CN113667734B - Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit - Google Patents
Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit Download PDFInfo
- Publication number
- CN113667734B CN113667734B CN202110808584.5A CN202110808584A CN113667734B CN 113667734 B CN113667734 B CN 113667734B CN 202110808584 A CN202110808584 A CN 202110808584A CN 113667734 B CN113667734 B CN 113667734B
- Authority
- CN
- China
- Prior art keywords
- schizophrenia
- methylation
- shank3
- reagent
- fragment sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Abstract
The invention provides an application of a SHANK3 fragment sequence methylation detection reagent in preparation of a schizophrenia diagnostic kit, belonging to the technical field of in-vitro diagnostic reagents. The research of the invention finds that the segment sequence with the length of 144bp of the SHANK3 gene promoter can be used as a biomarker for diagnosing schizophrenia. Compared with healthy people, the methylation level of CG at 83 th and 84 th positions and CG at 109 th and 110 th positions of the fragment sequence of the schizophrenia patient is obviously increased. Therefore, the methylation detection reagent of the segment sequence with the length of 144bp of the SHANK3 gene promoter can be used for preparing a schizophrenia diagnosis kit, is used for early diagnosis of schizophrenia, and has good application prospect.
Description
Technical Field
The invention belongs to the technical field of in-vitro diagnostic reagents, and particularly relates to an application of a SHANK3 fragment sequence methylation detection reagent in preparation of a schizophrenia diagnostic kit.
Background
Schizophrenia is a chronic disabling encephalopathy (SCZ) characterized by various damages of thinking, emotion, will behaviors and the like, and the chronic disabling encephalopathy mostly occurs in the late stage or early adult stage of teenagers, has a lifetime prevalence rate of about 1%, and can seriously affect the life, work, learning and social functions of patients. However, the pathophysiological mechanism of schizophrenia has not been fully elucidated so far, and the diagnosis and classification criteria of schizophrenia are still based on clinical symptoms and behavioral descriptions of patients, and lack of reliable biological basis for guiding clinical diagnosis and treatment, which greatly limits objective diagnosis, early intervention and effective treatment of schizophrenia in clinic, so that there is a need for developing an objective diagnostic reagent for schizophrenia.
The diagnostic reagent is prepared by adopting the principles or methods of immunology, microbiology, molecular biology and the like, and is used for diagnosing and detecting human diseases, investigating epidemiology and the like in vitro. The diagnostic reagent can be used for early diagnosis of diseases and has important significance for early intervention and effective treatment of the diseases. Therefore, the development of effective diagnostic agents for schizophrenia is important for the diagnosis and treatment of schizophrenia.
However, the lack of markers for diagnosing schizophrenia is a significant cause of the current difficulty in diagnosing schizophrenia. Due to the high complexity of the brain, it is difficult to accurately find biomarkers for the diagnosis of schizophrenia.
Therefore, there is a high necessity to find a biomarker for diagnosing schizophrenia.
Disclosure of Invention
The invention aims to provide application of a SHANK3 fragment sequence methylation detection reagent in preparation of a schizophrenia diagnostic kit.
The invention provides an application of a reagent for detecting the methylation of a promoter fragment sequence of a SHANK3 gene in preparing a schizophrenia diagnostic kit; the sequence of the fragment is as follows:
TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAACCGTCTAGGCGTGGGGAGAACGCAGGACGTGACCCACACACCGCACTGGAGGCTCCGCTCTGC。
further, the sites of methylation of the fragment sequence are CG at positions 83 and 84 and CG at positions 109 and 110 of the fragment sequence.
Further, the reagent for detecting the methylation of the fragment sequences is a reagent for sequencing;
and/or the reagent for detecting the methylation of the fragment sequences is a PCR reagent.
Furthermore, the reagent for detecting methylation of the fragment sequence is a reagent for pyrosequencing.
Further, the reagent for detecting the methylation of the sequence of the promoter fragment of the SHANK3 gene is a reagent for detecting the methylation of the sequence of the promoter fragment of the SHANK3 gene in human cortical interneurons;
and/or the reagent for detecting the methylation of the sequence of the promoter fragment of the SHANK3 gene is a reagent for detecting the methylation of the sequence of the promoter fragment of the SHANK3 gene in human peripheral mononuclear cells.
Further, the human cortical interneurons are cortical interneurons directionally induced by the human induced pluripotent stem cells.
