CN103966340B - A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof - Google Patents
A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof Download PDFInfo
- Publication number
- CN103966340B CN103966340B CN201410225922.2A CN201410225922A CN103966340B CN 103966340 B CN103966340 B CN 103966340B CN 201410225922 A CN201410225922 A CN 201410225922A CN 103966340 B CN103966340 B CN 103966340B
- Authority
- CN
- China
- Prior art keywords
- methylation
- disease
- primer
- alzheimer
- auxiliary diagnosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof, feature is that described test kit comprises a pair dopamine d 4 receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer, wherein upstream primer has the nucleotide sequence as shown in SEQ ID NO.1, downstream primer has the nucleotide sequence as shown in SEQ ID NO.2, methylation-specific sequencing primer is as shown in SEQ ID NO.3, advantage is the detection that this diagnostic kit can realize quickly and easily on a molecular scale to alzheimer's disease, detection efficiency is high, with strong points, simultaneously, the medicine being target spot with DRD4 gene promoter zone methylation is expected to become alzheimer's disease auxiliary diagnosis, a kind of new tool detecting and screen.
Description
Technical field
The present invention relates to the aided diagnosis technique field of alzheimer's disease, in particular to a kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof, especially a kind ofly the test kit and the application thereof that detect the dopamine D4 receptor gene promoter zone methylation degree that Ahl tribulus sea silent sickness is correlated with can be used for.
Background technology
Alzheimer's disease (Alzheimer disease, AD) is a kind of systemic nerve degenerative diseases, and its clinical manifestation is higher cognitive hypofunction, and principal character comprises neurofibrillary tangles and extracellular senile plaque in brain cell.AD needs of patients is nursed throughout one's life, brings great economical load therefore to society and family.AD is a kind of Complex Diseases caused by inherited genetic factors and environmental factors acting in conjunction, and the genetic mechanism found AD genes involved and then illustrate dementia morbidity has become the focus of at present research.Although have increasing medical research institute to pay attention to and carry out the etiological study of AD, and research focuses mostly in the single nucleotide polymorphism of correlation candidate gene and the cognation of AD, but its pathogeny is not explained clear yet completely, and this hampers the raising of AD Prevention and Curation level undoubtedly.
A kind of important receptor protein-dopamine d 4 receptor in dopamine D4 receptor gene (Dopamine receptor D4) encode dopamine neurohumor transmission path system, with cognitive and affective behavior is closely related.
At present, any test kit correlative study report about for detecting the dopamine D4 receptor gene promoter zone methylation degree that Ahl tribulus sea silent sickness is correlated with also is not disclosed both at home and abroad.
Summary of the invention
Technical problem to be solved by this invention is the present situation for prior art, there is provided detection efficiency high, a kind of detection kit for auxiliary diagnosis alzheimer's disease with strong points and application thereof, wherein the morbidity of the horizontal Ahl tribulus sea silent sickness of dopamine D4 receptor gene promoter zone methylation is proportionate.
The present invention solves the problems of the technologies described above adopted technical scheme:
For a detection kit for auxiliary diagnosis alzheimer's disease, in described detection kit, comprise a pair dopamine d 4 receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer:
The nucleotide sequence of methylation-specific upstream primer:
5′-biotin-GGGAGGTTTTGTTAGATATTAGGT-3′；
The nucleotide sequence of methylation-specific downstream primer:
5′-CCACCCTAAACCCAATATTTACTCATCTTA-3′；
The nucleotide sequence of methylation-specific sequencing primer:
5′-ACCAAACCAAACCCT-3′。
For an application for the detection kit of auxiliary diagnosis alzheimer's disease, described detection kit can be used for alzheimer's disease auxiliary diagnosis, detection or examination medicine.
Compared with prior art, the invention has the advantages that: the detection kit for auxiliary diagnosis alzheimer's disease of the present invention makes public for the first time test kit for detecting the dopamine D4 receptor gene promoter zone methylation degree that Ahl tribulus sea silent sickness is correlated with and application thereof, and the hyper-methylation level of dopamine D4 receptor gene promoter region causes
dRD4the low expression of gene, thus the generation and the development that affect alzheimer's disease.Therefore, the morbidity of the horizontal Ahl tribulus sea silent sickness of dopamine D4 receptor gene promoter zone methylation is proportionate, to detect
dRD4diagnostic kit based on gene promoter zone methylation level can realize the detection to alzheimer's disease quickly and easily on a molecular scale, and detection efficiency is high, with strong points, meanwhile, with
dRD4gene promoter zone methylation is a kind of new tool that the medicine of target spot is expected to become AD auxiliary diagnosis, detection and screening.
Accompanying drawing explanation
Fig. 1 is detected sequence region (particular location is chr11:637304-640705), and correlation analysis result figure between detect 4 CpG points (relation conefficient of such as CpG1 and CpG2 be 0.685, CpG2 and CpG3 relation conefficient be 0.718);
Fig. 2 is methylation level detected result exemplary plot (percentage ratio shown in figure is the methylation in corresponding CpG site, and the methylation being shown with CpG1 to CpG4 as figure is respectively 19%, 15%, 18%, 13%).
Embodiment
Below in conjunction with accompanying drawing embodiment, the present invention is described in further detail.
For a detection kit for auxiliary diagnosis alzheimer's disease, in described detection kit, comprise a pair dopamine d 4 receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer:
The nucleotide sequence of methylation-specific upstream primer:
5′-biotin-GGGAGGTTTTGTTAGATATTAGGT-3′；
The nucleotide sequence of methylation-specific downstream primer:
5′-CCACCCTAAACCCAATATTTACTCATCTTA-3′；
The nucleotide sequence of methylation-specific sequencing primer:
5′-ACCAAACCAAACCCT-3′。
For an application for the detection kit of auxiliary diagnosis alzheimer's disease, described detection kit can be used for alzheimer's disease auxiliary diagnosis, detection or examination medicine.
1, the collection of research object
Collect patients with Alzheimer disease from Ningbo City's Grade A hospital, diagnosis of dementias standard is according to the International Classification of Disease 10th edition (ICD-10) of the World Health Organization, and alzheimer's disease (AD) Case definition adopts NINCDS-ADRDA standard.Get rid of vascular dementia, after the diseases such as dementia with Lewy body, finally determine that Alzheimer patient 46 example is as case group (80.67 ± 9.20 years old), simultaneously collect age-matched and without dull-witted family history 61 normal persons as a control group (79.54 ± 7.87 years old).To all research objects under the prerequisite of informed consent, blood drawing detects the general biochemical indicator such as lipophorin, homocysteine, and venous blood samples 3ml enters in EDTA anticoagulant tube simultaneously ,-80 DEG C of low-temperature storage, and to be ready for use on, sample is unified extracts genomic dna.
2, the extraction of genomic dna
Application Lab-Aid 820 Full automatic instrument for extracting nucleic acid (Chinese Xiamen, cause kind biotechnology) extract the Whole Blood Genomic DNA of the sample that above-mentioned steps obtains, again by the NanoDrop2000 ultramicrospectrophotometer (U.S., Thermo Fisher Scientific) detect the concentration of gained DNA, for
dRD4the detection of gene promoter area DNA methylation level.
3, DNA methylation level determination
This research adopts pyrosequencing techniques pair
dRD44 CpG sites (as Fig. 1) of gene promoter area have carried out DNA methylation horizontal analysis.The ultimate principle of this technology: after bisulfite process DNA sample, using polymerase chain reaction (PCR) amplification again, the methylated cytosine(Cyt) of generation (C) base can be made to remain unchanged, and make that methylated C does not occur and be transformed to uridylic (U), then carry out PCR order-checking by sequencing primer, thus obtain which site and there occurs and methylate.This research adopts PyroMark Assay Design software to carry out design of primers, for the pcr amplification primer of testing and sequencing primer as follows:
(1) methylation-specific upstream primer (Forward primer)
5′-biotin-GGGAGGTTTTGTTAGATATTAGGT-3′（SEQ ID NO.1）；
(2) methylation-specific downstream primer (Reverse primer)
5′-CCACCCTAAACCCAATATTTACTCATCTTA-3′（SEQ ID NO.2）；
(3) methylation-specific sequencing primer (Sequencing primer)
5′-ACCAAACCAAACCCT-3′（SEQ ID NO.3）。
Specific experiment step:
A. EZ DNA methylation test kit-Gold(EZ DNA Methylation-Gold is adopted
tMkit; ZYMO RESEARCH) bisulfite conversion is carried out to sample DNA.
B. get DNA sample 20ng transformed in steps A and join Zymo Taq
tMpreMix enzyme (Zymo Taq
tMpreMix, ZYMO RESEARCH), and add above-mentioned a pair dopamine d 4 receptor gene promoter zone methylation specificity amplification primer, carry out pcr amplification, amplification condition: the first sex change of 95 DEG C of 10min; Then 95 DEG C of 30s, Tm 40s, 72 DEG C of 50s, the annealing reaction of totally 45 circulations; Then extension 72 DEG C of 7min.(note: Tm determines according to race PCR gradient temperature in an experiment)
C. the early-stage preparations of Manganic pyrophosphate complex initiation: add annealing buffer (the PyroMark Annealing Buffer that 45 μ l contain 0.3 μM of above-mentioned methylation-specific sequencing primer in PSQ96 plate in advance; Qiagen); Transfer in an Eppendorf pipe by needing the sepharose 4B total amount (every sample 3 μ l) of the mixing used; Binding buffer liquid (PyroMark Binding Buffer is added in sepharose 4B; Qiagen), make average each sample about have the volume of 50 μ l, mixture is mixed; Above mixture is added in PCR primer (50 μ l reaction volume), every sample 50 μ l; PCR primer is mixed 10 minutes at normal temperatures, magnetic bead is combined with vitamin H; In vacuum preparation work station, in four sample panel, add the high purity water of 180ml, 70% ethanol, lavation buffer solution (PyroMark Wash Buffer successively; Qiagen; ) and denaturation buffer (the PyroMark Denaturation Solution of 120ml; Qiagen); Open the pump at vacuum preparation work station, vacuum preparation tool is cleaned 30 seconds in high purity water; Then by vacuum preparation tool (PyroMark Vacuum Prep Filter Probes; Qiagen) move on in PCR plate, capture sepharose 4B (completing this at magnetic bead in PCR primer was in conjunction with latter three minutes to operate); Pick up PCR plate, check whether that most of magnetic bead has all been attracted on vacuum preparation tool; Vacuum preparation tool is put into 70% ethanol 5 seconds; Then 5 seconds are moved on in denaturation buffer; Move on to again in lavation buffer solution and clean 5-10 second; Turn off pump; Vacuum preparation tool is put into the plate containing sequencing primer, shake, release sepharose 4B (sequencing primer also can finally add); Use high purity water cleaning vacuum preparation tool; The PSQ96 plate being placed with sample is put be heated on hot plate 80 DEG C 2 minutes, then cool to room temperature, can carry out Manganic pyrophosphate complex initiation reaction.
D. Manganic pyrophosphate complex initiation: on PyroMark Q24 Manganic pyrophosphate complex initiation instrument, adopts Pyromark Gold Q24 test kit (Pyromark Gold Q24 Reagents; Qiagen) sample in the PSQ96 plate in step C is checked order, then apply PyroMark CpG software and methylation analysis (methylation level detected result example is shown in Fig. 2) is carried out to result.
4, data analysis
This research adopts SPSS 16.0 pairs of data to carry out finishing analysis, we find: there is significantly association (correlation coefficient r > 0.442 between 4 detected CpG sites, p < 0.001, there is statistical significance, see Fig. 1) (note: indicate statistical significance during p < 0.05, lower same), so we participate in after CpG1-CpG4 is averaged in follow-up analysis, find that the DNA methylation level between case group and control group exists significant difference (p=4.69E-05, in table 1).Therefore, we divide between gender comparison case group and control group
dRD4the difference of gene promoter zone methylation level, result (see table 2) finds in the male sex, there is association (CpG1:p=0.013 in the equal Ahl tribulus sea silent sickness in each CpG site, CpG2:p=0.012, CpG3:p=1.51E-04, CpG4:p=2.11E-05), and in women, only find CpG1 Ahl tribulus sea silent sickness relevant (p=0.009).
The present invention can be used for detecting the test kit of dopamine D4 receptor gene promoter zone methylation degree that Ahl tribulus sea silent sickness is correlated with and has accurately and reliably, flexibly fast and the advantage of economy.The present invention adopts mentioned reagent box pair
dRD4gene promoter zone methylation level detects, and can be that the auxiliary diagnosis of alzheimer's disease, detection or examination medicine are offered reference fast and reliablely.
Table 1 case group and comparing (n=107) between control group
| Characteristics | Case （n = 46） Mean ± SD | Control （n = 61） Mean ± SD | p value |
| Age （years） | 80.67±9.20 | 79.54±7.87 | 0.495 |
| TP （g/L） | 68.79±6.91 | 65.48±9.45 | 0.099 |
| ALB （g/L） | 38.32±3.83 | 36.86±3.61 | 0.090 |
| GLB （g/L） | 30.46±5.32 | 29.55±4.58 | 0.418 |
| A/G | 1.29±0.22 | 1.28±0.20 | 0.768 |
| ALT （U/L） | 13.87±10.68 | 18.20±13.46 | 0.193 a |
| ALP （U/L） | 78.00±24.30 | 96.82±63.34 | 0.113 a |
| TBA （μmol/L） | 6.91±3.84 | 6.07±5.86 | 0.503 |
| AST （U/L） | 20.52±7.22 | 23.58±11.70 | 0.258 a |
| Glu （mmol/L） | 5.23±1.58 | 5.53±2.71 | 0.444 b |
| TG （mmol/L） | 1.35±0.76 | 1.42±0.98 | 0.896 a |
| TC （mmol/L） | 4.48±1.04 | 4.28±1.22 | 0.378 |
| HDL-C （mmol/L） | 1.12±0.27 | 1.04±0.30 | 0.118 |
| ApoA （g/L） | 1.06±0.21 | 0.94±0.18 | 0.011 |
| ApoB （g/L） | 0.66±0.19 | 0.73±0.25 | 0.194 |
| Lp（a） （g/L） | 184.86±233.63 | 34.86±27.32 | 1.60E-04 a |
| ApoE （mg/L） | 37.73±17.44 | 36.69±10.37 | 0.800 |
| UREA （mmol/L） | 7.77±10.00 | 6.45±3.45 | 0.804 b |
| CRE （μmol/L） | 82.73±47.25 | 78.52±30.04 | 0.626 |
| UA （μmol/L） | 309.93±106.30 | 308.88±112.75 | 0.967 |
| Hcy （μmol/L） | 19.76±10.82 | 17.67±20.84 | 0.046 a |
| CRP （mg/L） | 6.20±11.72 | 15.00±26.21 | 0.016 a |
| Mean DRD4 methylation （%） | 14.67±4.12 | 11.44±3.72 | 4.69E-05 |
Case group and comparing (n=108) between control group after table 2 layering
| Characteristics | Case Mean ± SD | Control Mean ± SD | p value |
| All | |||
| CpG1 （%） | 16.50±5.14 | 13.13±4.67 | 0.001 # |
| CpG2 （%） | 12.26±4.84 | 10.13±3.92 | 0.013 # |
| CpG3 （%） | 14.98±5.27 | 11.59±4.59 | 0.001 # |
| CpG4 （%） | 14.96±4.22 | 10.92±4.90 | 1.96E-05 # |
| Mean DRD4 methylation （%） | 14.67±4.12 | 11.44±3.72 | 4.69E-05 # |
| Male | |||
| CpG1 （%） | 16.74±4.92 | 13.68±4.55 | 0.013 # |
| CpG2 （%） | 12.87±3.94 | 10.39±3.62 | 0.012 # |
| CpG3 （%） | 15.61±4.35 | 11.16±4.27 | 1.51E-04 # |
| CpG4 （%） | 15.65±4.60 | 10.36±4.42 | 2.11E-05 # |
| Mean DRD4 methylation （%） | 15.22±3.72 | 11.40±3.47 | 9.17E-05 # |
| Female | |||
| CpG1 （%） | 16.26±5.45 | 11.71±4.82 | 0.009 # |
| CpG2 （%） | 11.65±5.63 | 9.47±4.67 | 0.201 |
| CpG3 （%） | 14.35±6.10 | 12.71±5.31 | 0.380 |
| CpG4 （%） | 14.26±3.78 | 12.35±5.88 | 0.220 |
| Mean DRD4 methylation （%） | 14.13±4.51 | 11.56±4.40 | 0.080 |
Note: in table 1 and table 2, n is sample size; In list data,
pvalue is less than 0.05, has statistical significance; Add after # represents Multiple detection
pvalue still has statistical significance; Add a to represent and carried out Logarithm conversion; Add b and represent the rank test of utilization distribution free.
Most preferred embodiment of the present invention is illustrated, and the various change made by those of ordinary skill in the art or remodeling all can not depart from the scope of the present invention.
SEQUENCE LISTING
<110> University Of Ningbo
<120> detection kit for auxiliary diagnosis alzheimer's disease and application thereof
<130>
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 24
<212> DNA
<213> artificial sequence
<400> 1
biotin-gggaggttttgttagatattaggt
<210> 2
<211> 30
<212> DNA
<213> artificial sequence
<400> 2
ccaccctaaacccaatatttactcatctta
<210> 3
<211> 15
<212> DNA
<213> artificial sequence
<400> 3
accaaaccaaaccct
Claims (1)
1. for a detection kit for auxiliary diagnosis alzheimer's disease, it is characterized in that: in described detection kit, comprise a pair dopamine d 4 receptor gene promoter zone methylation specificity amplification primer and a methylation-specific sequencing primer:
Methylation-specific upstream primer is:
5′-biotin-GGGAGGTTTTGTTAGATATTAGGT-3′；
The nucleotide sequence of methylation-specific downstream primer:
5′-CCACCCTAAACCCAATATTTACTCATCTTA-3′；
The nucleotide sequence of methylation-specific sequencing primer:
5′-ACCAAACCAAACCCT-3′。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410225922.2A CN103966340B (en) | 2014-05-26 | 2014-05-26 | A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410225922.2A CN103966340B (en) | 2014-05-26 | 2014-05-26 | A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103966340A CN103966340A (en) | 2014-08-06 |
| CN103966340B true CN103966340B (en) | 2015-09-16 |
Family
ID=51236342
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410225922.2A Expired - Fee Related CN103966340B (en) | 2014-05-26 | 2014-05-26 | A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966340B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328201B (en) * | 2014-11-18 | 2016-04-06 | 宁波大学 | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1293669A (en) * | 1998-02-26 | 2001-05-02 | 纽罗根公司 | Benzylpiperazingl-and benzylipeeridinyl ethanone derivatives, their preparation method and their use as dopamine D receptor antagonists |
-
2014
- 2014-05-26 CN CN201410225922.2A patent/CN103966340B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103966340A (en) | 2014-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Varona et al. | Visual detection of single-nucleotide polymorphisms using molecular beacon loop-mediated isothermal amplification with centrifuge-free DNA extraction | |
| CN103911456B (en) | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| CN104328200B (en) | The detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| Liu et al. | Pediatric acute lymphoblastic leukemia patients exhibit distinctive alterations in the gut microbiota | |
| CN103103256B (en) | Can be used for the test kit and the application thereof that detect the DRD4 gene promoter zone methylation degree relevant to schizophrenia | |
| JP2014530011A5 (en) | ||
| CN104328201B (en) | A kind of detection kit of auxiliary diagnosis alzheimer's disease and detection method thereof | |
| CN113999901B (en) | Myocardial specific methylation markers | |
| CN103602722B (en) | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia | |
| Gu et al. | Bead-based multiplexed droplet digital polymerase chain reaction in a single tube using universal sequences: an ultrasensitive, cross-reaction-free, and high-throughput strategy | |
| CN103160582B (en) | Kit for detecting methylation degree for GCK (glucokinase) gene associated with type 2 diabetes and application thereof | |
| JP2012507291A5 (en) | ||
| CN103966340B (en) | A kind of detection kit for auxiliary diagnosis alzheimer's disease and application thereof | |
| CN103937806B (en) | A kind of Rh blood group DEL type RHD838G > A allelotrope and detection method thereof | |
| JP2013236627A (en) | Analysis methods for y chromosome and deletion site of sperm forming area on y chromosome | |
| CN103122378B (en) | Kit capable of being used for detecting methylation degree of alpha-adduction protein gene promoter region related to primary hypertension and application thereof | |
| Chen et al. | Saliva as a sampling source for the detection of leukemic fusion transcripts | |
| CN104561258B (en) | A kind of detection kit for straight colon cancer early diagnosis and application thereof | |
| CN105886641B (en) | Detection kit and its application for auxiliary diagnosis essential hypertension | |
| CN103014165A (en) | Kit capable of being used for detecting methylation degree of PLA2G7 gene promoter region relevant to coronary heart disease and application of kit | |
| TW201408779A (en) | Method and kit for detecting a mycobacterium tuberculosis | |
| JP2017189166A (en) | Method for diagnosing chronic pyoderma and diagnostic kit for chronic pyoderma | |
| CN108456724A (en) | A kind of detection kit and its detection method comprising opioid receptor gene | |
| CN104726589A (en) | Kit for detecting methylation degree of colorectal cancer related CMTM3 (CKLF-like MARVEL transmembrane domain containing family member 3) gene promoter region and application of kit | |
| CN106916877A (en) | A kind of mycobacterium tuberculosis rifampin-resistance mutation detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150916 Termination date: 20190526 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |