TW201408779A - Method and kit for detecting a mycobacterium tuberculosis - Google Patents

Abstract

The present invention provides a primer set for detecting Mycobacterium tuberculosis. The present invention also provides a method for detecting Mycobacterium tuberculosis. The process is able to amplify a large quantity of IS6110 gene sequences of Mycobacterium tuberculosis in samples by Loop-mediated Isothermal PCR (LAMP), and analyzing the amplified DNA fragments by gel electrophoresis, magnesium pyrophosphate formation or SYBER Green fluorescence, which can correctly and efficiently detect the existence of Mycobacterium tuberculosis in the samples. The present invention further provides a kit for detecting Mycobacterium tuberculosis.

Description

Method and kit for detecting tuberculosis

The invention relates to a primer for detecting tuberculosis, and particularly relates to a primer group for detecting Mycobacterium tuberculosis by a constant temperature circular nucleic acid amplification method.

Tuberculosis is a worldwide concern. In April 1993, the World Health Organization announced that tuberculosis was a global emergency disease and called on countries to work together to prevent and cure. According to estimates by the World Health Organization (WHO), about one-third of the world's population currently suffers from tuberculosis, and almost one second in the world, one person has new tuberculosis, and nearly two million people worldwide each year. Died of tuberculosis. In addition, it is estimated that 300 million people will be infected in the next 10 years, 940,000 people will be ill and 30 million will die. In addition, according to the Taiwan Provincial Department of Health's Disease Control Agency, the total number of legally infected patients in Taiwan in 2007 was 4,932, of which 1,448 were tuberculosis, accounting for about one-third of all.

Tuberculosis pathogen Mycobacterium tuberculosis complex (Mycobacterium tuberculosis complex, MTBC), contains M.tuberculosis, M.bovis, M.africanum, M.microti and M.canetti, of which the most important bacteria causing tuberculosis in humans tuberculous mycobacteria (M.tubcrculosis), but the most important parts of the lung is suffering from TB infection. However, the average person does not necessarily become a tuberculosis patient after infection. Only one in ten will be called primary infection (primary TB), and the rest will be latent tuberculosis infection (LTBI). These people may end their life. It will not occur, but about 5% of people are called active tuberculosis (Reactivation TB) because of the change of immunity. If the early diagnosis of "latent tuberculosis patients" is diagnosed early, it will effectively monitor and reduce tuberculosis infection.

At present, the main methods for clinical diagnosis of tuberculosis include smear acid-resistant staining microscopy and tuberculosis culture. Although the method is simple, the sensitivity of smear microscopy is low, only 50% to 60%, usually in sputum samples. In the case, at least 10,000 tuberculosis bacteria are needed before they can be found under the microscope. As for the tuberculosis culture method, although the specificity is high, it takes six to eight weeks to obtain a definitive diagnosis, and these shortcomings limit the efficacy and timeliness of the methods themselves in diagnosis and treatment. At present, there are many methods for detecting tuberculosis using PCR. Bacillus, but its sensitivity is only 60% to 80%, and the time required is six to seven hours. Therefore, there is an urgent need for a faster and more accurate diagnosis method, providing data for early diagnosis and early treatment of physicians.

It is known from the above background information that in the conventional tuberculosis detection technology, it has the disadvantages of complicated operation procedure, long time, low sensitivity, and the like, and the invention provides a rapid, sensitive and accurate detection method of tuberculosis.

Accordingly, the present invention provides a primer set for detecting tubercle bacilli in a clinical specimen, in particular, a novel primer set for detecting tuberculosis by a loop-mediated Isothermal Amplification (LAMP) method, including SEQ ID NO: 1~ SEQ ID NO: 6, this primer set can detect the single tuberculosis IS6110 gene in the reaction tube and is highly sensitive.

The invention further provides a method for rapidly detecting tubercle bacillus, wherein after the sample is decomposed in the cell, the DNA extraction is not performed, and the nucleic acid is directly amplified. The method comprises the steps of: (a) treating a sample with a cell decomposing reagent; (b) mixing the sample with a primer, wherein the primer comprises SEQ ID NO: 1 to SEQ ID NO: 6; (c) using a nucleic acid amplification method Amplifying one of the labeled DNA of the sample; and (d) detecting the target DNA.

The nucleic acid amplification method is a constant temperature circular nucleic acid amplification method.

In a specific embodiment, the primer sequence used in step (b) is SEQ ID NO: 1 and SEQ ID NO: 2, and the sequence of an primer pair is SEQ ID NO: 3 and SEQ ID NO. In a preferred embodiment, step (b) simultaneously incorporates a pair of circular primers, the sequences of which are SEQ ID NO: 5 and SEQ ID NO: 6 for enhancing the amplification target product.

The technical means adopted by the present invention for solving the shortcomings of the prior art is mainly to utilize a sample of a cell decomposition reagent, and to detect tuberculosis by a constant temperature circular nucleic acid amplification method using a primer set of the tuberculosis IS6110 gene.

The invention further provides a kit for detecting tuberculosis, comprising: (a) an primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 Group; and (b) a nucleic acid amplification reagent.

Wherein the nucleic acid amplification reagent is a thermostatic circular nucleic acid amplification reagent, wherein the primer is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. In a preferred embodiment, the primer further comprises SEQ ID NO: 5 and SEQ ID NO: 6. Rapid, highly specific and highly sensitive detection of Mycobacterium tuberculosis can be achieved by the technical means of the present invention.

The above described objects, features and advantages of the present invention will become more apparent to those skilled in the <RTIgt;

The method for detecting tuberculosis by using the novel primer set of the present invention actually comprises three steps: <1> processing a sample by a cell decomposition reagent, <2> amplifying the target DNA by a constant temperature loop reaction, and <3> using DNA electrophoresis. The amplified DNA is detected by gel or magnesium pyrophosphate turbidity or SYBR Green fluorimetry.

Example 1. Sample preparation and processing

For 44 samples of clinical sputum samples, add these samples to the same amount of sodium hydroxide-L-Acetyl-L-cysteine solution. After 15 minutes at room temperature, after centrifugation, the pellet was resuspended in 1 mL of phosphate buffer (PBS, pH 7.4) to obtain 100 μl of the suspension, and 400 μl of DNA lysis buffer (probiotics) was heated. 95 ° C, 5 minutes, high-speed centrifugation, 5 minutes, remove the supernatant (provided by the Cathay Hospital laboratory, and according to the clinical tuberculosis culture method, judge it as a positive or negative sample).

2. Introduction group design:

The primer used in the present invention is based on the sequence of the M. tuberculosis IS6110 gene fragment (GenBank accession NO. X17348) and is designed with a LAMP primer design software (http://primer explorer.JP/e/mdex.html). The primers used in the present invention and their sequences are shown in Table 1, including FO (SEQ ID NO: 1), BO (SEQ ID NO: 2), FI (SEQ ID NO: 3), and BI (SEQ ID NO: 4). , FL (SEQ ID NO: 5) and FB (SEQ ID NO: 6) and other primers.

3. Thermostatic ring nucleic acid amplification method (LAMP) test

The total volume of the LAMP assay reaction mixture of the present invention is 25 μl including: 0.2 μM FO and BO primer, 1.6 μM FI and BI primer and 0.8 μM FL and BL primer, 1.5 mM dNTP, 0.8 M betaine, 20 mM Tris- HCl (pH.8.8), 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 6 mM MgSO ₄ , 0.1% Triton X-100, 8 U Bst DNA polymerase (New England Biolabs) and 2 μl of sample extraction Above the clear liquid. The LAMP reaction conditions were 65 ° C, 60 minutes and 80 ° C for 5 minutes. After the reaction, the LAMP product was analyzed by 1.5% acacia gel electrophoresis.

4. Evaluation of clinical samples

Sensitivity, specificity, positive predictive value and negative predictive value of different diagnostic methods were calculated in the following manner.

Sensitivity = true positive number ^* 100 / (true positive number + false negative number)

Specificity = true negative number ^* 100 / (true negative number + false positive number)

Positive predictive value = true positive number ^* 100 / (true positive number + false positive number)

Negative predictive value = true negative number ^* 100 / (true negative number + false negative number)

5. Experimental results

A total of 44 clinical samples, including 31 positive samples and 13 negative samples, were tested for the technical means provided by the present invention. The results are shown in Figures 1(A) to (C), and 13 negative samples were detected. The results were all true negative, 31 positive samples, the test results only one sample was false negative and the rest were true positive reactions. The evaluation methods of clinical samples are shown in Table 2. The test results are sensitive and special. The primordial values were 96.8% and 100%, respectively, and the positive and negative predictive values were 100% and 92.9%, respectively, indicating that the technical means provided by the present invention can effectively and correctly assess whether the tuberculosis suspected patient is infected with tuberculosis, and the present invention is inspected. The body treatment to the test results takes only about two hours, which is faster. If the LAMP product is detected by the magnesium pyrophosphate turbidity method or the SYBR Green fluorescent color method, the result can be directly judged by the naked eye, and it is more convenient and rapid in use. .

Sensitivity=30/31 ^* 100%=96.8%

Specificity = 13/13 ^* 100% = 100%

Positive predictive value = 30/30 ^* 100% = 100%

Negative predictive value = 13/14 ^* 100% = 92.9%

Figure 1 (A) to (C) are the results of detecting clinical samples of patients with suspected tuberculosis, in which 〝-〞 结核 tuberculosis culture is a negative sample; 〝+〞 结核 tuberculosis culture is a positive sample; 〝NC〞 system Negative control group and 〝M〞 DNA standard.

<110> Yisheng Biotechnology Development Co., Ltd.

<120> Method and kit for measuring Mycobacterium tuberculosis /METHOD AND KIT FOR DETECTING A MYCOBACTERIUM TUBERCULOSIS

<160> 6

<170> PateneIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> FO primer of LAMP of IS6110 gene

<400> 1

<210> 2

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> BO primer of LAMP of IS6110 gene

<400> 2

<210> 3

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> FI primer for LAMP of IS6110 gene

<400> 3

<210> 4

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> BI primer of LAMP of IS6110 gene

<400> 4

<210> 5

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> FL primer of LAMP of IS6110 gene

<400> 5

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> BL primer of LAMP of IS6110 gene

<400> 6

Claims (10)

An primer for detecting tubercle bacillus comprising the following sequences: FO: AGACCTCACCTATGTGTCGA (SEQ ID NO: 1), BO: TCGCTGAACCGGATCGA (SEQ ID NO: 2), FI: ATGGAGGTGGCCATCGTGGAAGCCTACGTGGCCTTTGTCAC (SEQ ID NO: 3), and BI: AAGCCATCTGGACCCGCC AACCCCTATCCGTATGGTGGAT (SEQ ID NO: 4). The primer according to item 1 of the patent application further comprises the following sequences: FL: AGGATCCTG CGAGCGTAG (SEQ ID NO: 5) and BL: AAGAAGGCGTACTCG ACCTG (SEQ ID NO: 6). A method for detecting tuberculosis comprising the steps of: (a) treating a sample with a cell decomposing reagent; (b) mixing the sample with a primer as in claim 1; (c) amplifying by a nucleic acid amplification method One of the samples is labeled with DNA; and (d) the target DNA is detected. The method of claim 3, wherein the step (c) is a constant temperature circular nucleic acid amplification method. The method according to the fourth aspect of the invention, wherein the primer (1) used in the step (b) is an SEQ ID NO: 1 and SEQ ID NO: 2, and an intron sequence is SEQ ID. NO: 3 and SEQ ID NO: 4. The method of claim 5, wherein the step (b) simultaneously adds a pair of circular primers, the sequences of which are SEQ ID NO: 5 and SEQ ID NO: 6, for enhancing the amplification target product. A kit for detecting tuberculosis, comprising: (a) an primer selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO a group consisting of: 5 or SEQ ID NO: 6; and (b) a nucleic acid amplification reagent. The kit of claim 7, wherein the nucleic acid amplification reagent is a thermostatic circular nucleic acid amplification reagent. The kit of claim 7, wherein the primer is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. The kit of claim 9, wherein the primer further comprises SEQ ID NO: 5 and SEQ ID NO: 6.