CN104328200B - The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof - Google Patents
The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof Download PDFInfo
- Publication number
- CN104328200B CN104328200B CN201410657145.9A CN201410657145A CN104328200B CN 104328200 B CN104328200 B CN 104328200B CN 201410657145 A CN201410657145 A CN 201410657145A CN 104328200 B CN104328200 B CN 104328200B
- Authority
- CN
- China
- Prior art keywords
- methylation
- primer
- disease
- alzheimer
- coupled receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the detection kit of auxiliary diagnosis alzheimer's disease, described detection kit comprises a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer, and a pair described g protein coupled receptor gene promoter zone methylation specificity amplification primer comprises methylation-specific upstream primer and methylation-specific downstream primer; It is by detecting the relevant g protein coupled receptor gene promoter zone methylation degree auxiliary diagnosis alzheimer's disease of Ahl tribulus sea silent sickness, simply, conveniently, detection efficiency is high, with strong points, have accurately and reliably, flexibly fast and the advantage of economy, be conducive to early discovery and the treatment in time of alzheimer's disease.
Description
Technical field
The present invention relates to the aided diagnosis technique field of alzheimer's disease, in particular to a kind of detection kit and detection method thereof of auxiliary diagnosis alzheimer's disease, especially a kind ofly the detection kit and the detection method thereof that detect the g protein coupled receptor 50 gene promoter zone methylation degree that Ahl tribulus sea silent sickness is correlated with can be used for.
Background technology
Alzheimer's disease (Alzheimerdisease, AD) is a kind of systemic nerve degenerative diseases, and its clinical manifestation is higher cognitive hypofunction, and principal character comprises neurofibrillary tangles and extracellular senile plaque in brain cell.Patients with Alzheimer disease needs nursing throughout one's life, brings great economical load therefore to society and family.Alzheimer's disease is a kind of Complex Diseases caused by inherited genetic factors and environmental factors acting in conjunction, and the genetic mechanism found Alzheimer disease related genes and then illustrate dementia morbidity has become the focus of at present research.Although have increasing medical research institute to pay attention to and carry out the etiological study of alzheimer's disease, and research focuses mostly in the cognation of the single nucleotide polymorphism Ahl tribulus sea silent sickness of correlation candidate gene, but its pathogeny is not explained clear yet completely, and this hampers the raising of alzheimer's disease Prevention and Curation level undoubtedly.
G protein coupled receptor 50 (Gprotein-coupledreceptor50) is the member of g protein coupled receptor family, and GPR50 and bipolar affective disorder, major depressive disorder and schizophrenia exist relation.G protein coupled receptor 50 is encoded by the g protein coupled receptor 50 gene (Gprotein-coupledreceptor50gene, GPR50) (ChromosomeX:151176584..151181465) being positioned at X chromosome.Existing large quantity research reports the relation of GPR50 genetic expression Ahl tribulus sea silent sickness morbidity both at home and abroad.
At present, any detection kit correlative study report about for detecting the g protein coupled receptor gene promoter zone methylation degree that Ahl tribulus sea silent sickness is correlated with also is not disclosed both at home and abroad.
Summary of the invention
Technical problem to be solved by this invention is the present situation for prior art, provides the detection kit of easy to detect, with strong points, that Detection accuracy is high auxiliary diagnosis alzheimer's disease; By measuring auxiliary diagnosis alzheimer's disease to sample DNA methylation level, detection method is simple, detection efficiency is high.
