CN103602722A - Kit for detecting methylation degree of DRD3 gene related with schizophrenia and applications thereof - Google Patents
Kit for detecting methylation degree of DRD3 gene related with schizophrenia and applications thereof Download PDFInfo
- Publication number
- CN103602722A CN103602722A CN201310319417.XA CN201310319417A CN103602722A CN 103602722 A CN103602722 A CN 103602722A CN 201310319417 A CN201310319417 A CN 201310319417A CN 103602722 A CN103602722 A CN 103602722A
- Authority
- CN
- China
- Prior art keywords
- methylation
- schizophrenia
- drd3
- test kit
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Abstract
The invention discloses a kit for detecting methylation degree of a DRD3 gene related with schizophrenia and applications thereof. The kit is characterized by comprising a pair of DRD3 gene promoter region methylation specificity amplification primers and a methylation specificity sequencing primer, wherein the upstream primer has a nucleotide sequence represented by the SEQ ID No.1, the downstream primer has a nucleotide sequence represented by the SEQ ID No.2, and the methylation specificity sequencing primer is represented by the SEQ ID No.3. The kit has the advantages that the kit can achieve a convenient and rapid detection on schizophrenia and subtypes thereof in a molecular level and has a high detection efficiency and strong specificity. The drugs which take the methylation of DRD3 gene promoter region as the target are advantageously used as a novel way for assistant diagnosis, detection, and screening of schizophrenia.
Description
Technical field
The present invention relates to the schizoid detection kit of a kind of personalized auxiliary diagnosis, especially relate to a kind of can be used for detecting relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof.Background technology
Schizophrenia (Schizophrenia) is one of great mental disease, and it can cause the collapse of form of thinking and emotional reactions, the obstacle such as concrete manifestation is felt, consciousness, thinking, emotion and act of will.Schizophrenia is the disease that a kind of inherited genetic factors and the acting in conjunction of Environmental Psychology factor cause.It is reported, Chinese current schizophreniac's quantity is up to 1,300 ten thousand.In every 100 people of the whole of China, just there is a schizophreniac.Current, although neuroscience field is mainly devoted in psychiatry research, do not find out so far rational pathogenesis.Therefore the schizophrenia research of, carrying out feasibility has very large prospect.
Dopamine Receptors D3(
dRD3) be distributed in limbic midbrain area's nucleus accumbens septi and Calleja island, be a kind of G protein coupling receptor by genes encoding, and
dRD3gene is positioned at long-armed 13 district's 3 bands of No. 3 karyomit(e) of 3q13.3().Current research both domestic and external verified " schizoid clinical symptom is because central dopamine hyperaction causes ".And there is research background to show: methylating of gene is not change in DNA sequence dna situation, affecting genetic expression.Between gene methylation and schizophrenia, whether exist dependency to need further to be verified.At present, also not disclose both at home and abroad any relevant to schizophrenia about detection
dRD3the correlative study report of the test kit of gene methylation degree.
Summary of the invention
Technical problem to be solved by this invention be to provide a kind of can be used for detecting relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof, the significance of difference that this test kit is order by each CpG is analyzed, and can on molecular level, realize quickly and easily the detection to schizophrenia and schizophrenia hypotype, and detection efficiency is high, with strong points.
The present invention solves the problems of the technologies described above adopted technical scheme: can be used for detecting relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof, this test kit comprises a pair of
dRD3gene methylation specificity amplification primer and methylation-specific sequencing primer, wherein
The nucleotide sequence of described methylation-specific amplification upstream primer is as shown in SEQ ID NO.1:
5’-?AGGGAGTTAAGAGTTTAGATATAAGG?-3’（SEQ?ID?NO.1）；
The nucleotide sequence of described methylation-specific amplification downstream primer is as shown in SEQ ID NO.1:
5’-?GTTTAGGGTTTGTAGGG?-3’（SEQ?ID?NO.2）；
Described methylation-specific sequencing primer is as shown in SEQ ID NO.3:
5’-Biotin-?ACCCAAAACCACCTCTAAACAT?-3’（SEQ?ID?NO.3）。
A kind of can be used for detecting relevant to schizophrenia
dRD3the application of the test kit of gene methylation degree, in periphery blood examination is surveyed, by this test kit, detect 2 methylations of DRD3 gene CpG and the normal group that obtain and there is significant difference, judge that the male sex suffers from prepattern and paranoid schizophrenia, women suffers from prepattern schizophrenia; By this test kit, detect 3 methylations of DRD3 gene CpG and the normal group that obtain and have significant difference, judge that the male sex suffers from prepattern and paranoid schizophrenia, women suffers from prepattern schizophrenia; By this test kit, detect 5 methylations of DRD3 gene CpG and the normal group that obtain and there is significant difference, judge that women's group suffers from paranoid schizophrenia.
Compared with prior art, the invention has the advantages that: the present invention disclose first can be used for detecting relevant to schizophrenia
dRD3the test kit of gene methylation degree and application thereof,
dRD3the hyper-methylation level of gene causes
dRD3the low expression of gene, thereby impact
dRD3internal circulating load in the transhipment of brain path reduces, and finally causes schizoid generation and development.Therefore
dRD3gene methylation level is negative correlation at brain and prevalence of schizophrenia.To detect peripheral blood
dRD3gene promoter zone methylation level is basic diagnostic kit, can on molecular level, realize quickly and easily the detection to schizophrenia and schizophrenia hypotype, and detection efficiency is high, with strong points.This test kit can be used in auxiliary diagnosis, detection or the examination medicine of each crowd's schizophrenia hypotype of men and women, and application prospect is extensive.
Accompanying drawing explanation
Fig. 1 is
dRD3the association analysis result that the detected sequence region of gene and 5 CpG that detect are ordered; (for example CpG1 and CpG2 dependency are that 0.862, CpG3 and CpG4 dependency are 0.193)
Fig. 2 is methylation level detected result example: represent methylation, CpG1 is respectively 13%, 18% to the methylation of CpG5 as shown, 13%, 8%, 8%.
Embodiment
Below in conjunction with accompanying drawing, embodiment is described in further detail the present invention.
Specific embodiment
1, the collection of research object
Schizophreniac collects in Cong Mou hospital, 354 examples altogether, collect 300 normal persons as a control group simultaneously, analysis through age (finally the age of selected sample is all about thirty years old), sex, knowledge background and these data of DNA related concentrations, filter out the match index (age, educational background, sex) higher experiment sample amount: 30 schizophreniacs (15 male sex+15 women), 30 Normal groups (15 male sex+15 women).
2, the extraction of genomic dna
Application Lab-Aid 820 Full automatic instrument for extracting nucleic acids (Chinese Xiamen Zeesan Biotech Co., Ltd., 500ul system) extract the Whole Blood Genomic DNA of sample, then by nucleic acid-protein determinator, detect the concentration of gained DNA, for
dRD3the detection of gene promoter area DNA methylation level.
3, DNA methylation level determination
This research adopts bisulfite tetra-sodium sequencing technologies pair
dRD3dNA methylation level detection has been carried out in 5 CpG sites (as Fig. 1) of gene promoter area.The ultimate principle of this technology: process after DNA sample with the bisulfite in test kit, using polymerase chain reaction (PCR) amplification again, can make to occur methylated cytosine(Cyt) (C) base remains unchanged, and make not occur methylated C, be transformed into uridylic (U), then by sequencing primer, carry out PCR order-checking, thereby obtain which site, occurred to methylate.This research adopts PyroMark Assay Design software to carry out design of primers, as follows for pcr amplification primer and the sequencing primer of testing:
(1) methylation-specific upstream primer (Forward primer)
5’-?AGGGAGTTAAGAGTTTAGATATAAGG?-3’（SEQ?ID?NO.1），
(2) methylation-specific downstream primer (Reverse primer)
5’-?GTTTAGGGTTTGTAGGG?-3’（SEQ?ID?NO.2）；
(3) methylation-specific sequencing primer (Sequencing primer)
5’-Biotin-?ACCCAAAACCACCTCTAAACAT?-3’?（SEQ?ID?NO.3）。
The concrete steps of above-mentioned amplification are:
A. adopt QIAGEN EpiTect bisulf iotate-treated test kit (EpiTech Bisulfite Kits; Qiagen; #59104) sample DNA is carried out to hydrosulphite conversion;
B. get the DNA sample 20ng transforming in steps A and join Pyromark PCR test kit (Pyromark PCR Kit; Qiagen; #978703), and add above-mentioned a pair of
dRD3gene promoter zone methylation specificity amplification primer, carries out pcr amplification, amplification condition: the first sex change of 95 ℃ of 15min; Follow 95 ℃ of 15s, Tm 30s, 72 ℃ of 20s, the annealing reaction of totally 50 circulations; Then 72 ℃ of 5min(of extension note: Tm determines according to running PCR gradient temperature in experiment);
C. the early-stage preparations of tetra-sodium order-checking: annealing buffer (the PyroMark Annealing Buffer that adds in advance 45 μ l to contain the above-mentioned methylation-specific sequencing primer of 0.3 μ M in PSQ96 plate; Qiagen; #979009); The sepharose 4B total amount mixing (every sample 3 μ l) that needs are used is transferred in an Eppendorf pipe; In sepharose 4B, add binding buffer liquid (PyroMark Binding Buffer; Qiagen; #979006), make average each sample approximately have the volume of 50 μ l, mixture is mixed; Above mixture is added in PCR product (50 μ l reaction volume) to every sample 50 μ l; PCR product is mixed to 10 minutes at normal temperatures, magnetic bead is combined with vitamin H; In vacuum preparation work station, in four sample panel, add successively high purity water, 70% ethanol, lavation buffer solution (the PyroMark Wash Buffer of 180ml; Qiagen; #979008) and sex change damping fluid (the PyroMark Denaturation Solution of 120ml; Qiagen; #979007); Open the pump at vacuum preparation work station, vacuum preparation tool is cleaned 30 seconds in high purity water; Then by vacuum preparation tool (PyroMark Vacuum Prep Filter Probes; Qiagen; #979010) move on in PCR plate, capture sepharose 4B (be combined with PCR product at magnetic bead latter three minutes in complete this operate); Pick up PCR plate, check whether most of magnetic bead has all been attracted on vacuum preparation tool; Vacuum preparation tool is put into 70% ethanol 5 seconds; Then move on in sex change damping fluid 5 seconds; Move on to again in lavation buffer solution and clean 5-10 second; Turn off pump; Vacuum preparation tool is put into the plate that contains sequencing primer, shaken, discharge sepharose 4B (sequencing primer also can finally add); Use high purity water to clean vacuum preparation tool; By the PSQ96 plate that is placed with sample be placed on hot-plate, be heated to 80 ℃ 2 minutes, then cool to room temperature, can carry out tetra-sodium sequencing reaction;
D. tetra-sodium order-checking: on PyroMark Q24 tetra-sodium sequenator, adopt Pyromark Gold Q24 test kit (Pyromark Gold Q24 Reagents; Qiagen; #978802) sample in the PSQ96 plate in step C is checked order, then apply PyroMark CpG software result is carried out to methylation analysis (methylation level detected result example is shown in Fig. 2).
4, data analysis
This research adopts 16.0 pairs of data of SPSS to carry out finishing analysis.We find: in 5 detected CpG sites, have between 4 sites (CpG1, CpG2, CpG4 and CpG5), exist dependency (
r> 0.6, and
p< 0.001, sees Fig. 1), so we use
dRD3the methylation in each CpG site, has done respectively the comparison between sex and hypotype.
Result (in Table 1, table 2) is found: the methylation level between minute hypotype and sex and CpG site thereof relatively in, CpG2, CpG3 in the male sex with prepattern and paranoid schizophrenia all exist associated (
p< 0.05, but in the male sex intolerance style and prepattern difference not remarkable, cannot further distinguish); And CpG2 in women with prepattern schizophreniac exist associated (
p=0.004 < 0.05), CpG3 in women with prepattern schizophrenia also exist associated (
p=0.040 < 0.05), and CpG5 in women with paranoid schizophrenia exist associated (
p=0.024 < 0.05).
The situation that methylates in CpG site in table 1 male sex hypotype
| Grouping | Prepattern | Intolerance style | Control group | p1(prepattern and control group) | p2(intolerance style and control group) | p3(intolerance style and prepattern) |
| CpG1 methylation (%) | 15.27±3.61 | 16.31±4.11 | 10.33±10.89 | 0.223 | 0.083 | 0.523 |
| CpG2 methylation (%) | 15.81±3.60 | 16.23±3.96 | 5.09±4.09 | 2.29×10 -6 | 8.44×10 -7 | 0.794 |
| CpG3 methylation (%) | 14.18±4.05 | 15.46±3.93 | 5.91±5.92 | < 0.01 | 1.03×10 -4 | 0.441 |
| CpG4 methylation (%) | 8.91±2.59 | 8.46±2.85 | 10.33±9.35 | 0.668 | 0.575 | 0.693 |
| CpG5 methylation (%) | 5.73±1.62 | 6.62±2.18 | 10.46±9.68 | 0.723 | 0.698 | 0.277 |
The CpG site situation that methylates in each hypotype of table 2 women
| Grouping | Prepattern (14) | Intolerance style (15) | Control group (15) | p1(prepattern and control group) | p2(intolerance style and control group) |
| CpG1 methylation (%) | 14.23±4.38 | 16.36±6.59 | 15.67±3.46 | 0.341 | 0.754 |
| CpG2 methylation (%) | 12.85±4.04 | 18.09±6.17 | 17.07±3.13 | 0.004 | 0.622 |
| CpG3 methylation (%) | 13.00±4.02 | 16.18±4.17 | 16.40±4.26 | 0.040 | 0.897 |
| CpG4 methylation (%) | 8.31±3.84 | 11.73±4.29 | 10.00±2.78 | 0.189 | 0.224 |
| CpG5 methylation (%) | 7.54±3.45 | 9.82±4.38 | 6.14±2.21 | 0.220 | 0.024 |
Compare with other technologies, this test kit of the present invention design can be from
dRD3in the index of each site methylation of gene, accurately sample to be measured is carried out to schizoid screening, the general meter adopting of comparing has more cogency on qualitative.Meanwhile, by mensuration, compare the strength of association of each CpG site methylation level of patient and normal value, can auxiliary judgment whether suffer from schizophrenia and somatotype thereof.More effectively, easily patient is carried out to detection of dynamic, have advantages of accurately and reliably, flexibly fast and economy.
Above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned giving an example.Those skilled in the art are in essential scope of the present invention, and the variation of making, remodeling, interpolation or replacement, also should belong to protection scope of the present invention, and protection scope of the present invention is as the criterion with claims.
Claims (2)
1. one kind can be used for detecting relevant to schizophrenia
dRD3the test kit of gene methylation degree, is characterized in that: this test kit comprises a pair of
dRD3gene promoter zone methylation specificity amplification primer and methylation-specific sequencing primer, the nucleotide sequence of wherein said methylation-specific amplification upstream primer is as shown in SEQ ID NO.1:
5’-?AGGGAGTTAAGAGTTTAGATATAAGG?-3’；
The nucleotide sequence of described methylation-specific amplification downstream primer is as shown in SEQ ID NO.1:
5’-?GTTTAGGGTTTGTAGGG?-3’?；
Described methylation-specific sequencing primer is as shown in SEQ ID NO.3:
5’-Biotin-?ACCCAAAACCACCTCTAAACAT?-3’?。
One kind as claimed in claim 1 can be used for detecting relevant to schizophrenia
dRD3the application of the test kit of gene methylation degree, it is characterized in that: in periphery blood examination is surveyed, by this test kit, detect 2 methylations of DRD3 gene CpG and the normal group that obtain and there is significant difference, judge that the male sex suffers from prepattern and paranoid schizophrenia, women suffers from prepattern schizophrenia; By this test kit, detect 3 methylations of DRD3 gene CpG and the normal group that obtain and have significant difference, judge that the male sex suffers from prepattern and paranoid schizophrenia, women suffers from prepattern schizophrenia; By this test kit, detect 5 methylations of DRD3 gene CpG and the normal group that obtain and there is significant difference, judge that women's group suffers from paranoid schizophrenia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310319417.XA CN103602722B (en) | 2013-07-25 | 2013-07-25 | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310319417.XA CN103602722B (en) | 2013-07-25 | 2013-07-25 | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103602722A true CN103602722A (en) | 2014-02-26 |
| CN103602722B CN103602722B (en) | 2015-08-05 |
Family
ID=50120986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310319417.XA Expired - Fee Related CN103602722B (en) | 2013-07-25 | 2013-07-25 | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103602722B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561346A (en) * | 2015-01-23 | 2015-04-29 | 西安交通大学 | Primer and kit for detecting SCZ related gene polymorphism |
| CN108715894A (en) * | 2018-06-12 | 2018-10-30 | 宁波大学 | A kind of detection kit and detection method including schizophrenia split gene |
| CN112877419A (en) * | 2021-01-20 | 2021-06-01 | 武汉大学 | DNA methylation marker for predicting schizophrenia occurrence risk, screening method and application |
| CN113667734A (en) * | 2021-07-16 | 2021-11-19 | 四川大学华西医院 | Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1344155A (en) * | 1999-01-27 | 2002-04-10 | 概念股份公司 | Transnasal transport/immunisation with highly adaptable carriers |
-
2013
- 2013-07-25 CN CN201310319417.XA patent/CN103602722B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1344155A (en) * | 1999-01-27 | 2002-04-10 | 概念股份公司 | Transnasal transport/immunisation with highly adaptable carriers |
Non-Patent Citations (2)
| Title |
|---|
| LUMINE MATSUMOTO等: "CpG Demethylation Enhances Alpha-Synuclein Expression and Affects the Pathogenesis of Parkinson’s Disease", 《PLOS ONE》 * |
| ROCIO G URDINGUIO等: "Epigenetic mechanisms in neurological diseases: genes, syndromes, and therapies", 《LANCET NEUROL》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561346A (en) * | 2015-01-23 | 2015-04-29 | 西安交通大学 | Primer and kit for detecting SCZ related gene polymorphism |
| CN108715894A (en) * | 2018-06-12 | 2018-10-30 | 宁波大学 | A kind of detection kit and detection method including schizophrenia split gene |
| CN112877419A (en) * | 2021-01-20 | 2021-06-01 | 武汉大学 | DNA methylation marker for predicting schizophrenia occurrence risk, screening method and application |
| CN113667734A (en) * | 2021-07-16 | 2021-11-19 | 四川大学华西医院 | Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103602722B (en) | 2015-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103103256B (en) | Can be used for the test kit and the application thereof that detect the DRD4 gene promoter zone methylation degree relevant to schizophrenia | |
| WO2021073490A1 (en) | Method for detecting mutation and methylation of tumor specific gene in ctdna | |
| CN101845520B (en) | HPA allelic gene typing detection reagent kit | |
| Liu et al. | Pediatric acute lymphoblastic leukemia patients exhibit distinctive alterations in the gut microbiota | |
| WO2020020072A1 (en) | Methylation modification-based tumor marker stamp-ep2 | |
| WO2023071889A1 (en) | Methylation biomarker related to detection of gastric cancer lymph node metastasis, or combination thereof and use thereof | |
| CN103602722B (en) | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia | |
| CN106048021B (en) | Primer for detecting P53 gene mutation in microcomponent combines and its application | |
| CN103911456A (en) | Detection kit for helping diagnose Alzheimer disease and detection method thereof | |
| CN108018353A (en) | A kind of colorectal cancer early screening primer sets and kit based on 4 genes | |
| CN104328200B (en) | The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| Fang et al. | Identification of differentially expressed lncRNAs as potential plasma biomarkers for active tuberculosis | |
| CN107447042B (en) | Molecular marker for diagnosing active tuberculosis diseases and application thereof | |
| CN106086169B (en) | Primer for detecting EGFR genetic mutation in microcomponent combines and its application | |
| WO2023226939A1 (en) | Methylation biomarker for detecting colorectal cancer lymph node metastasis and use thereof | |
| CN104328201B (en) | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| CN105925691B (en) | A kind of quick detection people No. 13, No. 18, No. 21, the kit of X and Y chromosome number | |
| CN103122378B (en) | Kit capable of being used for detecting methylation degree of alpha-adduction protein gene promoter region related to primary hypertension and application thereof | |
| CN103014165B (en) | Kit capable of being used for detecting methylation degree of PLA2G7 gene promoter region relevant to coronary heart disease and application of kit | |
| CN106011253B (en) | Primer for detecting PDGFRA gene mutation in microcomponent combines and its application | |
| WO2017084027A1 (en) | Kit for prognostic stratification of acute myelocytic leukemia and testing method therefor | |
| CN104561258B (en) | A kind of detection kit for straight colon cancer early diagnosis and application thereof | |
| CN105969875B (en) | Primer for detecting PIK3CA gene mutation in microcomponent combines and its application | |
| CN104726589A (en) | Kit for detecting methylation degree of colorectal cancer related CMTM3 (CKLF-like MARVEL transmembrane domain containing family member 3) gene promoter region and application of kit | |
| CN103305604A (en) | Kit for detecting CDKN2B gene promoter region methylation degree related to coronary disease and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150805 Termination date: 20180725 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |