CN103555740B - The one degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application - Google Patents
The one degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application Download PDFInfo
- Publication number
- CN103555740B CN103555740B CN201310511236.7A CN201310511236A CN103555740B CN 103555740 B CN103555740 B CN 103555740B CN 201310511236 A CN201310511236 A CN 201310511236A CN 103555740 B CN103555740 B CN 103555740B
- Authority
- CN
- China
- Prior art keywords
- gene
- wheat
- cbl
- cipk
- degeneration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to a degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application.The chip of expression spectrum information that the present invention coerces according to wheat salt, drought, select in root and leaf, express the obvious protein kinase gene being subject to salt and drought induction, and cloned its cDNA sequence containing full length coding region, nucleotide sequence is as shown in SEQ ID NO.1.Analysis shows, this genes encoding CBL-CIPK class serine/threonine protein kitase, aminoacid sequence, as shown in SEQ ID NO.2, is named as TaCIPK33.Shown by transgenosis functional analysis, this gene has the function improving plant salt endurance and drought resistance.This provides the foundation for deeply understanding wheat response molecule mechanism that is arid, salt stress, and this gene can be applicable to the genetic improvement of the degeneration-resistant new germ plasm of the crops such as wheat simultaneously.
Description
Technical field
The present invention relates to a degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application, belong to Protocols in Molecular Biology and gene engineering technology field.
Background technology
Wheat is the main food of about 35% world population.The adverse circumstances such as arid, salinification are the important environmental factorss of restriction yield and quality of wheat, and easily cause infecting disease and pest, cause larger financial loss.But wheat cannot escape adverse circumstance environment, therefore, clone's drought resisting, resistant gene of salt, study the molecular mechanism of its drought resisting, salt tolerant, cultivates drought resistance and salt tolerance new variety and have great theory and practice meaning.
Serine/threonine protein kitase involved in plant, to the responsing reaction of different adverse circumstance, can play a role in raising stress resistance of plant.The function that serine/threonine protein kitase has " central processing unit (CPU) ", receive the input information such as the such as plant hormone that passes over from acceptor or other extraneous factors, change into suitable output information, as the change of the aspects such as metabolism, genetic expression, Growth of Cells and division.
According to the similarity of serine/threonine protein kitase catalytic domain, be divided into: Calcium-dependent protein kinase (CDPK) subfamily, SNF1 related protein kinase (SnRK) subfamily, receptoroid kinases (RLKs) subfamily, MAPK/MAPKK/MAPKKK subfamily, cyclin dependent kinase (CDK) subfamily, GSK3/SHAGGY subfamily etc.Various environment stress acts on vegetable cell, first Ca in trigger cell
2+the change of concentration.Ca2+ oscillations is by various calcium ion susceptor perception in cell and transmit Ca2+ oscillations, has two class Ca in plant
2+dependent form susceptor, a class is calmodulin (CaM), and another kind of is the distinctive calcium adjusting phosphatase B analogy albumen of plant (CBL).CBL susceptor and protein kinase C IPK(CBL-Interacting Protein Kinases) interacting forms Ca
2+-CBL-CIPK complex body, CBL-CIPK complex body is activated, and the CBL-CIPK complex phosphorylates being in state of activation modifies downstream object target protein, the Ca2+ oscillations of various dynamic change of decoding, the physiological process that regulation and control are relevant.CIPK is considered to belong to one of the large subtribe of plant snf 1-related protein kinase family three SnRK3 subtribe.
Current discovery, there are 26 CIPKs family members in Arabidopis thaliana, paddy rice CIPKs family member has 30.Plant SOS signal transduction under CBL-CIPK signal pathway wide participation plant high-salt stress.Plant under salt stress, Ca in cell
2+concentration increases, the Ca on cytolemma
2+susceptor SOS3/CBL4 is in conjunction with Ca
2+and acting on kinases SOS2/CIPK24, SOS3-SOS2 complex body is activated and phosphorylation cytolemma Na
+/ H
+counter transport carrier S OS1, improves Na
+/ H
+antiport ability, by Na excessive in cell
+discharge to maintain Na in cell
+balance.Potassium (K in plant growth and development process
+) play an important role.Plant is to K
+absorption and transhipment mainly pass through K
+transporter.CBL-CIPK signal transduction system plays an important role in the response of regulating plant low potassium stress.In Arabidopis thaliana, CIPK23 and CBL1 or CBL9 interacts, the K of phosphorylate downstream
+passage AKT1, activates K
+transhipment.CBL1 and CBL9 can also interact with CIPK6, CIPK16, transmits low potassium signal, regulation and control AKT1.CBL-CIPK also participates in the signal transduction relying on ABA and non-dependent ABA.CBL1 afunction mutant cbl1 to arid, to damage to plants caused by sudden drop in temperature and the susceptibility of the multiple abiotic stress such as salt stress does not rely on ABA, with the CBL9 afunction mutant cbl9 of CBL1 very high homology, the susceptibility of abiotic stress is then highly relied on ABA.In addition, except the response of mediated plant environment to external world, CBL-CIPK system is other physiological process of the involved in plant development process of being correlated with and regulating plant also.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, a degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application are provided.
Summary of the invention
The present invention according to early stage wheat salt, drought coerces the chip of expression spectrum information of acquisition, select to express the protein kinase gene (probe) obviously by salt and drought induction in root and leaf, and cloned its cDNA sequence containing full length coding region, nucleotide sequence is as shown in SEQ ID NO.1.Analysis shows, this genes encoding CBL-CIPK class serine/threonine protein kitase, aminoacid sequence, as shown in SEQ ID NO.2, is named as TaCIPK33.Shown by transgenosis functional analysis, this gene has the function improving plant salt endurance and drought resistance.This provides the foundation for deeply understanding wheat response molecule mechanism that is arid, salt stress, and this gene can be applicable to the genetic improvement of the degeneration-resistant new germ plasm of the crops such as wheat simultaneously.
Detailed Description Of The Invention
The encoding gene TaCIPK33 of the degeneration-resistant regulatory factor of one grow wheat CBL-CIPK class, nucleotide sequence is as shown in SEQ ID No.1.Encoding gene TaCIPK33 sequence 1463 bases of the degeneration-resistant regulatory factor of wheat CBL-CIPK class, there are 1332 bases coding region.
The degeneration-resistant regulatory factor of above-mentioned wheat CBL-CIPK class, aminoacid sequence is as shown in SEQ ID No.2.The described degeneration-resistant regulatory factor of wheat CBL-CIPK class is made up of 443 amino-acid residues.
A kind of recombinant vectors inserting nucleotide sequence shown in above-mentioned SEQ ID No.1.
A kind of transgenic cell line, containing above-mentioned recombinant vectors.
A kind of transfer-gen plant, containing above-mentioned recombinant vectors.
The encoding gene TaCIPK33 of the degeneration-resistant regulatory factor of above-mentioned wheat CBL-CIPK class, recombinant vectors, transgenic cell line or transfer-gen plant are cultivating the application in salt tolerant, drought-resistant plant.
Preferred according to the present invention, described plant is wheat or tobacco.
Beneficial effect
The present invention has been cloned into wheat TaCIPK33 gene first, this genes encoding CBL-CIPK class serine/threonine protein kitase, and demonstrates by transgenosis functional analysis the function that described gene has raising plant salt endurance and drought resistance.This gene is proceeded to overexpression in tobacco by the approach that the present invention is mediated by agrobacterium tumefaciens, and compared with wild-type tobacco plants, the transgene tobacco Progeny plants containing TaCIPK33 gene of the present invention has more obvious salt tolerant, drought-resistant ability.Gene of the present invention can be the degeneration-resistant new variety of crop such as cultivating wheat and provides theoretical foundation and genetic resources.
Accompanying drawing explanation
Fig. 1, pcr amplification electrophoresis result photo for TaCIPK33 full length gene cDNA sequence;
Wherein: M, DNA molecular amount standard Marker(Trans2k plus), 1, negative control, 2, PCR primer;
After Fig. 2, NaCl, PEG Stress treatment, TaCIPK33 gene melts the electrophoresis result photo that the RT-PCR in No. 3 seedling roots and leaf analyzes on wheat mountain;
Wherein: Actin is internal reference; Leaf is leaf; Root is root;
The expression of TaCIPK33 gene under 200mM NaCl Stress treatment in A, root;
The expression of TaCIPK33 gene under volumetric concentration is 18%PEG6000 Stress treatment in B, root;
The expression of TaCIPK33 gene under 200mM NaCl Stress treatment in C, leaf;
The expression of TaCIPK33 under volumetric concentration is 18%PEG6000 Stress treatment in D, leaf;
The digestion verification electrophoresis result photo of the plant expression vector pROK II-TaCIPK33 of Fig. 3, structure;
Wherein: M, DNA molecular amount standard Marker(Trans2k plus), 1, pROKII plasmid, 2, the BamH I of pROK II-TaCIPK33 and KpnI double digestion result;
The regenerative process photo of Fig. 4, TaCIPK33 transgene tobacco;
Wherein: the induction in inducing culture of A, kalamycin resistance bud and screening, B, kalamycin resistance bud grow in screening culture medium; C, transgenic tobacco plant are at greenhouse normal growth;
The PCR of Fig. 5, transgene tobacco identifies electrophoresis result photo;
Wherein: M, DNA molecular amount standard Marker(Trans2k plus), 1-11, transfer-gen plant, 12, positive control, 13, water contrast, 14, Wild-type non-transgenic tobacco plant;
The phenotypic evaluation photo of Fig. 6, transgene tobacco strain;
Wherein: A, vertical cultivation two weeks long growing states of seedling root on the MS substratum containing 100mM NaCl;
B, on the substratum containing 100mM N.F,USP MANNITOL, vertically cultivate two weeks long growing states of seedling root;
In A, B figure, upper left is the wild strain WT of contrast, and upper right is transgenic line S/T-8, and lower-left is transgenic line S/T-9, and bottom right is transgenic line S/T-10;
C, on the MS substratum containing 100mM NaCl seed germination situation;
D, on the MS substratum containing 100mM N.F,USP MANNITOL seed germination situation;
In C, D figure, top is the wild strain WT of contrast, and below is transgenic line S/T-10.
Embodiment
Below in conjunction with specification drawings and specific embodiments, technical scheme of the present invention is described further, but institute of the present invention protection domain is not limited thereto.
Biological material source
Bacillus coli DH 5 alpha, Beijing Quanshijin Biotechnology Co., Ltd is on sale;
Agrobacterium LBA4404, Invitrogen company is on sale;
Plant expression vector pROK II, Biovector China plasmid vector strain gene storehouse is on sale;
Wheat mountain melts No. 3, and Lu Nong examines No. [2004] 030, word, common commercially available prod;
In following examples if no special instructions, the method for use is this area ordinary method, and substratum is this area conventional medium.
The clone of embodiment 1TaCIPK33 gene cDNA sequence
The clone of TaCIPK33 full length gene cDNA sequence and sequencing
1. primer sequence
According to SSH and the chip of expression spectrum data results design gene-specific primer of wheat, the masterplate being amplifying target genes with wheat seedlings blade cDNA Article 1 chain, the full-length cDNA of amplification gene, primer sequence is:
TaCIPK-S：5′CGACCTACCTCCTACCCTC3′，SEQ ID NO.3
TaCIPK–A：5′GCAAGATAGTTCCATTCCG3′。SEQ ID NO.4
2.PCR reaction system (20 μ l)
Add 10 × PCR damping fluid successively (containing Mg
2+) 2.0 μ L, 2.5mM dNTP1.6 μ L, reverse transcription cDNA first chain product 1 μ L, forward primer (TaCIPK-S) 0.5 μ L, reverse primer (TaCIPK-A) 0.5 μ L, 5U/ μ L Taq archaeal dna polymerase 0.2 μ L, add water to 20 μ L.
3.PCR response procedures is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30Sec, 62 DEG C of renaturation 30Sec, 72 DEG C extend 1min, 30cycles; 72 DEG C extend 10min, 4 DEG C of preservations.
4.1wt% agarose gel electrophoresis
Pcr amplification product 1wt% agarose gel electrophoresis detects, and finds the band having an entry at 1463bp place, as shown in Figure 1.
5. the recovery of the object fragment of increasing, be cloned into pMD18-T carrier
After adopting 1wt% agarose gel electrophoresis to amplified fragments, use TIANgel Midi Purification kit test kit to reclaim goal gene fragment and PCR primer, concrete operation step carries out according to test kit specification sheets.PCR primer is connected with TaKaRa company pMD18-T carrier, and obtain and connect product, linked system is:
1uL pMD18-T Vector, 4uL PCR primer, 5uL Ligation Mix;
Condition is 16 DEG C and connects 30 minutes.
6. reclaim the choning and sequencing of fragment
By in the connection product conversion bacillus coli DH 5 alpha competent cell of full dose, picking white bacterial plaque shakes bacterium in 37 DEG C, extracts the plasmid having inserted gene fragment.
(1) double digestion detection validation: with Hind III and the EcoR I endonuclease digestion of TaKaRa company, operate as follows: enzyme cuts system 20 μ L, comprise 2 μ L damping fluids, 14 μ L have inserted the plasmid of gene fragment, 1 μ L HindIII restriction endonuclease, 1 μ LEcoRI restriction endonuclease, moisturizing 2 μ L.In 37 DEG C of water-baths 4 hours, electrophoresis detection enzyme cut result.
(2) send order-checking company to check order the bacterium liquid of the positive colony of connection carrier, guarantee correct, sequencing result as shown in SEQ IDNo.1, by 1463 based compositions, called after TaCIPK33.
The expression analysis of embodiment 2 gene
The expression analysis of TaCIPK33 gene under NaCl, PEG Stress treatment condition
1. material processing
Choose full wheat mountain and melt No. 3 seeds, normally sprout.
Select grow to two leaves wholeheartedly, unanimous on the whole, the healthy and strong mountain of situation melts No. 3 wheats and carries out following Stress treatment: 200mMNaCl recovers 48h after steeping root process 48h; Concentration expressed in percentage by volume is recover 48h after 18%PEG6000 solution leaching root process 48h, contrasts as healthy plant under normal condition.Respectively in 0h, 0.5h, 1h, 3h, 6h, 12h, 24h, 48h, recovery 24h and recovery 48h sampling ,-70 DEG C of preservations.Get root and leaf that the Stress treatment different time points of No. 3 wheat plants is melted on mountain, Trizol method extracts wheat total serum IgE.
2.Trizol method extracts wheat total serum IgE
The seedling leaves of No. 3 10 days seedling ages is melted for material with wheat mountain
(1) organization material is put into the mortar of Liquid nitrogen precooler, abundant grind into powder in liquid nitrogen, powder is loaded in 1.5mL centrifuge tube, every 100mg material adds rapidly the TRIzol extracting solution of the Invitrogen company of 1ml, concuss 15 seconds, mixing sample, make the abundant cracking of sample, room temperature places 5 minutes;
(2) 100uL2M sodium-acetate (PH4.0) is added, incubation 2-3 minute;
(3) 0.2ml chloroform (chloroform) is added, thermal agitation 15 seconds, incubation 2-3 minute;
(4) 4 DEG C, centrifugal 15 minutes of 12000rpm, gets supernatant liquor and moves in new 1.5mL centrifuge tube;
(5) add 800 μ L chloroforms, acutely rocked for 15 seconds with hand, incubation 2-3 minute;
(6) 4 DEG C, centrifugal 15 minutes of 12000rpm, gets supernatant liquor and moves in new 1.5mL centrifuge tube;
(7) add 500 μ L Virahols, put upside down mixing, room temperature leaves standstill 10 minutes;
(8) 4 DEG C, centrifugal 10 minutes of 12000rpm, absorbs supernatant liquor;
(9) volume percent adding 1m L precooling is the ethanolic soln of 75%, and spiral shakes.4 DEG C, centrifugal 5 minutes of 7500rpm, abandons supernatant, collecting precipitation;
(10) the ethanolic soln washing RNA repeated with volume percent is 75% precipitates once;
(11) supernatant is removed, RNA is deposited on aseptic operating platform and dries about 10-15 minute, RNA shows slightly transparent, and (or volume percent is preserve (put in-80 DEG C of refrigerators and save backup) in the ethanolic soln of 75% to add appropriate DEPC water (being generally 20 μ L) dissolution precipitation;
(12) get 1 μ L RNA sample, 1wt% agarose gel electrophoresis detects, imaging in ultraviolet gel imaging system, and whether qualification RNA degrades and rough concentration.
3. the synthesis of the first chain cDNA
Adopt the RevertAid First Strand cDNA Synthesis Kit test kit of Fermentas company to carry out, reactions steps is as follows:
First, mRNA reverse transcription is become the first chain cDNA, ThermoScript II used is the RevertAid FirstStrand cDNA Synthesis Kit of Fermentas company, and reaction system is 20 μ L.Add 1 μ L oligo (dT) successively
18primer(100uM), 1 μ g Total RNA and DEPC water to 10 μ L, 65 DEG C of water-bath sex change 5min, chilling on ice, slightly centrifugal; Then 1 μ L RNase Inhabitor (20U/uL) is added successively, 4 μ L5x Reaction Buffer, 2 μ L dNTP Mixture(10mM) 1 μ LM-MuLV ReverseTranscriptase (200U/uL), 4 μ L RNase Free ddH
2o, mixing;
Then in PCR instrument according to " 42 DEG C, 60min; 70 DEG C, 5min; 4 DEG C, preserve " program run; Reverse transcription obtains the Article 1 chain of wheat cDNA, in-20 DEG C of preservations.
4.PCR reaction system
Melting No. 3 wheat cDNA with mountain is template, using TaActin-S and TaActin-A as amplimer, obtains the actin internal reference product fragment of about 558bp.The cycle number of PCR is determined, the masterplate amount of adjustment cDNA according to the amplification situation of internal reference Actin.
(1) internal reference Actin primer sequence:
TaActin-S5′AGCCATACCGTGCCAATC3′
TaActin-A5′AGAGCCTCCAATCCAGAC3′
(2) reaction system is as follows: TaqMix10uL, template x uL, TaActin-S0.5, TaActin-A0.5, and moisturizing is to total system 20 μ L.
(3) PCR response procedures: 94 DEG C of 5min; 94 DEG C of 30Sec, 58 DEG C of 30Sec, 72 DEG C of 1min, 30cycles; 72 DEG C of 10min; 4 DEG C of preservations.
1wt% agarose gel electrophoresis detects expression analysis, and result as shown in Figure 2.