Further, the human induced pluripotent stem cells are reprogrammed by human skin cells.
The invention also provides a schizophrenia diagnostic kit, which comprises a reagent for detecting the methylation of the promoter fragment sequence of the SHANK3 gene; the sequence of the fragment is as follows:
TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAACCGTCTAGGCGTGGGGAGAACGCAGGACGTGACCCACACACCGCACTGGAGGCTCCGCTCTGC；
preferably, the sites of methylation of the fragment sequence are the CG at positions 83 and 84 and the CG at positions 109 and 110 of the fragment sequence.
Further, the reagent for detecting the methylation of the fragment sequences is a reagent for sequencing;
and/or, the reagent for detecting the methylation of the fragment sequence is a PCR reagent;
preferably, the reagent for detecting methylation of the fragment sequence is a reagent for pyrosequencing.
Further, the reagent for detecting the methylation of the promoter fragment sequence of the SHANK3 gene is a reagent for detecting the methylation of the promoter fragment sequence of the SHANK3 gene in human cortical interneurons;
and/or the reagent for detecting the methylation of the sequence of the promoter fragment of the SHANK3 gene is a reagent for detecting the methylation of the sequence of the promoter fragment of the SHANK3 gene in human peripheral mononuclear cells;
preferably, the human cortical interneurons are cortical interneurons directionally induced by human induced pluripotent stem cells;
more preferably, the human induced pluripotent stem cells are reprogrammed from human skin cells.
The research of the invention finds that the segment sequence with the length of 144bp of the SHANK3 gene promoter can be used as a biomarker for diagnosing schizophrenia. Compared with healthy people, the methylation level of CG at 83 th and 84 th positions and CG at 109 th and 110 th positions of the fragment sequence of the schizophrenia patient is obviously increased. Therefore, the methylation detection reagent of the segment sequence with the length of 144bp of the SHANK3 gene promoter can be used for preparing a schizophrenia diagnosis kit, is used for early diagnosis of schizophrenia, and has good application prospect.
Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.
The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.
Drawings
FIG. 1 is a result of diagnosis of schizophrenia using the biomarkers of the present invention; wherein, a is the process of directional differentiation of cortical interneurons, b is the result of immunofluorescence staining of cortical interneurons of patients with Schizophrenia (SCZ) and normal control groups (HC), and c is the comparison of the methylation levels of CG (CG1) at positions 83 and 84 and CG (CG4) at positions 109 and 110 in promoter fragment sequences of the genes of the patients with Schizophrenia (SCZ) and the normal control groups (HC) SHANK 3.
Detailed Description
The raw materials and equipment used in the embodiment of the present invention are known products and obtained by purchasing commercially available products.
Example 1 diagnosis of schizophrenia Using biomarkers
1. The gene name: SHANK3
2. Fragment sequence (length 144bp, underlined two CGs are hypermethylated sites):
TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAACCGTCTAGGCGTGGGGAGAACGCAGGACGTGACCCACACACCGCACTGGAGGCTCCGCTCTGC(SEQ ID NO.1)
the hypermethylation sites are the CG at positions 83 and 84 and the CG at positions 109 and 110 of the fragment sequence, respectively.
3. Experimental methods
Induced pluripotent stem cells (iPSCs) from 5 schizophrenic patients and 4 normal controls were prepared and directed to induce cortical interneurons using reprogramming techniques. The significant increase of the methylation level of the gene fragment sequence in the schizophrenia patients compared with the normal control is verified in the neurons, and the increase of the methylation level of the fragment is proved to be a biological marker for schizophrenia diagnosis.
The specific method comprises the following steps:
a. cortical interneuron differentiation method: reference is made to Peiyan Ni, Haneul Noh, Zhuiching Shao, Qian Zhu, Youxin Guan, Joshua J.park, Fatima Arif, James M.park, Chiderah Abani, Cameron Beaudreault, Joy S.park, Elizabeth Berry, Alexander Moghadam, Patric Stanton, John N N.Hutchon, Biandrews, Clare Faux, John Parnevelas, Leonard M.Eisenberg, Kyunjook Park, Vadim Y.Bolshakov, Sangmi 201ung, Large-Scale Generation and Characterification of Hormogeneous powders of cell filtration, moisture of cell, gradient 430, Pluronic Stem City crack, moisture filtration of moisture, device of cell, device family of moisture, device family of cell, device family of moisture, moisture of cell, moisture of cell of the family of the genus of the family of the species of the family of the genus of the species of the family of the species of the family of the species of the genus of the family of the genus of the family of the genus of the family of the genus of the family.
i. Preparation of Induced pluripotent Stem cells (iPSCs)
Reprogramming is performed by conventional techniques from skin cells derived from the subject. The subjects (schizophrenic patients and normal controls) were all from Mclean Hospital, Harvard medical school, and the detailed information was referred to (Mol Psychiatry,2020,25(11): 2873-2888.) as part of the samples in the articles, namely ID 292, L5, L7 and L9 of HC group (normal control group) in article Figure 3a, and ID 58, 285, 483, 1442 and L8 of SCZ group (schizophrenic patients).
ii directional differentiation of cortical interneurons
Cortical interneurons are committed to differentiate as shown in FIG. 1 a.
(1) The prepared iPSCs were cultured in KSR medium (20% serum replacement, 2mM L-glutamine and 10. mu.M. beta. -mercaptoethanol in DMEM medium) at week 1, and then cultured with L (LDN193189,100nM), S (SB431542, 10. mu.M), Sg (SHH signaling pathway agonist SAG, 0.1. mu.M) and W (Wnt signaling pathway inhibitor IWP2, 5. mu.M), and 10. mu.M of ROCK inhibitor (Y-27632) was added on the day of differentiation. And obtaining the neurosphere after differentiation.
(2) KSR medium was supplemented with L (ldn193189,100nm) and Sg (SHH signaling pathway agonist SAG,0.1 μ M) at week 2; and the neurospheres are transferred to spinner conditions for culture (80rpm), and the obtained 3D embryoid bodies are uniform in size and stable in cell viability.
(3) Sg (0.1. mu.M) and FGF8(100ng/ml) were added at week 3 using N2 medium (2% N2 and 200. mu.M ascorbic acid in DF12 medium); after three weeks, neural precursor cells are obtained, and after optimized pancreatin (0.5% pancreatin, 2U/ml Turbo DNase, 1mM Trehalose) digestion, the neural precursor cells are inoculated on a glass slide, and after fixation, immunofluorescence staining is carried out to identify the proportion of Nkx2.1 and Nestin. Simultaneously, a one-week synchronization of Curtureone (1 ‰), DAPT (10. mu.M) and PD0332991 (2. mu.M) was initiated.
(4) After 4 weeks, medium was changed to B27 medium (2% B27 in DF12 medium) with 10ng/ml GDNF and 10ng/ml BDNF; cortical interneurons (cINs) were obtained after 8 weeks, digested with optimized pancreatin (0.5% pancreatin, 2U/ml Turbo DNAse, 1mM Trehalose), inoculated on slides, and fixed for immunofluorescence staining to identify the ratios of GAD, SOX6 and β -Tublin.
b. Phenotypic identification of cortical interneurons:
and (3) performing phenotype identification on the differentiated cortical interneurons of each subject by adopting an immunofluorescence staining method, wherein fig. 1b shows a typical staining result, and table 1 shows the specific expression amount of each marker of the differentiated cortical interneurons of the ipscs from each tested source. The conclusion was that there was no difference in phenotype between the schizophrenic patients and the normal controls, suggesting that the subsequent differences in methylation levels were not due to abnormal cellular phenotype.
TABLE 1 specific expression levels of each marker for iPSC differentiated cortical interneurons from each test source
c. The SHANK3 gene promoter has high methylation level in cortical interneuron
Extracting genome DNA of cortical interneurons of the subjects, and carrying out methylation sequencing on the fragment sequence (SEQ ID NO.1, 144bp) of the SHANK3 gene promoter by adopting a pyrosequencing method. As a result, the methylation level of two CG sites (CG at 83 th and 84 th positions and CG at 109 th and 110 th positions of the fragment sequence, respectively, underlined in the fragment sequence) in the fragment sequence of the schizophrenia patient is remarkably increased compared with that of the normal control, and the result is displayed as a histogram (FIG. 1c, CG at 83 th and 84 th positions is CG1, and CG at 109 th and 110 th positions is CG4 in FIG. 1 c).
Example 2 diagnosis of schizophrenia Using biomarkers
Except that the methylation level of the above-mentioned fragment sequence of the promoter of the SHANK3 gene was detected in the cortical interneuron of example 1; schizophrenia can also be diagnosed by detecting the methylation level of the sequence of the fragment of the SHANK3 gene promoter in peripheral mononuclear cells.
In conclusion, the research of the invention finds that the segment sequence with the length of 144bp of the SHANK3 gene promoter can be used as a biomarker for diagnosing schizophrenia. Compared with healthy people, the methylation level of CG at 83 th and 84 th positions and CG at 109 th and 110 th positions of the fragment sequence of the schizophrenia patient is obviously increased. Therefore, the methylation detection reagent of the segment sequence with the length of 144bp of the SHANK3 gene promoter can be used for preparing a schizophrenia diagnosis kit, is used for early diagnosis of schizophrenia, and has good application prospect.
SEQUENCE LISTING
<110> Sichuan university Hospital in western China
Application of <120> SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnosis kit
<130> GYKH1970-2021P0113328CCR4
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 144
<212> DNA
<213> Artificial sequence
<400> 1
tcagctgcac cactcaggcc aggccagtgg ccttgggagg ggcctgtgat gctgggacca 60
cagttcctgg gcagggagca accgtctagg cgtggggaga acgcaggacg tgacccacac 120
accgcactgg aggctccgct ctgc 144
Claims (6)
1. Detection ofSHANK3The application of the reagent for gene promoter fragment sequence methylation in the preparation of a schizophrenia diagnostic kit; the sequence of the fragment is as follows:
TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAACCGTCTAGGCGTGGGGAGAACGCAGGACGTGACCCACACACCGCACTGGAGGCTCCGCTCTGC, respectively; the sites of methylation of the fragment sequence are the CG at positions 83 and 84 and the CG at positions 109 and 110 of the fragment sequence.
2. Use according to claim 1, characterized in that: the reagent for detecting methylation of fragment sequences is a sequencing reagent.
3. Use according to claim 2, characterized in that: the reagent for detecting methylation of the fragment sequence is a reagent for pyrosequencing.
4. Use according to any one of claims 1 to 3, characterized in that: the detectionSHANK3The reagent for detecting methylation of gene promoter fragment sequence is used for detecting human cortical interneuronsSHANK3An agent for methylation of a gene promoter fragment sequence.
5. Use according to claim 4, characterized in that: the human cortical interneurons are cortical interneurons directionally induced by the human induced pluripotent stem cells.
6. Use according to claim 5, characterized in that: the human induced pluripotent stem cells are reprogrammed by human skin cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110808584.5A CN113667734B (en) | 2021-07-16 | 2021-07-16 | Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110808584.5A CN113667734B (en) | 2021-07-16 | 2021-07-16 | Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113667734A CN113667734A (en) | 2021-11-19 |
| CN113667734B true CN113667734B (en) | 2022-05-24 |
Family
ID=78539440
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110808584.5A Active CN113667734B (en) | 2021-07-16 | 2021-07-16 | Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113667734B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102918163A (en) * | 2009-09-08 | 2013-02-06 | 美国控股实验室公司 | Compositions and methods for diagnosing autism spectrum disorders |
| CN106061510A (en) * | 2013-12-12 | 2016-10-26 | 布罗德研究所有限公司 | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for genome editing |
| CN110714069A (en) * | 2019-11-21 | 2020-01-21 | 深圳市龙华区人民医院 | Application of PLEKHG5 gene methylation in asthenospermia diagnostic agent and kit |
| CN110791561A (en) * | 2019-11-21 | 2020-02-14 | 深圳市龙华区人民医院 | Application of CDR1 gene methylation in asthenospermia diagnostic agent and kit |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090307180A1 (en) * | 2008-03-19 | 2009-12-10 | Brandon Colby | Genetic analysis |
| HUE041411T2 (en) * | 2011-04-12 | 2019-05-28 | Verinata Health Inc | Resolving genome fractions using polymorphism counts |
| CN103602722B (en) * | 2013-07-25 | 2015-08-05 | 宁波大学 | Can be used for the test kit and the application thereof that detect the DRD3 gene methylation degree relevant to schizophrenia |
| US20180296537A1 (en) * | 2015-06-05 | 2018-10-18 | Novartis Ag | Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders |
| KR20180026743A (en) * | 2015-07-06 | 2018-03-13 | 세이지 테라퓨틱스, 인크. | Oxysterol and its use |
| KR20200026804A (en) * | 2017-05-18 | 2020-03-11 | 더 브로드 인스티튜트, 인코퍼레이티드 | Systems, Methods, and Compositions for Targeted Nucleic Acid Editing |
| WO2019005884A1 (en) * | 2017-06-26 | 2019-01-03 | The Broad Institute, Inc. | Crispr/cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing |
| CN111733229B (en) * | 2020-06-04 | 2022-09-30 | 四川大学华西医院 | Schizophrenia genetic risk typing kit and typing device |
-
2021
- 2021-07-16 CN CN202110808584.5A patent/CN113667734B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102918163A (en) * | 2009-09-08 | 2013-02-06 | 美国控股实验室公司 | Compositions and methods for diagnosing autism spectrum disorders |
| CN106061510A (en) * | 2013-12-12 | 2016-10-26 | 布罗德研究所有限公司 | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for genome editing |
| CN110714069A (en) * | 2019-11-21 | 2020-01-21 | 深圳市龙华区人民医院 | Application of PLEKHG5 gene methylation in asthenospermia diagnostic agent and kit |
| CN110791561A (en) * | 2019-11-21 | 2020-02-14 | 深圳市龙华区人民医院 | Application of CDR1 gene methylation in asthenospermia diagnostic agent and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113667734A (en) | 2021-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Thomsen et al. | Fixed single-cell transcriptomic characterization of human radial glial diversity | |
| Choi et al. | A comparison of genetically matched cell lines reveals the equivalence of human iPSCs and ESCs | |
| US20200377860A1 (en) | Three-dimensional differentiation of epiblast spheroids to kidney organoids models stage-specific epithelial physiology, morphogenesis, and disease | |
| US11279914B2 (en) | Assembly of functionally integrated human forebrain spheroids and methods of use thereof | |
| CN108291206A (en) | The purifying based on MACS of the retinal pigment epithelium of source of human stem cell | |
| Palpant et al. | Chromatin and transcriptional analysis of mesoderm progenitor cells identifies HOPX as a regulator of primitive hematopoiesis | |
| Van den Hurk et al. | Patch-seq protocol to analyze the electrophysiology, morphology and transcriptome of whole single neurons derived from human pluripotent stem cells | |
| EP2494032A1 (en) | Generating induced pluripotent stem cells and progenitor cells from fibroblasts | |
| CN106350521B (en) | A kind of preparation method of the patient-specific motor neuron of ALS | |
| Hathy et al. | Investigation of de novo mutations in a schizophrenia case-parent trio by induced pluripotent stem cell-based in vitro disease modeling: convergence of schizophrenia-and autism-related cellular phenotypes | |
| JP2022177161A (en) | Ready-to-use cryopreserved cells | |
| Pan et al. | A new FACS approach isolates hESC derived endoderm using transcription factors | |
| CN113667734B (en) | Application of SHANK3 fragment sequence methylation detection reagent in preparation of schizophrenia diagnostic kit | |
| CN113528576A (en) | Recurrent grapevine patient specific induced pluripotent stem cell line containing NLRP7 pure and mutant and construction method thereof | |
| CN115210365A (en) | Application of pluripotent marker in detection of contaminated residual undifferentiated pluripotent stem cells | |
| CN111909985A (en) | Kit for detecting leukemia minimal residual disease gene by adopting loop-mediated isothermal amplification method | |
| Feldman et al. | CRISPR-Cas9 Screens Reveal Genes Regulating a G0-like State in Human Neural Progenitors | |
| CN112011510A (en) | Method for preparing dopamine neuron by human pluripotent stem cell | |
| EP4219685A1 (en) | In vitro generation of organized 3d cell structures including head-trunk embryo-like structures, using epigenetic remodeling factors - microfluidic platform suitable for their generation | |
| Tang et al. | Wnt Signaling Promotes Cell Caudalization And Inner Ear Differentiation in Mouse Stem Cell-Derived Organoids | |
| CN116024330B (en) | Application of miR-137-3p in thin endometrium | |
| Owen et al. | Characterization of an eye field-like state during optic vesicle organoid development | |
| Pham et al. | Transcriptional network governing extraembryonic endoderm cell fate choice | |
| Rosen et al. | Parallel genome-scale CRISPR screens distinguish pluripotency and self-renewal | |
| Salerno et al. | Identification of molecular signatures in neural differentiation and neurological diseases using digital color-coded molecular barcoding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |