CN103602722B - Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia - Google Patents
Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia Download PDFInfo
- Publication number
- CN103602722B CN103602722B CN201310319417.XA CN201310319417A CN103602722B CN 103602722 B CN103602722 B CN 103602722B CN 201310319417 A CN201310319417 A CN 201310319417A CN 103602722 B CN103602722 B CN 103602722B
- Authority
- CN
- China
- Prior art keywords
- methylation
- schizophrenia
- test kit
- primer
- drd3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the test kit and application thereof that can be used for detecting the DRD3 gene methylation degree relevant to schizophrenia, feature is that this test kit comprises a pair DRD3 gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer, wherein upstream primer has the nucleotide sequence as shown in SEQ ID NO.1, downstream primer has the nucleotide sequence as shown in SEQ ID NO.2, methylation-specific sequencing primer is as shown in SEQ ID NO.3, advantage is the detection that this diagnostic kit can realize quickly and easily on a molecular scale to schizophrenia and hypotype thereof, detection efficiency is high, with strong points, simultaneously, the medicine being target spot with DRD3 gene promoter zone methylation is expected to become schizophrenia auxiliary diagnosis, a kind of new tool detecting and screen.
Description
Technical field
The present invention relates to the schizoid detection kit of a kind of personalized auxiliary diagnosis, especially relate to a kind of can be used for detect relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof.Background technology
Schizophrenia (Schizophrenia) is one of great mental disorder, and it can cause the collapse of form of thinking and emotional reactions, concrete manifestation is felt, consciousness, thinking, the obstacle such as emotion and act of will.Schizophrenia is the disease that a kind of inherited genetic factors and the acting in conjunction of Environmental Psychology factor cause.It is reported, Chinese current schizophreniac's quantity is up to 1,300 ten thousand.A schizophreniac is just had in every 100 people of the whole of China.Current, although psychiatry research is mainly devoted to neuroscience field, do not find out rational pathogenesis so far.Therefore, the schizophrenia research carrying out feasibility has very large prospect.
Dopamine Receptors D3(
dRD3) be distributed in nucleus accumbens septi and the Calleja island of limbic midbrain area, be by a kind of G-protein coupling receptor of genes encoding, and
dRD3gene is positioned at 3q13.3(No. 3 chromosome long arm 13 district 3 and is with).Current research both domestic and external verified " schizoid clinical symptom due to central dopamine hyperaction cause ".And having research background to show: methylating of gene is not changing in DNA sequence dna situation, affecting genetic expression.Whether there is dependency between gene methylation and schizophrenia to need to be verified further.At present, also do not disclose both at home and abroad any about detection relevant to schizophrenia
dRD3the correlative study report of the test kit of gene methylation degree.
Summary of the invention
Technical problem to be solved by this invention be to provide a kind of can be used for detect relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof, this test kit is by the significance of difference analysis of each CpG point, and can realize the detection to schizophrenia and schizophrenia subtypes quickly and easily on a molecular scale, detection efficiency is high, with strong points.
The present invention solves the problems of the technologies described above adopted technical scheme: can be used for detection relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof, this test kit comprises a pair
dRD3gene methylation specificity amplification primer and methylation-specific sequencing primer, wherein
The nucleotide sequence of described methylation-specific amplification upstream primer is as shown in SEQ ID NO.1:
5’- AGGGAGTTAAGAGTTTAGATATAAGG -3’(SEQ ID NO.1);
The nucleotide sequence of described methylation-specific amplification downstream primer is as shown in SEQ ID NO.1:
5’- GTTTAGGGTTTGTAGGG -3’(SEQ ID NO.2);
Described methylation-specific sequencing primer is as shown in SEQ ID NO.3:
5’-Biotin- ACCCAAAACCACCTCTAAACAT -3’(SEQ ID NO.3)。
A kind of can be used for detect relevant to schizophrenia
dRD3the application of the test kit of gene methylation degree, in periphery blood examination is surveyed, DRD3 gene CpG 2 methylations of obtaining are detected and normal group has significant difference by this test kit, then judge that the male sex suffers from prepattern and paranoid schizophrenia, women then suffers from prepattern schizophrenia; Detect by this test kit DRD3 gene CpG 3 methylations of obtaining and normal group has significant difference, then judge that the male sex suffers from prepattern and paranoid schizophrenia, women then suffers from prepattern schizophrenia; Detect by this test kit DRD3 gene CpG 5 methylations of obtaining and normal group has significant difference, then judge that women's group suffers from paranoid schizophrenia.
Compared with prior art, the invention has the advantages that: the present invention make public for the first time can be used for detect relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof,
dRD3the hyper-methylation level of gene causes
dRD3the low expression of gene, thus impact
dRD3reduce in the internal circulating load of brain path transhipment, finally cause schizoid generation and development.Therefore
dRD3gene methylation level is negative correlation at brain and prevalence of schizophrenia.To detect peripheral blood
dRD3diagnostic kit based on gene promoter zone methylation level, can realize the detection to schizophrenia and schizophrenia subtypes quickly and easily on a molecular scale, detection efficiency is high, with strong points.This test kit can be used in the auxiliary diagnosis of each crowd's schizophrenia subtypes of men and women, detection or examination medicine, and application prospect is extensive.
Accompanying drawing explanation
Fig. 1 is
dRD3the association analysis result of 5 CpG points that gene is detected sequence region and detects; (such as CpG1 and CpG2 dependency is 0.862, CpG3 and CpG4 dependency is 0.193)
Fig. 2 is methylation level detected result example: represent methylation, and the methylation as illustrated CpG1 to CpG5 is respectively 13%, 18%, 13%, 8%, 8%.
Embodiment
Below in conjunction with accompanying drawing embodiment, the present invention is described in further detail.
Specific embodiment
1, the collection of research object
Schizophreniac is collected from certain hospital, 354 examples altogether, collect 300 normal persons as a control group simultaneously, through the analysis of age (age of final selected sample is all about thirty years old), sex, knowledge background and these data of DNA related concentrations, filter out the match index (age, educational background, sex) higher experiment sample amount: 30 schizophreniacs (15 male sex+15 women), 30 Normal groups (15 male sex+15 women).
2, the extraction of genomic dna
The Whole Blood Genomic DNA of sample is extracted in application Lab-Aid 820 Full automatic instrument for extracting nucleic acid (Chinese Xiamen Zeesan Biotech Co., Ltd., 500ul system), then detects the concentration of gained DNA by nucleic acid-protein determinator, for
dRD3the detection of gene promoter area DNA methylation level.
3, DNA methylation level determination
This research adopts bisulfite pyrosequencing techniques pair
dRD35 CpG sites (as Fig. 1) of gene promoter area have carried out DNA methylation level detection.The ultimate principle of this technology: after the bisulfite process DNA sample in test kit, using polymerase chain reaction (PCR) amplification again, the methylated cytosine(Cyt) of generation (C) base can be made to remain unchanged, and make that methylated C does not occur and be transformed to uridylic (U), then carry out PCR order-checking by sequencing primer, thus obtain which site and there occurs and methylate.This research adopts PyroMark Assay Design software to carry out design of primers, for the pcr amplification primer of testing and sequencing primer as follows:
(1) methylation-specific upstream primer (Forward primer)
5’- AGGGAGTTAAGAGTTTAGATATAAGG -3’(SEQ ID NO.1),
(2) methylation-specific downstream primer (Reverse primer)
5’- GTTTAGGGTTTGTAGGG -3’(SEQ ID NO.2);
(3) methylation-specific sequencing primer (Sequencing primer)
5’-Biotin- ACCCAAAACCACCTCTAAACAT -3’ (SEQ ID NO.3)。
The concrete steps of above-mentioned amplification are:
A. QIAGEN EpiTect bisulf iotate-treated test kit (EpiTech Bisulfite Kits is adopted; Qiagen; #59104) bisulfite conversion is carried out to sample DNA;
B. get DNA sample 20ng transformed in steps A and join Pyromark PCR kit (Pyromark PCR Kit; Qiagen; #978703), and add above-mentioned a pair
dRD3gene promoter zone methylation specificity amplification primer, carries out pcr amplification, amplification condition: the first sex change of 95 DEG C of 15min; Then 95 DEG C of 15s, Tm 30s, 72 DEG C of 20s, the annealing reaction of totally 50 circulations; Then extension 72 DEG C of 5min(note: Tm determine according to race PCR gradient temperature in an experiment);
C. the early-stage preparations of Manganic pyrophosphate complex initiation: add annealing buffer (the PyroMark Annealing Buffer that 45 μ l contain 0.3 μM of above-mentioned methylation-specific sequencing primer in PSQ96 plate in advance; Qiagen; #979009); Transfer in an Eppendorf pipe by needing the sepharose 4B total amount (every sample 3 μ l) of the mixing used; Binding buffer liquid (PyroMark Binding Buffer is added in sepharose 4B; Qiagen; #979006), make average each sample about have the volume of 50 μ l, mixture is mixed; Above mixture is added in PCR primer (50 μ l reaction volume), every sample 50 μ l; PCR primer is mixed 10 minutes at normal temperatures, magnetic bead is combined with vitamin H; In vacuum preparation work station, in four sample panel, add the high purity water of 180ml, 70% ethanol, lavation buffer solution (PyroMark Wash Buffer successively; Qiagen; #979008) and denaturation buffer (the PyroMark Denaturation Solution of 120ml; Qiagen; #979007); Open the pump at vacuum preparation work station, vacuum preparation tool is cleaned 30 seconds in high purity water; Then by vacuum preparation tool (PyroMark Vacuum Prep Filter Probes; Qiagen; #979010) move on in PCR plate, capture sepharose 4B (completing this at magnetic bead in PCR primer was in conjunction with latter three minutes to operate); Pick up PCR plate, check whether that most of magnetic bead has all been attracted on vacuum preparation tool; Vacuum preparation tool is put into 70% ethanol 5 seconds; Then 5 seconds are moved on in denaturation buffer; Move on to again in lavation buffer solution and clean 5-10 second; Turn off pump; Vacuum preparation tool is put into the plate containing sequencing primer, shake, release sepharose 4B (sequencing primer also can finally add); Use high purity water cleaning vacuum preparation tool; The PSQ96 plate being placed with sample is put be heated on hot plate 80 DEG C 2 minutes, then cool to room temperature, can carry out Manganic pyrophosphate complex initiation reaction;
D. Manganic pyrophosphate complex initiation: on PyroMark Q24 Manganic pyrophosphate complex initiation instrument, adopts Pyromark Gold Q24 test kit (Pyromark Gold Q24 Reagents; Qiagen; #978802) sample in the PSQ96 plate in step C is checked order, then apply PyroMark CpG software and methylation analysis (methylation level detected result example is shown in Fig. 2) is carried out to result.
4, data analysis
This research adopts SPSS 16.0 pairs of data to carry out finishing analysis.We find: have in 5 detected CpG sites to exist between 4 sites (CpG1, CpG2, CpG4 and CpG5) dependency (
r> 0.6, and
p< 0.001, is shown in Fig. 1), therefore we use
dRD3the methylation in each CpG site, has done comparing between sex with hypotype respectively.
Result (see table 1, table 2) finds: in a point hypotype compares with the methylation level between sex and CpG site thereof, CpG2, CpG3 exist with prepattern and paranoid schizophrenia and associate in the male sex (
p< 0.05, but in the male sex, intolerance style and prepattern difference are not remarkable, cannot distinguish further); And CpG2 exist with prepattern schizophreniac in women and associate (
p=0.004 < 0.05), CpG3 also exists with prepattern schizophrenia and associates in women (
p=0.040 < 0.05), and CpG5 exist with paranoid schizophrenia in women association (
p=0.024 < 0.05).
The methylation status in CpG site in table 1 male sex hypotype
Grouping | Prepattern | Intolerance style | Control group | p1(prepattern and control group) | p2(intolerance style and control group) | p3(intolerance style and prepattern) |
CpG1 methylation (%) | 15.27±3.61 | 16.31±4.11 | 10.33±10.89 | 0.223 | 0.083 | 0.523 |
CpG2 methylation (%) | 15.81±3.60 | 16.23±3.96 | 5.09±4.09 | 2.29×10 -6 | 8.44×10 -7 | 0.794 |
CpG3 methylation (%) | 14.18±4.05 | 15.46±3.93 | 5.91±5.92 | < 0.01 | 1.03×10 -4 | 0.441 |
CpG4 methylation (%) | 8.91±2.59 | 8.46±2.85 | 10.33±9.35 | 0.668 | 0.575 | 0.693 |
CpG5 methylation (%) | 5.73±1.62 | 6.62±2.18 | 10.46±9.68 | 0.723 | 0.698 | 0.277 |
CpG site methylation status in each hypotype of table 2 women
Grouping | Prepattern (14) | Intolerance style (15) | Control group (15) | p1(prepattern and control group) | p2(intolerance style and control group) |
CpG1 methylation (%) | 14.23±4.38 | 16.36±6.59 | 15.67±3.46 | 0.341 | 0.754 |
CpG2 methylation (%) | 12.85±4.04 | 18.09±6.17 | 17.07±3.13 | 0.004 | 0.622 |
CpG3 methylation (%) | 13.00±4.02 | 16.18±4.17 | 16.40±4.26 | 0.040 | 0.897 |
CpG4 methylation (%) | 8.31±3.84 | 11.73±4.29 | 10.00±2.78 | 0.189 | 0.224 |
CpG5 methylation (%) | 7.54±3.45 | 9.82±4.38 | 6.14±2.21 | 0.220 | 0.024 |
Compare with other technologies, this test kit of the present invention's design can be from
dRD3in the index of gene each site methylation, accurately carry out schizoid screening to sample to be measured, the general meter adopted of comparing, has more cogency on qualitative.Meanwhile, by measuring the strength of association comparing patient's each CpG site methylation level and normal value, auxiliary judgment schizophrenia and somatotype thereof can whether be suffered from.More effectively, easily detection of dynamic is carried out to patient, have accurately and reliably, flexibly fast and the advantage of economy.
Above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned citing.Those skilled in the art are in essential scope of the present invention, and the change made, remodeling, interpolation or replacement, also should belong to protection scope of the present invention, protection scope of the present invention is as the criterion with claims.
Claims (1)
1. one kind can be used for the test kit detecting the DRD3 gene methylation degree relevant to schizophrenia, it is characterized in that: this test kit comprises a pair DRD3 gene promoter zone methylation specificity amplification primer and methylation-specific sequencing primer, the nucleotide sequence of wherein said methylation-specific amplification upstream primer is as shown in SEQ ID NO.1:
5’-AGGGAGTTAAGAGTTTAGATATAAGG-3’;
The nucleotide sequence of described methylation-specific amplification downstream primer is as shown in SEQ ID NO.2:
5’-GTTTAGGGTTTGTAGGG-3’;
Described methylation-specific sequencing primer is as shown in SEQ ID NO.3:
5’-Biotin-ACCCAAAACCACCTCTAAACAT-3’。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310319417.XA CN103602722B (en) | 2013-07-25 | 2013-07-25 | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310319417.XA CN103602722B (en) | 2013-07-25 | 2013-07-25 | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103602722A CN103602722A (en) | 2014-02-26 |
CN103602722B true CN103602722B (en) | 2015-08-05 |
Family
ID=50120986
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310319417.XA Expired - Fee Related CN103602722B (en) | 2013-07-25 | 2013-07-25 | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103602722B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104561346B (en) * | 2015-01-23 | 2017-04-26 | 西安交通大学 | primer and kit for detecting SCZ related gene polymorphism |
CN108715894A (en) * | 2018-06-12 | 2018-10-30 | 宁波大学 | A kind of detection kit and detection method including schizophrenia split gene |
CN112877419A (en) * | 2021-01-20 | 2021-06-01 | 武汉大学 | DNA methylation marker for predicting schizophrenia occurrence risk, screening method and application |
CN113667734B (en) * | 2021-07-16 | 2022-05-24 | 四川大学华西医院 | Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1344155A (en) * | 1999-01-27 | 2002-04-10 | 概念股份公司 | Transnasal transport/immunisation with highly adaptable carriers |
-
2013
- 2013-07-25 CN CN201310319417.XA patent/CN103602722B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1344155A (en) * | 1999-01-27 | 2002-04-10 | 概念股份公司 | Transnasal transport/immunisation with highly adaptable carriers |
Non-Patent Citations (2)
Title |
---|
CpG Demethylation Enhances Alpha-Synuclein Expression and Affects the Pathogenesis of Parkinson’s Disease;Lumine Matsumoto等;《PLoS ONE》;20101130;第5卷(第11期);正文第1页右栏倒数第1-2行 * |
Epigenetic mechanisms in neurological diseases: genes, syndromes, and therapies;Rocio G Urdinguio等;《Lancet Neurol》;20091130;第8卷;第1056-1072页 * |
Also Published As
Publication number | Publication date |
---|---|
CN103602722A (en) | 2014-02-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2017124854A1 (en) | Primers, probe and kit for detecting ndrg4 gene methylation for early diagnosis of intestinal cancer | |
CN103103256B (en) | Can be used for the test kit and the application thereof that detect the DRD4 gene promoter zone methylation degree relevant to schizophrenia | |
CN103602722B (en) | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia | |
Afrin et al. | Targeted next-generation sequencing for detecting MLL gene fusions in leukemia | |
CN101979666B (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting herpes simplex viruses 2 | |
CN104232781A (en) | TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles | |
CN104328200B (en) | The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
CN103911456B (en) | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
CN108642180A (en) | Detect the method and kit of SDC2 gene methylations | |
CN107447042B (en) | Molecular marker for diagnosing active tuberculosis diseases and application thereof | |
CN106148484B (en) | A kind of kit that diagnosis Y chromosome is micro-deleted | |
CN106048021B (en) | Primer for detecting P53 gene mutation in microcomponent combines and its application | |
CN104328201B (en) | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
CN103160582B (en) | Kit for detecting methylation degree for GCK (glucokinase) gene associated with type 2 diabetes and application thereof | |
CN103122378B (en) | Kit capable of being used for detecting methylation degree of alpha-adduction protein gene promoter region related to primary hypertension and application thereof | |
JP6164683B2 (en) | Method for analyzing deletion site of spermatogenesis region on Y chromosome and Y chromosome | |
CN103305604B (en) | Kit for detecting CDKN2B gene promoter region methylation degree related to coronary disease and application thereof | |
CN106544428A (en) | Primer and its application needed for detection BDNF gene promoter zone methylation degree | |
CN104561258B (en) | A kind of detection kit for straight colon cancer early diagnosis and application thereof | |
WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
CN105950723A (en) | Noninvasive methylation quantitative detection kit used for early diagnosis on colorectal cancer | |
CN106011253B (en) | Primer for detecting PDGFRA gene mutation in microcomponent combines and its application | |
CN104726589A (en) | Kit for detecting methylation degree of colorectal cancer related CMTM3 (CKLF-like MARVEL transmembrane domain containing family member 3) gene promoter region and application of kit | |
CN103966340B (en) | A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof | |
CN103014165A (en) | Kit capable of being used for detecting methylation degree of PLA2G7 gene promoter region relevant to coronary heart disease and application of kit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150805 Termination date: 20180725 |