The present invention solves the problems of the technologies described above adopted technical scheme:
The detection kit of auxiliary diagnosis alzheimer's disease, described detection kit comprises a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer, and a pair described g protein coupled receptor gene promoter zone methylation specificity amplification primer comprises methylation-specific upstream primer and methylation-specific downstream primer:
Described methylation-specific upstream primer comprises following nucleotide sequence:
5’-GGGGATTTAGAGAGGTTGTAAAG-3’；
Described methylation-specific downstream primer comprises following nucleotide sequence:
5’-Biotin-CCAACCTATAAACCCAACTAACTACTCTAC-3’；
Described methylation-specific sequencing primer comprises following nucleotide sequence:
5’-GGGATTTTTTTAGTTGTTAGTTAT-3’。
The detection method of the detection kit of auxiliary diagnosis alzheimer's disease: comprise the following steps:
Step one: the Whole Blood Genomic DNA extracting sample, and detect the concentration of gained DNA;
Step 2: adopt methylating reagent box to carry out bisulfite conversion to sample DNA;
Step 3: get DNA sample 20ng transformed in step 2 and join ZymoTaq
tMpreMix enzyme, and add a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer, carry out pcr amplification;
Step 4: the early-stage preparations of Manganic pyrophosphate complex initiation: add the annealing buffer that 45 μ l contain 0.3 μM of methylation-specific sequencing primer in PSQ96 plate in advance, to the sepharose 4B of the mixing used be needed to transfer in an Eppendorf tube, in sepharose 4B, add the mixing of binding buffer liquid; Above mixed solution is added in pcr amplification product, PCR primer is mixed 10 minutes at normal temperatures, magnetic bead is combined with vitamin H; In vacuum preparation work station, in four sample panel, add the denaturation buffer of the high purity water of 180ml, 70% ethanol, lavation buffer solution and 120ml successively; Open the pump at vacuum preparation work station, vacuum preparation tool is cleaned 30 seconds in high purity water; Then vacuum preparation tool is moved on in PCR plate, capture sepharose 4B; Pick up PCR plate, check whether that most of magnetic bead has all been attracted on vacuum preparation tool; Vacuum preparation tool is put into 70% ethanol 5 seconds; Then 5 seconds are moved on in denaturation buffer; Move on to again in lavation buffer solution and clean 5 to 10 seconds; Turn off pump; Vacuum preparation tool is put into the plate containing methylation-specific sequencing primer, shake, release sepharose 4B; Use high purity water cleaning vacuum preparation tool; The PSQ96 plate being placed with sample is put be heated on hot plate 80 DEG C 2 minutes, then cool to room temperature;
Step 5: Manganic pyrophosphate complex initiation: on Manganic pyrophosphate complex initiation instrument, adopts PyromarkGoldQ24 test kit to check order to the sample in the PSQ96 plate in step 4, then applies PyroMarkCpG software and carries out methylation analysis to result.
Adopt Lab-Aid820 Full automatic instrument for extracting nucleic acid to extract Whole Blood Genomic DNA in above-mentioned step one, then detect the concentration of DNA by NanoDrop2000 ultramicrospectrophotometer.
EZDNA methylating reagent box is adopted in above-mentioned step 2.
In above-mentioned step 3, pcr amplification condition is: the first sex change of 95 DEG C of 10min; Then 95 DEG C of 30s, Tm40s, 72 DEG C of 50s, the annealing reaction of totally 35 circulations; Then extension 72 DEG C of 7min.
In above-mentioned step 5, Manganic pyrophosphate complex initiation instrument adopts PyroMarkQ24 Manganic pyrophosphate complex initiation.
The detection kit of auxiliary diagnosis alzheimer's disease of the present invention and detection method thereof, described detection kit comprises a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer, and a pair described g protein coupled receptor gene promoter zone methylation specificity amplification primer comprises methylation-specific upstream primer and methylation-specific downstream primer; Its advantage is: by detecting the relevant g protein coupled receptor gene promoter zone methylation degree auxiliary diagnosis alzheimer's disease of Ahl tribulus sea silent sickness, simply, conveniently, detection efficiency is high, with strong points, have accurately and reliably, flexibly fast and the advantage of economy, be conducive to early discovery and the treatment in time of alzheimer's disease.
Accompanying drawing explanation
Fig. 1 is the dependency diagram in detected sequence region and 7 CpG sites;
Fig. 2 is DNA methylation level detection result schematic diagram.
Embodiment
Below in conjunction with accompanying drawing embodiment, the present invention is described in further detail.
The detection kit of auxiliary diagnosis alzheimer's disease, described detection kit comprises a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer, and a pair described g protein coupled receptor gene promoter zone methylation specificity amplification primer comprises methylation-specific upstream primer and methylation-specific downstream primer:
Described methylation-specific upstream primer comprises following nucleotide sequence:
5’-GGGGATTTAGAGAGGTTGTAAAG-3’；
Described methylation-specific downstream primer comprises following nucleotide sequence:
5’-Biotin-CCAACCTATAAACCCAACTAACTACTCTAC-3’；
Described methylation-specific sequencing primer comprises following nucleotide sequence:
5’-GGGATTTTTTTAGTTGTTAGTTAT-3’。
The detection method of the detection kit of auxiliary diagnosis alzheimer's disease: comprise the following steps:
Step one: the Whole Blood Genomic DNA extracting sample, and detect the concentration of gained DNA;
Step 2: adopt methylating reagent box to carry out bisulfite conversion to sample DNA;
Step 3: get DNA sample 20ng transformed in step 2 and join ZymoTaq
tMpreMix enzyme, and add a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer, carry out pcr amplification;
Step 4: the early-stage preparations of Manganic pyrophosphate complex initiation: add the annealing buffer that 45 μ l contain 0.3 μM of methylation-specific sequencing primer in PSQ96 plate in advance, to the sepharose 4B of the mixing used be needed to transfer in an Eppendorf tube, in sepharose 4B, add the mixing of binding buffer liquid; Above mixed solution is added in pcr amplification product, PCR primer is mixed 10 minutes at normal temperatures, magnetic bead is combined with vitamin H; In vacuum preparation work station, in four sample panel, add the denaturation buffer of the high purity water of 180ml, 70% ethanol, lavation buffer solution and 120ml successively; Open the pump at vacuum preparation work station, vacuum preparation tool is cleaned 30 seconds in high purity water; Then vacuum preparation tool is moved on in PCR plate, capture sepharose 4B; Pick up PCR plate, check whether that most of magnetic bead has all been attracted on vacuum preparation tool; Vacuum preparation tool is put into 70% ethanol 5 seconds; Then 5 seconds are moved on in denaturation buffer; Move on to again in lavation buffer solution and clean 5 to 10 seconds; Turn off pump; Vacuum preparation tool is put into the plate containing methylation-specific sequencing primer, shake, release sepharose 4B; Use high purity water cleaning vacuum preparation tool; The PSQ96 plate being placed with sample is put be heated on hot plate 80 DEG C 2 minutes, then cool to room temperature;
Step 5: Manganic pyrophosphate complex initiation: on Manganic pyrophosphate complex initiation instrument, adopts PyromarkGoldQ24 test kit to check order to the sample in the PSQ96 plate in step 4, then applies PyroMarkCpG software and carries out methylation analysis to result.
In embodiment, adopt Lab-Aid820 Full automatic instrument for extracting nucleic acid to extract Whole Blood Genomic DNA in step one, then detect the concentration of DNA by NanoDrop2000 ultramicrospectrophotometer.
In embodiment, in step 2, adopt EZDNA methylating reagent box.
In embodiment, in step 3, pcr amplification condition is: the first sex change of 95 DEG C of 10min; Then 95 DEG C of 30s, Tm40s, 72 DEG C of 50s, the annealing reaction of totally 45 circulations; Then extension 72 DEG C of 7min.
In embodiment, in step 5, Manganic pyrophosphate complex initiation instrument adopts PyroMarkQ24 Manganic pyrophosphate complex initiation.
The inconsistent low expression causing Alzheimer ospc gene of the methylation level of g protein coupled receptor gene promoter region, thus affect generation and the development of alzheimer's disease.Therefore, the morbidity of the horizontal Ahl tribulus sea silent sickness of g protein coupled receptor gene promoter zone methylation is negative correlation in the male sex, the detection to alzheimer's disease can be realized quickly and easily on a molecular scale by the diagnostic kit detected based on alzheimer's disease gene promoter zone methylation level, detection efficiency is high, with strong points.
The morbidity of the horizontal Ahl tribulus sea silent sickness of g protein coupled receptor gene promoter zone methylation is proved in the male sex in negative correlation below by experiment.
1, the collection of research object
Patients with Alzheimer disease is collected from Ningbo City's Grade A hospital, diagnosis of dementias standard is according to the International Classification of Disease 10th edition (ICD-10) of the World Health Organization, and alzheimer's disease (AD) Case definition adopts NINCDS-ADRDA standard.Get rid of vascular dementia, after the diseases such as dementia with Lewy body, finally determine that Alzheimer patient 61 example is as case group (79.78 ± 7.87 years old), simultaneously collect age-matched and without dull-witted family history 63 normal persons as a control group (80.94 ± 8.88 years old).To all research objects under the prerequisite of informed consent, blood drawing detects the general biochemical indicator such as lipophorin, homocysteine, and venous blood samples 3ml enters in EDTA anticoagulant tube simultaneously ,-80 DEG C of low-temperature storage, and to be ready for use on, sample is unified extracts genomic dna.
2, the extraction of genomic dna
Application Lab-Aid820 Full automatic instrument for extracting nucleic acid (Chinese Xiamen, cause kind biotechnology) extract the Whole Blood Genomic DNA of the sample that above-mentioned steps obtains, again by the NanoDrop2000 ultramicrospectrophotometer (U.S., ThermoFisherScientific) concentration of gained DNA is detected, for the detection of BDNF gene promoter area DNA methylation level.
3, DNA methylation level determination
This experiment adopts pyrosequencing techniques pair
gPR507 CpG sites (as Fig. 1) of gene promoter area have carried out DNA methylation horizontal analysis.The ultimate principle of this technology: after bisulfite process DNA sample, using polymerase chain reaction (PCR) amplification again, the methylated cytosine(Cyt) of generation (C) base can be made to remain unchanged, and make that methylated C does not occur and be transformed to uridylic (U), then carry out PCR order-checking by sequencing primer, thus obtain which site and there occurs and methylate.This research adopts PyroMarkAssayDesign software to carry out design of primers, for the pcr amplification primer of testing and sequencing primer as follows:
(1) methylation-specific upstream primer (Forwardprimer)
5’-GGGGATTTAGAGAGGTTGTAAAG-3’，
(2) methylation-specific downstream primer (Reverseprimer)
5’-Biotin-CCAACCTATAAACCCAACTAACTACTCTAC-3’，
(3) methylation-specific sequencing primer (Sequencingprimer)
5’-GGGATTTTTTTAGTTGTTAGTTAT-3’。
The concrete steps of DNA methylation level determination:
The first step: adopt EZDNA methylating reagent box-Gold (EZDNAMethylation-Gold
tMkit; ZYMORESEARCH) bisulfite conversion is carried out to sample DNA.
Second step: get DNA sample 20ng transformed in the first step and join ZymoTaq
tMpreMix enzyme (ZymoTaq
tMpreMix, ZYMORESEARCH), and add above-mentioned a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer, carry out pcr amplification, amplification condition: the first sex change of 95 DEG C of 10min; Then 95 DEG C of 30s, Tm40s, 72 DEG C of 50s, the annealing reaction of totally 35 circulations; Then extension 72 DEG C of 7min.(note: Tm determines according to race PCR gradient temperature in an experiment)
3rd step: the early-stage preparations of Manganic pyrophosphate complex initiation: add the annealing buffer (PyroMarkAnnealingBuffer that 45 μ l contain 0.3 μM of above-mentioned methylation-specific sequencing primer in PSQ96 plate in advance; Qiagen); Transfer in an Eppendorf tube by needing the sepharose 4B total amount (every sample 3 μ l) of the mixing used; Binding buffer liquid (PyroMarkBindingBuffer is added in sepharose 4B; Qiagen), make average each sample about have the volume of 50 μ l, mixture is mixed; Above mixture is added in PCR primer (50 μ l reaction volume), every sample 50 μ l; PCR primer is mixed 10 minutes at normal temperatures, magnetic bead is combined with vitamin H; In vacuum preparation work station, in four sample panel, add the high purity water of 180ml, 70% ethanol, lavation buffer solution (PyroMarkWashBuffer successively; Qiagen; ) and the denaturation buffer (PyroMarkDenaturationSolution of 120ml; Qiagen); Open the pump at vacuum preparation work station, vacuum preparation tool is cleaned 30 seconds in high purity water; Then by vacuum preparation tool (PyroMarkVacuumPrepFilterProbes; Qiagen) move on in PCR plate, capture sepharose 4B (completing this at magnetic bead in PCR primer was in conjunction with latter three minutes to operate); Pick up PCR plate, check whether that most of magnetic bead has all been attracted on vacuum preparation tool; Vacuum preparation tool is put into 70% ethanol 5 seconds; Then 5 seconds are moved on in denaturation buffer; Move on to again in lavation buffer solution and clean 5-10 second; Turn off pump; Vacuum preparation tool is put into the plate containing sequencing primer, shake, release sepharose 4B (sequencing primer also can finally add); Use high purity water cleaning vacuum preparation tool; The PSQ96 plate being placed with sample is put be heated on hot plate 80 DEG C 2 minutes, then cool to room temperature, can carry out Manganic pyrophosphate complex initiation reaction.
4th step: Manganic pyrophosphate complex initiation: on PyroMarkQ24 Manganic pyrophosphate complex initiation instrument, adopts PyromarkGoldQ24 test kit (PyromarkGoldQ24Reagents; Qiagen) sample in the PSQ96 plate in the 3rd step is checked order, then apply PyroMarkCpG software and methylation analysis (methylation level detected result example is shown in Fig. 2) is carried out to result.Percentage ratio shown in Fig. 2 is the methylation in corresponding CpG site, and the methylation of CpG1 to CpG4 is respectively 39% as shown in Figure 2,36%, 50%, 48%, 37%, 33%, 35%.
4, data analysis
This experiment adopts SPSS16.0 to carry out finishing analysis to data, we find: there is significantly association (correlation coefficient r >0.691 between 7 detected CpG sites, p<0.001, there is statistical significance, see Fig. 1) (note: indicate statistical significance during p<0.05, lower same), so we participate in after CpG1-CpG7 is averaged in follow-up analysis, there is not significant difference (p=0.893, in table 1) in the DNA methylation level between case group and control group.We divide the difference of alzheimer's disease gene promoter zone methylation level between gender comparison case group and control group, result (see table 2) finds that Ahl tribulus sea silent sickness exists association (p=0.002) in the male sex, and result (see table 3) also represents that sex is on being that this gene methylation level has remarkably influenced.
Fig. 1 is detected sequence region: particular location is ChrX:150346251..150346464; And correlation analysis result between 7 CpG points detecting of point sex (in the such as male sex relation conefficient of CpG1 and CpG2 be 0.960, CpG2 and CpG3 relation conefficient be 0.954).
Table 1 case group and comparing (n=114) between control group
| Case group (n=51) | Control group (n=63) | p value | |
| Total bilirubin μm ol/L | 14.23±6.24 | 8.63±3.0 | 4.81E-07 |
| Bilirubin direct μm ol/L | 6.44±2.95 | 3.68±1.30 | 1.06E-07 |
| Unconjugated bilirubin μm ol/L | 7.79±3.70 | 4.96±1.85 | 1.44E-05 |
| Total protein g/L | 65.65±9.52 | 68.74±6.80 | 0.118 |
| Albumin g/L | 36.55±3.91 | 38.43±3.81 | 0.035 |
| Sphaeroprotein g/L | 30.00±5.65 | 30.30±5.30 | 0.807 |
| Archon ratio | 1.26±0.23 | 1.31±0.22 | 0.398 |
| Pseudocholinesterase KU/L | 6.14±1.96 | 6.62±1.76 | 0.286 |
| TOTAL BILE ACID μm ol/L | 5.98±5.78 | 6.79±3.81 | 0.506 |
| Prealbumin mg/Dl | 23.40±7.91 | 24.45±2.97 | 0.531 |
| Glutamic-oxal(o)acetic transaminase U/L | 23.28±11.56 | 20.75±7.18 | 0.294 |
| Triglyceride level mmol/L | 1.40±0.97 | 1.33±0.74 | 0.688 |
| Total cholesterol mmol/L | 4.22±1.23 | 4.44±1.02 | 0.346 |
| High density lipoprotein cholesterol mmol/L | 1.10±0.30 | 1.12±0.27 | 0.077 |
| APoA g/L | 0.92±0.20 | 1.06±0.20 | 0.005 |
| Apolipoprotein B g/L | 0.72±0.25 | 0.66±0.18 | 0.306 |
| Lp(a) mg/dL | 0.35±0.27 | 1.75±2.34 | 0.005 |
| Serum lipase U/L | 42.58±16.64 | 44.36±17.06 | 0.654 |
| Apo E mg/L | 36.49±10.35 | 37.73±17.43 | 0.763 |
| Potassium mmol/L | 3.95±0.43 | 4.34±0.42 | 1.45E-04 |
| Calcium mmol/L | 2.10±0.09 | 2.13±0.12 | 0.274 |
| Phosphorus mmol/L | 1.12±0.28 | 1.25±0.15 | 0.036 |
| Magnesium mmol/L | 0.87±0.12 | 0.56±0.07 | 0.687 |
| Creatinine μm ol/L | 77.96±30.17 | 82.09±46.59 | 0.625 |
| Immunoglobulin M g/L | 0.77±0.48 | 1.09±0.63 | 0.022 |
| Immunoglobulin G g/L | 12.08±2.55 | 13.08±0.63 | 0.112 |
| Immunoglobulin A g/L | 2.68±1.16 | 3.05±1.16 | 0.213 |
| Complement C_3 g/L | 0.91±0.22 | 1.12±0.24 | 0.001 |
| age | 79.78±7.87 | 80.94±8.88 | 0.236 |
| BMI | 22.64±3.04 | 22.39±3.60 | 0.704 |
| CpG1 | 18.53±13.60 | 17.92±11.27 | 0.784 b |
| CpG2 | 14.59±11.12 | 14.16±9.19 | 0.902 b |
| CpG3 | 28.41±17.29 | 27.24±14.72 | 0.86 b |
| CpG4 | 27.82±16.61 | 28.73±14.90 | 0.760 |
| CpG5 | 23.11±15.26 | 23.19±13.63 | 0.979 |
| CpG6 | 14.16±10.70 | 14.44±9.05 | 0.877 |
| CpG7 | 15.49±11.07 | 15.36±9.93 | 0.950 |
| Mean value | 20.29±13.40 | 20.11±11.61 | 0.893 b |
Case group and comparing (n=108) between control group after table 2 layering
| The male sex | Case group (n=27) | Control group (n=46) | p value |
| CpG1 | 7.12±6.48 | 14.85±10.06 | 0.001 b |
| CpG2 | 5.65±5.38 | 11.61±8.09 | 0.002 b |
| CpG3 | 14.46±9.49 | 22.76±12.60 | 0.005 b |
| CpG4 | 13.89±8.12 | 24.35±12.82 | 3.14E-04 b |
| CpG5 | 10.62±8.05 | 19.22±12.03 | 0.003 b |
| CpG6 | 5.62±5.13 | 11.80±7.93 | 2.24E-04 b |
| CpG7 | 6.44±5.63 | 12.57±8.63 | 0.003 b |
| Mean value | 9.15±6.58 | 16.67±10.12 | 0.002 b |
Comparing (n=108) after table 3 layering between male sex's group with women's group
Note: n represents number of samples,
pvalue is less than 0.05, has statistical significance; Add b and represent the rank test of utilization distribution free.
Most preferred embodiment of the present invention is illustrated, and the various change made by those of ordinary skill in the art or remodeling all can not depart from the scope of the present invention.
SEQUENCELISTING
<110> University Of Ningbo
The detection kit of <120> auxiliary diagnosis alzheimer's disease and detection method thereof
<130>
<160>3
<170>PatentInversion3.3
<210>1
<211>23
<212>DNA
<213> artificial sequence
<400>1
ggggatttagagaggttgtaaag23
<210>2
<211>30
<212>DNA
<213> artificial sequence
<400>2
ccaacctataaacccaactaactactctac30
<210>3
<211>24
<212>DNA
<213> artificial sequence
<400>3
gggatttttttagttgttagttat24
Claims (1)
1. the detection kit of auxiliary diagnosis alzheimer's disease, it is characterized in that: described detection kit comprises a pair g protein coupled receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer, a pair described g protein coupled receptor gene promoter zone methylation specificity amplification primer comprises methylation-specific upstream primer and methylation-specific downstream primer:
Described methylation-specific upstream primer is:
5’-GGGGATTTAGAGAGGTTGTAAAG-3’；
Described methylation-specific downstream primer is:
5’-Biotin-CCAACCTATAAACCCAACTAACTACTCTAC-3’；
Described methylation-specific sequencing primer is:
5’-GGGATTTTTTTAGTTGTTAGTTAT-3’。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410657145.9A CN104328200B (en) | 2014-11-18 | 2014-11-18 | The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410657145.9A CN104328200B (en) | 2014-11-18 | 2014-11-18 | The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104328200A CN104328200A (en) | 2015-02-04 |
| CN104328200B true CN104328200B (en) | 2016-04-06 |
Family
ID=52403005
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410657145.9A Expired - Fee Related CN104328200B (en) | 2014-11-18 | 2014-11-18 | The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104328200B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106978476A (en) * | 2016-08-17 | 2017-07-25 | 上海易瑞生物科技有限公司 | A kind of parkinson's syndrome tumor susceptibility gene detection and genotyping kit and its application |
| CN108456724A (en) * | 2018-03-23 | 2018-08-28 | 宁波大学 | A kind of detection kit and its detection method comprising opioid receptor gene |
| CN108707657A (en) * | 2018-06-12 | 2018-10-26 | 宁波大学 | A kind of detection kit and detection method including g protein coupled receptor gene |
| CN114410773B (en) * | 2022-01-27 | 2024-05-03 | 宁波大学 | Marker combination for predicting or diagnosing depression recurrence and application thereof |
| CN117143994B (en) * | 2023-10-12 | 2024-05-07 | 上海交通大学医学院附属第九人民医院黄浦分院 | Peripheral blood circulation DNA methylation marker for diagnosing Alzheimer disease, kit and identification method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2900936B1 (en) * | 2006-05-15 | 2013-01-04 | Exonhit Therapeutics Sa | METHOD AND METHODS FOR DETECTING ALZHEIMER'S DISEASE |
-
2014
- 2014-11-18 CN CN201410657145.9A patent/CN104328200B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104328200A (en) | 2015-02-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104328200B (en) | The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| CN103911456B (en) | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| Liu et al. | Pediatric acute lymphoblastic leukemia patients exhibit distinctive alterations in the gut microbiota | |
| JP2017184642A (en) | Dementia marker, evaluation method of dementia using same, evaluation reagent, and evaluation kit | |
| TW201639967A (en) | Method, kit, device and system of detecting fetal genetic information | |
| CN103103256B (en) | Can be used for the test kit and the application thereof that detect the DRD4 gene promoter zone methylation degree relevant to schizophrenia | |
| CN104328201B (en) | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| CN104561287A (en) | Reagent and method for detecting ninth exon mutation of CALR gene | |
| CN108018353A (en) | A kind of colorectal cancer early screening primer sets and kit based on 4 genes | |
| CN103602722B (en) | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia | |
| CN103937806B (en) | A kind of Rh blood group DEL type RHD838G > A allelotrope and detection method thereof | |
| CN105177152B (en) | Detect the method and primer of HLA-B*51 allele | |
| CN103305604B (en) | Kit for detecting CDKN2B gene promoter region methylation degree related to coronary disease and application thereof | |
| CN103122378B (en) | Kit capable of being used for detecting methylation degree of alpha-adduction protein gene promoter region related to primary hypertension and application thereof | |
| CN103966340B (en) | A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof | |
| CN105316349A (en) | Mycobacterium tuberculosis KatG mutant gene and application thereof | |
| CN113999901B (en) | Myocardial specific methylation markers | |
| Ng et al. | Detecting Graft-Derived Cell-Free DNA Through Amplification Refractory Mutation System Polymerase Chain Reaction in Living-Donor Liver Transplantation: Report of 2 Cases | |
| WO2018129887A1 (en) | Primary biliary cholangitis-associated interleukin 21 and application thereof | |
| CN103014165A (en) | Kit capable of being used for detecting methylation degree of PLA2G7 gene promoter region relevant to coronary heart disease and application of kit | |
| CN107400708A (en) | Purposes of the XRCC1 gene pleiomorphisms in rheumatic arthritis diagnoses validity | |
| CN105039543B (en) | Available for the kit and its application for detecting the PTPN1 gene promoter zone methylation degree related to diabetes B | |
| CN105886641B (en) | Detection kit and its application for auxiliary diagnosis essential hypertension | |
| CN105316350B (en) | Mycobacterium tuberculosis EmbB mutators and application thereof | |
| CN100376686C (en) | Method of detecting apolipoprotein E gene type and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160406 Termination date: 20181118 |