The structure of the overexpression plant expression vector of embodiment 3CaMV35S promoters driven
Plant expression vector pROK II is the binary vector containing CaMV35S promotor and NPTII gene, containing restriction enzyme BamH I and Kpn I site in its multiple clone site.According to the cDNA coding region sequence of gene TaCIPK33, design packet is containing the gene-specific primer of complete ORF, and primer sequence: TaCIPK-S1 adds BamH I(GGATCC) site, TaCIPK-A1 adds Kpn I(GGTACC) site,
TaCIPK-S15′CGC
GGATCCCGACCTACCTCCTACCCTC3′，SEQ ID NO.5
TaCIPK-A15′CGG
GGTACCGCAAGATAGTTCCATTCCG3′，SEQ ID NO.6
By this cDNA sequence to primer amplification gene, amplify the gene fragment of 1463bp, and be cloned on the pMD18-T carrier of TaKaRa company.Then with restriction enzyme BamH I and Kpn I double digestion empty carrier pROK II and the pMD18-T carrier carrying goal gene fragment respectively, reclaim carrier large fragment and TaCIPK33 gene fragment respectively, 16 DEG C of connections of spending the night, obtain recombinant plasmid plant expression vector pROK II-TaCIPK33.
(1) empty carrier pROK II and the T-carrier B amH I restriction endonuclease and the Kpn I enzymes double zyme cutting that carry goal gene fragment
Endonuclease reaction system (20 μ L):
BamH I restriction endonuclease 1 μ L
Kpn I restriction endonuclease 1 μ L
Empty carrier pROK II
(or goal gene fragment) 5 μ L
10×Buffer 2μL
Mend ddH
2o to 20 μ L,
37 DEG C of thermostat water bath incubations 2 hours;
(2) digestion products electrophoresis and recovery
After double digestion has reacted, digestion products is carried out 0.8wt% agarose gel electrophoresis, sepharose test kit reclaims carrier large fragment and TaCIPK gene fragment;
(3) connect
Carrier large fragment and goal gene fragment through double digestion is carried out 16 DEG C according to the ratio of volume ratio 1:4 spend the night and be connected, reaction system following (25 μ L): TaCIPK gene fragment 10 μ L, pROK II carrier large fragment 4 μ L, 10 × T
4dNA Ligasebuffer2.5 μ L, T
4dNA Ligase1 μ L, moisturizing to 25 μ L; 16 DEG C of connections are spent the night;
(4) transform
To connect product by heat shock method transformation of E. coli DH5 α competent cell, transformed bacteria to drop on the LB solid plate containing Kan50 μ g/ml 37 DEG C and cultivates 16 hours;
(5) enzyme of positive recombinant cuts qualification
Picking white bacterial plaque shakes bacterium in 37 DEG C, extract plasmid, BamH I restriction endonuclease and Kpn enzymes double zyme cutting detection validation, endonuclease reaction system is with (1) step in embodiment 3, digestion products is through 0.8wt% agarose gel electrophoresis, goal gene band and the carrier segments band of suitable size detected, illustrate that TaCIPK gene has successfully been connected to pROK II carrier, obtained recombinant expression vector plasmid DNA.Result as shown in Figure 3.The recombinant vectors connected is checked order, guarantees correct.
The competent preparation of embodiment 4 Agrobacterium and conversion
1. the preparation of Agrobacterium competent cell
(1) from picking Agrobacterium LBA4404 list bacterium colony YEP flat board (containing 50 μ g/ml Rifampins), be inoculated in the YEP liquid nutrient medium containing 50 μ g/ml Rifampins, 200rpm, overnight incubation at 28 DEG C;
(2) get 2ml incubated overnight liquid and be inoculated in 50ml containing in identical antibiotic YEP liquid nutrient medium, under the same terms, be cultured to OD
600to 0.5;
(3) bacterium liquid ice bath 30min, 4 DEG C, the centrifugal 10min of 5000rpm, collects thalline;
(4) thalline is resuspended in the NaCl of the 10ml0.15mol/L of ice bath, 4 DEG C of centrifugal 10min of 5000rpm, collects thalline;
(5) bacterium liquid Eddy diffusion is in the CaCl of 1ml20mmol/L ice precooling
2in solution, be divided in 1.5ml Eppendorf pipe by bacterium liquid with every pipe 200 μ L, liquid nitrogen flash freezer 1min ,-70 DEG C save backup.
2. freeze-thaw method transformation Agrobacterium LBA4404
(1) thawed on ice Agrobacterium competent cell, adds 1 μ g recombinant expression vector plasmid DNA, ice bath 30min after mixing;
(2) liquid nitrogen flash freezer 1min, moves to rapidly 37 DEG C of insulation 3min;
(3) add the liquid YEP800 μ L of antibiotic-free, 4hr is cultivated in 28 DEG C of concussions;
(4) the centrifugal 30s of 7000rpm, collects thalline, is applied on the YEP flat board containing 50 μ g/ml Rifampins, 50 μ g/ml Kan, is inverted light culture 2 ~ 3 days for 28 DEG C.
3. positive bacterium colony PCR identifies
Bacterium colony PCR the primer is with embodiment 1, and method and program are with the step 2 in embodiment 1.
Embodiment 5 transgenosis functional verification----Transformation of tobacco, screening and phenotype analytical
1. leaf disc transformation method transformation of tobacco
(1) tobacco seed is the ethanolic soln sterilization 1min of 75% in volume percent, aseptic water washing 3 ~ 5 times; Clorox and water are diluted with the mass ratio of 1:4, to seed disinfection 10min, aseptic water washing 5 times, uniform spreading spills in 1/2MS
0on minimum medium, it is made to germinate.
(2) after seed germination (about two weeks), transferred to (containing 1/2MS) in independent bottle, grow 4 ~ 5 weeks, plant to be planted grows enough leaves for conversion.
(3) picking Agrobacterium (carrying the single bacterium colony of Agrobacterium of recombinant expression vector plasmid) is inoculated in containing 50 μ g/ml kantlex, and in the YEP liquid nutrient medium of 50 μ g/ml Rifampins, 28 DEG C, 200rpm shaking culture is about 24h, to logarithmic phase.
(4) by the centrifugal 6min of bacterium liquid 6000rpm, thalline is collected, MS
0liquid nutrient medium is resuspended.
(5) get tobacco leaf, be cut into small pieces (0.5 × 0.5cm), and the tobacco leaf sheared is put in 1.5min in resuspended bacterium liquid, continuous vibration, uses aseptic filter paper suck dry moisture after taking out, it is neatly closely arranged on MS division culture medium, 28 DEG C, light culture 2d.
(6) light culture two days later, is arranged in by blade loosely on MS Selective agar medium, 28 DEG C, light application time 16h/d, changed a subculture every two weeks.
(7) when it grows Multiple Buds, cut and put in elongation medium, make it extend.
(8) when Multiple Buds grows to 3 ~ 5cm, transfer to root media, short its is taken root.
(9) after root system development is good, seedling is washed root immigration and fill in the flowerpot of sterile soil, lid mulch film 3d.
(10) cultivate under light, grow to and to a certain degree move on in large basin, greenhouse Routine Management, results T
0for seed.Result as shown in Figure 4.
2. the screening of transgene tobacco positive plant
T
0after seed 7.5wt% chlorine bleach liquor (comprising 7.5wt% clorox and 0.01wt%Triton-X100) sterilization, sowing is on MS Selective agar medium (50mg/L kantlex), cultivate 10 days in culturing room, select kalamycin resistance plant and (grow true leaf 1-2 couple, root is stretched in substratum) and be transplanted in nutrition pot, cultivate until seed maturity, adopt the screening T that uses the same method
1t is obtained for seed
2for plant, and at T
1strain is inserted, at T than the list copy for 3:1 for selecting resistance in plant
2the homozygous lines of generation selection resistant part, that is: isozygoty T
2for strain, will isozygoty T
2molecular Detection and the phenotypic evaluation of transgene tobacco is carried out for strain.
The acquisition of the homozygous lines that single copy inserts is this area conventional steps: by the T of results
1for planting seed on the MS substratum being added with kantlex, meeting albefaction, death after non-transgenic seed germination, transgenic seed is normal green seedling after sprouting, by card side (x
2) test, calculate the ratio of green seedling and the dead seedling of albefaction, be inserted in acceptor tobacco if foreign gene is single copy, the ratio of so green seedling and the dead seedling of albefaction is exactly 3:1, the i.e. transgenic line of single copy insertion, otherwise be not just satisfactory transgenic progeny (namely meeting mendelian inheritance).The seed of the transgenic line that the single copy of results inserts, continues to screen on the MS substratum being added with kantlex, be completely green seedling be homozygote, the T namely isozygotied
2for strain.Transgenosis T
3for strain for the selfing of single copy homozygous lines is gone down to posterity acquisition.
3. the PCR qualification of transgene tobacco
(1) CTAB method extracts tobacco leaf genomic dna
1. get the fresh blade of about 100mg, put into 1.5ml centrifuge tube, liquid nitrogen flash freezer, grinding, adds 2 × CTAB Extraction buffer that 600 μ L are preheated to 65 DEG C, mixing of turning upside down, and is placed in 65 DEG C of water-baths and leaves standstill 30min; Continuous jog, makes CTAB extracting solution and vegetable material fully mix therebetween;
2. mixture adds isopyknic phenol/chloroform/primary isoamyl alcohol after being chilled to room temperature, mixing, and room temperature leaves standstill 15min, 4 DEG C, the centrifugal 10min of 12000rpm;
3. get supernatant, add isopyknic chloroform/primary isoamyl alcohol, mixing, 4 DEG C, the centrifugal 10min of 12000rpm;
4. get supernatant, add the 3mol/L NaAc(pH5.3 of 1/10 volume) and the Virahol of 0.7 times of volume, mixing, room temperature leaves standstill 15min, 4 DEG C, the centrifugal 15min of 12000rpm, precipitation DNA;
5. 75% ethanol washes precipitation twice.Abandon supernatant, dry several minutes of super clean bench
6. precipitation is dissolved in appropriate TE damping fluid, in-20 DEG C of preservations.
(2) pcr amplification of transgene tobacco
With the tobacco gene group DNA of said extracted for template, carry out pcr amplification with gene-specific primer (with embodiment 1).
PCR reaction system is with the step 2 in embodiment 1, and PCR response procedures is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30Sec, 62 DEG C of renaturation 30Sec, 72 DEG C extend 1min, 30cycles; 72 DEG C extend 10min, 4 DEG C of preservations.PCR primer detects the object band amplifying about 1463bp in transgenic tobacco plant through 1.0% agarose gel electrophoresis, in the plant turning empty carrier and aqua sterilisa be that negative control has no amplified band, result is as shown in Figure 5.
4. the phenotypic evaluation of transgene tobacco
(1) plantation of tobacco
T
3in generation, single seed 7.5wt% chlorine bleach liquor (comprising 7.5wt% clorox and 0.01wt%Triton-X100) copying the tobacco line that isozygotys sterilized 10 minutes, then rinsed with sterile water is used 5 ~ 6 times, point is sowed on MS flat board, then be transplanted to (Nutrition Soil mixes by equal proportion with vermiculite) in nutrition pot, 25 DEG C of cultivations.
(2) NaCl and drought stress process
The long statistics of root
The sprouting tobacco seedling of 2 days (contrast WT and transgenic line S/T-8, S/T-9, S/T-10) is carefully moved in the MS culture dish containing 100mMNaCl, 100mM N.F,USP MANNITOL, statistics root length is observed in vertical cultivation for two weeks, and result shows the root of the tobacco plant the turning TaCIPK33 gene aobvious root than Wild type control plants kept burning day and night long (as shown in Fig. 6 A, 6B).
Germination rate is added up
Use hypochlorite disinfectant after 10 minutes transgenic progeny tobacco seed (S/T-10) and wild-type tobacco seed (WT), rinsed with sterile water 5 times, select and be sowed at respectively containing in the MS culture dish of 100mM NaCl, 100mM N.F,USP MANNITOL, after cultivating two weeks, add up the germination rate of seed respectively, found that the seed germination rate that the turns TaCIPK33 genetic tobacco offspring germination rate (as shown in Fig. 6 C, 6D) higher than wild type seeds.
Interpretation of result
Can be drawn by above-mentioned experimental result, gene TaCIPK33 coding CBL-CIPK class serine/threonine protein kitase described in the application, involved in plant is to the response of arid, high salt adverse circumstance.After this gene TaCIPK33 overexpression, transfer-gen plant can produce the characteristic of salt-tolerant drought-resistant.
Claims (1)
1. the encoding gene of the degeneration-resistant regulatory factor of a grow wheat CBL-CIPK class
taCIPK33 are cultivating the application in salt tolerant, Drought resistant Wheat or tobacco, described encoding gene
taCIPK33 nucleotide sequences are as shown in SEQ ID No.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310511236.7A CN103555740B (en) | 2013-10-25 | 2013-10-25 | The one degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310511236.7A CN103555740B (en) | 2013-10-25 | 2013-10-25 | The one degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103555740A CN103555740A (en) | 2014-02-05 |
| CN103555740B true CN103555740B (en) | 2015-09-02 |
Family
ID=50010088
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310511236.7A Expired - Fee Related CN103555740B (en) | 2013-10-25 | 2013-10-25 | The one degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103555740B (en) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104911159B (en) * | 2014-03-12 | 2018-03-13 | 中国农业科学院作物科学研究所 | Plant stress tolerance correlative protein TaWPK and its encoding gene and application |
| CN104059929B (en) * | 2014-04-28 | 2019-12-06 | 中国农业科学院作物科学研究所 | Application of maize CIPK21 gene in improving plant stress resistance |
| CN106279384B (en) * | 2015-05-14 | 2019-05-28 | 中国科学院植物研究所 | AtCIPK23 gene is improving the application in the resistance to low iron ability of plant |
| CN105713909B (en) * | 2015-12-22 | 2019-06-18 | 河南农业大学 | Wheat cdna TaFUS3 and its application |
| CN108795913B (en) * | 2018-05-04 | 2021-07-02 | 山西大学 | Plant medium-energy catalytic H2S-producing enzymes and uses thereof |
| CN108588117B (en) * | 2018-05-11 | 2021-07-30 | 兰州大学 | Application of Qinghai-Tibet plateau wild barley HsCIPK17 in improving abiotic stress resistance of rice |
| CN112501146B (en) * | 2020-12-10 | 2022-04-01 | 沈阳农业大学 | Application of OsCIPK9 protein and coding gene thereof in improving rice sheath blight resistance |
| CN114656532B (en) * | 2020-12-22 | 2023-08-18 | 中国农业大学 | Application of CBL9 and coding gene thereof in regulation and control of saline-alkali tolerance of plants |
| CN112813083B (en) * | 2021-02-24 | 2022-04-12 | 沈阳农业大学 | Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance |
| CN112980874B (en) * | 2021-04-09 | 2022-08-23 | 华中农业大学 | Application of GhCIPK6D1 gene in improving drought resistance of cotton |
| CN114875062B (en) * | 2022-06-15 | 2023-02-07 | 西北农林科技大学 | Method for improving wheat scab resistance through genome editing |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101407818A (en) * | 2008-11-28 | 2009-04-15 | 北京市农林科学院 | Maize protein kinase encoding gene ZmCIPK2, and use of encoding protein thereof |
| WO2010025513A1 (en) * | 2008-09-04 | 2010-03-11 | Australian Centre For Plant Functional Genomics Pty Ltd | Salinity tolerance in plants |
-
2013
- 2013-10-25 CN CN201310511236.7A patent/CN103555740B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010025513A1 (en) * | 2008-09-04 | 2010-03-11 | Australian Centre For Plant Functional Genomics Pty Ltd | Salinity tolerance in plants |
| CN101407818A (en) * | 2008-11-28 | 2009-04-15 | 北京市农林科学院 | Maize protein kinase encoding gene ZmCIPK2, and use of encoding protein thereof |
Non-Patent Citations (3)
| Title |
|---|
| H6UKTO;Wang W X.et al.;《UniProtKB/TrEMBL》;20131016;Sequences * |
| NRN0089484F4;Puzio et al.;《EMBL-EBI》;20080327;source、CDS、Sequence * |
| 小麦TaCIPK31基因的克隆及生物信息学分析;韩玲玲等;《河南农业大学学报》;20130630;第47卷(第3期);第263页左栏 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103555740A (en) | 2014-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103555740B (en) | The one degeneration-resistant regulatory factor of grow wheat CBL-CIPK class and encoding gene thereof and application | |
| CN102485897B (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN107245480B (en) | Acetolactate synthase mutant protein with herbicide resistance and application thereof | |
| CN102776201B (en) | Application of OsELF 3 gene in controlling heading stage of paddy rice | |
| CN106868021B (en) | Gene OsNAC1 for controlling rice seed size and application thereof | |
| US11414671B2 (en) | High temperature seed germination | |
| CN112626080B (en) | R gene for controlling soybean-rhizobium matching property, protein and application thereof | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN102732526A (en) | Application of OsSRO1c gene in controlling rice drought resistance | |
| CN110643630A (en) | Application of KNAT1 gene in improving salt stress resistance of plants | |
| AU2020100800A4 (en) | Use of aegilops tauschii hmt1 gene | |
| CN104093840A (en) | Methods for improving crop yield | |
| CN103951740A (en) | Bermuda grass CCAAT transcription factor CdtNF-YC1 as well as coding gene and application thereof | |
| CN104004772B (en) | A kind of hybridized Chinese tuliptree LhPIN3 gene and application thereof | |
| CN101864430B (en) | Wheat introgression family gene Tamyb31 for resisting abiotic stress and application thereof | |
| CN108676804A (en) | Application of the arabidopsis AT5G49330 genes in terms of salt stress reaction | |
| CN103667315A (en) | Salt-tolerant and drought-resistant gene TaDHN1 of wheat, recombinant plasmid and application | |
| CN104498508A (en) | Wheat introgression line response abiotic stress regulation gene TaGBF and application | |
| CN102268439B (en) | Gene OS1 for regulating nitrogen absorption and utilization and drought stress of corn, and application thereof | |
| CN105255914A (en) | Lycium barbarum mitogen activated protein kinase kinase and application in improving saline-alkaline tolerance of plant | |
| CN110407922A (en) | Rice cold tolerance gene qSCT1 and its application | |
| BR112019020311A2 (en) | epsp improved plant synthases and methods of use | |
| CN104558132B (en) | Peanut DELLA gene families and its encoding gene and application | |
| CN108998457A (en) | The coded sequence of alfalfa Drought and heat resistance gene M sMBF1c and application | |
| CN101508997B (en) | Wheat salt-sensitive gene TaDi19A and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150902 Termination date: 20171025 |