is cloned OSJNBa0052O12 SacI and EcoRI complete degestion, after electrophoretic separation, the DNA fragmentation extracting 9.6kb is connected in pCAMBIA1300, and this clone covers the genome area of whole goal gene ORF, also comprises ATG upstream 2.2kb sequence and TAG downstream 800bp sequence.By the method for electric shock, plasmid is proceeded in Agrobacterium (Agrobacteriumtumefaciens) strain EHA105, then by agrobacterium mediation converted rice callus.The callus that we utilize mutant rataria to induce, after inducing culture cultivates 3 weeks, selects the acceptor that eugonic callus is used as to transform.Infect rice callus with the EHA105 bacterial strain containing binary plasmid carrier, under dark, 25 DEG C of conditions, Dual culture is after 3 days, is cultivating containing in the screening culture medium of 40mg/LHygromycin.Screening kanamycin-resistant callus tissue is being cultivated about 10 days containing on the pre-division culture medium of 50mg/L.The callus of breaking up in advance is gone on division culture medium, cultivates under illumination condition.Within about one month, obtain resistant transgenic plant.To transgenosis T
0and T
1carry out qualification and continuous print for plant to observe, find plant forms, comprise plant height, tiller, heading stage and fringe portion form all recover normal.
Embodiment 3:
By in channel genes rice mutant pth1 of the present invention, compared with " plant height, tiller, heading stage and fringe grow " of the transgenic paddy rice of final gained is fine with contrast rice varieties Japan, all return to standard state.
What more than enumerate is only several specific embodiments of the present invention.Be necessary to point out, the present invention is not limited to above embodiment, for all distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.
Claims (1)
1. the purposes of rice plant morphogenesis regulatory gene PTH1, it is characterized in that: for building transgenic paddy rice, be mutant pth1 for genetically modified paddy rice, the plant height of described transgenic paddy rice, tiller, heading stage length and fringe portion grow fine with contrast rice varieties Japan compared with, return to standard state; The nucleotide sequence of this gene is as shown in SEQ ID No:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310602467.9A CN103613651B (en) | 2013-11-21 | 2013-11-21 | Rice plant morphogenesis regulating gene PTH1 and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310602467.9A CN103613651B (en) | 2013-11-21 | 2013-11-21 | Rice plant morphogenesis regulating gene PTH1 and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103613651A CN103613651A (en) | 2014-03-05 |
| CN103613651B true CN103613651B (en) | 2015-04-08 |
Family
ID=50164379
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310602467.9A Expired - Fee Related CN103613651B (en) | 2013-11-21 | 2013-11-21 | Rice plant morphogenesis regulating gene PTH1 and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103613651B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811478B (en) * | 2015-11-27 | 2020-02-04 | 华南农业大学 | Method for regulating and controlling plant height of rice plant |
| CN109721649B (en) * | 2019-03-14 | 2021-05-11 | 中国水稻研究所 | Rice plant type regulation related gene, protein and application |
-
2013
- 2013-11-21 CN CN201310602467.9A patent/CN103613651B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103613651A (en) | 2014-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946661B (en) | Rice grain shape controlling gene GL7 and application thereof | |
| CN106399323B (en) | A kind of Rice Leaf color controlling gene YL1 and its application | |
| CN104450711B (en) | OsmiR156f genes are increasing paddy rice effective tillering and the application in improving paddy rice single plant yield | |
| CN115305252A (en) | Receptor kinase gene OsIFBR1 for regulating and controlling rice resistance | |
| CN107353332A (en) | A kind of rice chloroplast developmental regulation Gene A HS1 and its coding protein and application | |
| CN102268081B (en) | Rice lateral root control gene OsIAAII and use thereof | |
| CN103613651B (en) | Rice plant morphogenesis regulating gene PTH1 and applications thereof | |
| CN101857633A (en) | Leaf-shaped control gene SRNL1 of rice and application thereof | |
| CN102212122A (en) | Mutant lethal gene for controlling development of rice chloroplasts and application thereof | |
| CN104962532B (en) | A kind of Senescence of Rice controlling gene OsNaPRT1 and its coding protein and application | |
| CN102219839B (en) | Gene SRL-1 for controlling leaf shape of paddy rice and application thereof | |
| CN104593380A (en) | Gene ZmHKT1;1a coding corn HKT transportprotein for improving plant salt-tolerance as well as application of gene | |
| CN104593383A (en) | Gene TaFBK1 with F-box structure field, and expression vector and application thereof | |
| CN110791487A (en) | Rice receptor kinase gene LOC _ Os11g47290, and coding protein and application thereof | |
| Li et al. | Rapid generation of selectable marker-free transgenic rice with three target genes by co-transformation and anther culture | |
| CN109456396A (en) | A kind of protein, molecular labeling and the application of Senescence of Rice and fringe type controlling gene HK73 and its coding | |
| CN102226187B (en) | Method for cultivating selective marker-free transgenic rice | |
| CN105294846A (en) | Application of CIC1 protein in regulation and control of plant low-temperature resistance | |
| CN112457385B (en) | Application of gene LJP1 for controlling rice growth period | |
| CN104805100B (en) | Paddy gene OsS μ 2 applications in plant leaf blade aging is delayed of BP | |
| CN103484472A (en) | Rice lateral root formation control gene OsHK1 and coded protein thereof | |
| CN102994528B (en) | Haynaldia villosa calmodulin interacting protein kinase gene and expression vector and application thereof | |
| CN102206652B (en) | Rice gel consistency control gene GC6 and application thereof | |
| CN104371023A (en) | Application of CDS sequence of paddy rice transcription factor Os01g36630 gene | |
| CN102154311A (en) | Gene GE1 for controlling size of paddy embryo and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150408 Termination date: 20211121 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |