CN108998457A

CN108998457A - The coded sequence of alfalfa Drought and heat resistance gene M sMBF1c and application

Info

Publication number: CN108998457A
Application number: CN201810970512.9A
Authority: CN
Inventors: 李小冬; 尚以顺; 莫本田; 陈光吉; 熊先勤; 蔡鸣; 蔡一鸣; 孙方; 李世歌; 张瑜; 吴佳海; 韩永芬; 王小利; 陈锡
Original assignee: GUIZHOU INSTITUTE OF PRATACULTURE
Current assignee: GUIZHOU INSTITUTE OF PRATACULTURE
Priority date: 2018-08-24
Filing date: 2018-08-24
Publication date: 2018-12-14
Also published as: ZA201900629B

Abstract

The invention discloses the nucleotide sequence of alfalfa MsMBF1c a kind of and amino acid sequence and it adjust plant drought heat resistance in application, change plant by overexpression MsMBF1c to the resistivity of arid and high temperature, guarantee is provided to improve stress resistance of plant under high temperature and drought condition, for use in the Drought and heat resistance breed breeding of herbage, crops and industrial crops, to slow down the injury caused by crop yield and quality of the environment-stress such as high temperature and drought.Belong to plant genetic engineering field.

Description

The coded sequence of alfalfa Drought and heat resistance gene M sMBF1c and application

Technical field

The present invention relates to field of plant genetic project technology, and in particular to a kind of alfalfa Drought and heat resistance gene The coded sequence of MsMBF1c and its application.

Background technique

It is a variety of biological and abiotic that plant is often subject to pest and disease damage, arid, high temperature, salinization of soil etc. in growth and development process Stress causes growth to slow down, yield decline, therefore the high resistance to cold and diseases of crops is always that research work and agricultural production are pursued Common objective.Arid usually occurs with high temperature stress simultaneously, is one of most important abiotic stress of agricultural production, it is annual because Arid causes 50% or more crop production reduction.Ecological grassland animal husbandry is the backing of Agricul tural Sustain able Development, however mostly The number pasture growing region relatively barren in soil, often faces more acute environment-stress.Alfalfa is as a kind of wide The cold-season-type leguminous forage of general plantation, Drought and heat resistance and acid resistance are two masters of its genetic improvement in south plantation is promoted Want target.Plant hides the unfavorable growing environment such as arid, high temperature by mobile like that without image of Buddha animal, in long-term evolution mistake Cheng Zhong, can the expression of some crucial adversity genes, to adjust the physiological status of itself seasonal and prominent to adapt to by changing Hair property disaster.By the method for science of heredity forward or backwards, successful identification goes out the gene that many participation adverse circumstances regulate and control, mainly It can be divided into three classes: 1, the gene of environmental injury, including coding are directly protected the plants from for synthesizing various osmotic fields The enzyme of matter.2, encode the enzyme and signal transduction albuminoid of film fat modification.3, by adjusting other gene expression indirect protections The transcription factor that plant injures from heat and drought condition.

By the way that drought resisting or heat-resisting strain in various plants has had successfully been obtained to these key gene genetic transformations, so And they are all largely to obtain in laboratory conditions for arid or high temperature single stress, in actual production, are done Drought usually occurs together with other unfavorable factors, therefore studies and become using the transcription factor that can reply a variety of environment stresses Solve the problems, such as this effective way.Mostly anti-turn has been cultivated in model plant and some crops by transgene method Gene strain.Overexpression FTL1/DDF1 can significantly improve tolerance of the plant to low temperature, high temperature and arid in arabidopsis Ability.Overexpression NAC transcription factor can be improved it to arid and tolerance with high salt in rice.OsDREB1 can be shown It writes and improves transgenic arabidopsis and rice to resistance arid, with high salt and low temperature.In addition, by the SlAREB1 of tomato in potato Middle overexpression can significantly improve plant to arid and tolerance with high salt.These researchs resist the new of a variety of adverse circumstances to cultivate Kind provides theoretical basis and technical support.

In the gene with a variety of resistance, MBF1 (Multiprotein Bridging Factors 1) is one The transcriptional activation confactor guarded in animals and plants adjusts gene expression by connection transcription factor and other regulation original parts, Participate in the biological processes such as cell differentiation, hormone regulating and controlling, lipid metaboli and histidine metabolism.There are 3 copies in arabidopsis MBF1 gene, MBF1a and MBF1b and the MBF1 genetic homology in animal are higher, do not have DNA binding ability；And MBF1c It can be lured in conjunction with DNA and by the abscisic acid and salicylic acid that disease, arid, high temperature, with high salt, hydrogen peroxide and external source apply It leads.Research discovery MBF1c regulates and controls the heat resistance of plant by adjusting salicylic acid, ethylene and trehalose signal pathway recently, and The expression of 36 different transcription factors including capable of adjusting including DREB2a, HSFs and bZIP etc..In arabidopsis, mistake Amount expression MBF1c can significantly improve seed germination of the plant under high temperature, arid and high salt conditions, and this resistance Enhancing high temperature with arid occur simultaneously when still remain.Therefore, MBF1c is the weight for cultivating a variety of adverse circumstance crops of resistance Want candidate gene.But research of the gene in herbage Drought and heat resistance is not yet reported that, especially vegetative growth phase is heat-resisting It adjusts.

Alfalfa because its excellent nutritional quality play the role of in animal husbandry it is highly important.As Grassland in south China is raw The development of state animal husbandry needs the tens million of mus of planting artificial pasture in Karst District in Southwest China, needs this high yield of alfalfa Good leguminous forage.However Drought and heat resistance screening varieties are carried out in southern area at present and are often only slept according to the autumn with germplasm innovation This index of grade, has certain limitation, and at present in alfalfa to the systematic Study of its pleiotropic gene and Germplasm innovation is also less.

Summary of the invention

The object of the present invention is to provide the coded sequence of alfalfa Drought and heat resistance gene M sMBF1c a kind of and applications, are The alfalfa New idioplasm resource for cultivating Drought and heat resistance, promoting and applying in Karst District in Southwest China has highly important theoretical research Value and application prospect.

To achieve the above object, the present invention uses following scheme:

A kind of coded sequence of alfalfa Drought and heat resistance gene M sMBF1c, it has such as SEQ ID NO:1 in sequence table Shown in nucleotide sequence；Or the polynucleotides with amino acid sequence shown in SEQ ID NO:2 in polynucleotide.

The coded sequence of alfalfa Drought and heat resistance gene M sMBF1c is albumen shown in SEQ ID NO:2 in sequence table Matter belongs to more pontin protein transcription co-activation.

Alfalfa Drought and heat resistance gene M sMBF1c is significantly combined induction with high temperature by arid, high temperature and arid；? In the arabidopsis of MsMBF1c overexpression, transgenic plant is sprouted with the growth of seedling stage in seed to high than WT lines The tolerance of temperature will enhance；And in the alfalfa of overexpression MsMBF1c, the drought resistance and heat resistance of genetically modified plants All significantly increase.

The application of the coded sequence of aforementioned alfalfa Drought and heat resistance gene M sMBF1c, be used to adjust plant germination and The heat resistance of Seedling Stage, and plant is adjusted in growth phase to arid and high temperature resistance, alfalfa Drought and heat resistance gene Plant drought resistance and heat resistance can be improved in the coded sequence of MsMBF1c.

Compared with prior art, advantages of the present invention is as follows:

The present invention is the sequence of domestic and international first public play-by-play alfalfa MsMBF1c, and overexpression amount can Enhance arabidopsis and the heat resistance of alfalfa and the function of drought resistance currently without relevant report, present invention discover that in arabidopsis Middle overexpression alfalfa MsMBF1c gene can be improved under hot conditions the germination percentage of seed and seedling to high temperature Tolerance, scale MsMBF1c gene is crossed in alfalfa can be improved Medicago sativa to high temperature and drought resistance ability, Therefore the present invention proposes that plant drought and heat resistance can be changed using overexpression MsMBF1c, to change under the conditions of high temperature and drought Kind crop anti-adversity provides guarantee, can be ultimately utilized in the Drought and heat resistances breeding of new variety such as herbage, crops and industrial crops, slows down Injury of the environment-stress such as high temperature and drought to crop yield and quality.

Detailed description of the invention

Fig. 1 is alfalfa MsMBF1c and arabidopsis MBF1c homologous sequence comparison chart；

Alfalfa MsMBF1c amino acid sequence and arabidopsis AtMBF1c ammonia are compared using ClustalX 1.8.3 software Base acid sequence obtains result；

Fig. 2 is plant expression vector schematic diagram；

Clone, which obtains MsMBF1c coding sequence and connect it with pMD18-T empty carrier, obtains pMD18- MsMBF1c after sequencing is correct, with Sma1 and Sac1 difference digestion pMD18-MsMBF1c and pBI121 empty carrier, recycles gene piece Then section and carrier segments are connected, are converted, screening obtains pBI121-MsMBF1c positive colony；

Fig. 3 is that MsMBF1c is schemed by high temperature, drought-induced expression；

The big alfalfa seedling of surrounding is subjected to high temperature and Osmotic treatment respectively, extracts the RNA in blade, reverse transcription is living CDNA is obtained, MsMBF1c expression quantity is then analyzed using qRT-PCR；

Fig. 4 is screening pBI121-MsMBF1c positive transgenic arabidopsis；

It is raw that the transgenic seed disinfected is seeded in 1/2MS+ kanamycins 50mg/L+ Ticarcillin/Clavulanate Acid 300mg/L culture medium Long 15 days (A)；It is planted using PCR method resistance marker primer and gene-specific primer detection pBI121-MsMBF1c transgenosis Strain；

Fig. 5 MsMBF1c overexpression improves arabidopsis germination percentage under hot conditions；

The seed disinfected is seeded on 1/2MS culture medium, plate is placed in thermostat water bath 45 DEG C after vernalization 3d Germination percentage is counted after high-temperature process 4h, 4.5h and 5h, 7d, MsMBF1c overexpression improves arabidopsis germination percentage under hot conditions；

Fig. 6 MsMBF1c overexpression improves Arabidopsis thaliana Seedlings survival rate under hot conditions；

The seed disinfected is seeded on 1/2MS culture medium, plate is placed in phjytotron and grows 7 days after vernalization 3d, Seedling is immersed into 42 DEG C of high-temperature process 20min, 25min, 30min in thermostat water bath, is transferred under 22 DEG C of normal growing conditions Growth 7 days, takes a picture and counts the death rate, mutant germination percentage is remarkably decreased with survival rate, and complementary materials are suitable with wild type；

Fig. 7 is screening pBI121-MsMBF1c positive transgenic clover；

It is screening pressure with kanamycins, by positive transgenic plantlet of transplant into fertile soil using the method for tissue cultures It carries out practicing seedling processing, positive face has carried out the Molecular Identification of resistant gene and specific gene respectively.

Specific embodiment

Below by specific embodiment, the invention will be further described, specific as follows:

Embodiment 1: the clone of alfalfa MsMBF1c and sequence alignment analysis.

Using arabidopsis AtMBF1c gene as template, the sequence of M. truncatula MBF1c gene is retrieved in ncbi database, Using it as template design primer (forward primer: [5 '-ATGTCAGGTCTAGGCCATATTTCTC-3 ']；Reverse primer: [5 '- TCATTTCTTGCCACGCAGTTTAG-3 ']), the coding of MsMBF1c as template, is cloned using alfalfa " middle lucerne No.1 " cDNA Sequence is connected to pMD18-T carrier after recovery purifying, and ABI3700 sequencing is utilized to obtain its coded sequence.It utilizes ClustalX 1.8.3 software compares MsMBF1c and AtMBF1c protein sequence, and comparison result is shown in Fig. 1.

1, alfalfa blade total serum IgE is extracted.

(1) under the conditions of in the controlled environment chamber, 22 DEG C, 8h illumination/16h is dark, and plantation alfalfa " in herd No. 1 " takes The fresh leaf sample liquid nitrogen grinding of 100mg, uses TRIZOL^TMKit extracts plant leaf blade total serum IgE,

(2) sample ground is added in 1ml Trizol reagent, is turned upside down, sample is allowed sufficiently to connect with Trizol Touching, (20-25 DEG C, similarly hereinafter) placement 10min of room temperature,

(3) 200 μ l chloroforms are added, (VORTEX-GENIE 2T) acutely vibrates 30s on vortex oscillation instrument, is placed at room temperature for 5min,

(5) 12000g 4 DEG C, is centrifuged 10min, takes 500 μ l supernatants into new pipe, 1ml dehydrated alcohol is added, -20 after mixing DEG C place 20min,

(6) 12000g 4 DEG C, is centrifuged 10min, outwells supernatant, and 75% ethyl alcohol that 1ml pre-cooling is added (uses DEPC H₂O according to Volume ratio dilution),

(7) 10000g, is centrifuged 10min, outwells supernatant, be air-dried 15min by 4 DEG C,

(8) add 20-30 μ l RNase-free H₂O 50-60 DEG C dissolves 5min.

2, reverse transcription synthesizes the first chain of cDNA

The synthesis of the first chain of cDNA uses PrimeScript^TMⅡfirst strand cDNA synthesis Kit (Takara) reverse transcription reagent box, concrete operations illustrate to carry out referring to kit, specific as follows.

(1) following reaction solution is configured on ice, gently concussion mixes,

(2) 42 DEG C, 1h is incubated in thermostat water bath,

(3) 75 DEG C, it is incubated for 5min in DNA cloning instrument, terminates reaction.

3, MsMBF1c gene is cloned

(1) using arabidopsis MBF1c as template, BLST analysis is carried out in ncbi database, selects M. truncatula MBF family base Because sequence uses primer premier5.0 design primer sequence, PCR amplification is carried out by template of alfalfa blade cDNA, In the following way with proportional arrangement reaction solution:

(2) according to following procedure carry out PCR reaction, 94 DEG C of 3min, 94 DEG C of 30s, 52 DEG C of 30s, 72 DEG C of 1min, 30cycles, 72 DEG C of 5min, 25 DEG C of 5min.Recovery purifying MsMBF1c segment (the raw work in Shanghai, SanPrep Column DNA Gel Extraction Kit), and it is connected to pMD18-T carrier (Takara), sequencing obtains alfalfa MsMBF1c code sequence Column, base sequence are nucleotide sequence shown in SEQ ID NO:1.Its corresponding protein sequence is SEQ ID NO:2 institute The amino acid sequence shown.

Using ClustalX 1.8.3 sequence alignment program, MsMBF1c is compared with AtMBF1c protein sequence, and Make sequence alignment figure.

As a result: obtaining the coded sequence of a 429bp, encode 142 amino acid, compared and divided by ClustalX 1.8.3 Analysis discovery, MsMBF1c and AtMBF1c protein sequence similarity illustrate MBF1c gene function in clover and arabidopsis up to 72% Than more conservative.

Embodiment 2: the inducing expression analysis of alfalfa MsMBF1c.

(1) under the conditions of in the controlled environment chamber, wild type " in the herd No. 1 " alfalfa for growing 4 weeks is divided into 4 groups, 2 right According to group, 1 Osmotic treatment group, 1 high-temperature process group.

(2) high-temperature process group: simulating high-temperature process in illumination box, under the conditions of processing group is placed in 40 DEG C, the high temperature side of body Compel 1h, control group (20-22 DEG C) growth under normal operation, after having handled, processing group and control group sample together.

(3) Osmotic treatment group: simulating drought is handled in the controlled environment chamber, under normal operation with control group by processing group (20-22 DEG C) growth, processing group Continuous Drought 2 weeks, control group normally waters, and after having handled, processing group and control group take together Sample.

(4) RNA extraction and reverse transcription reference implementation case 1 are lured using qRT-PCR detection MsMBF1c by high temperature and arid Lead the variation of expression.

(5) SYBR Green Realtime PCR Master Mix plus (TOYUBO, QPK-212) kit is used, Reaction solution is prepared in accordance with the following methods:

Primer sets are combined into qMsMBF1cF+qMsMBF1cR, and primer sequence is qMsMBF1c F: CAATGAGAAGCCTCAAGTGATCCA,qMsMBF1c R:TGCCACGCAGTTTAGCTCCAAG。

(6) PCR reaction: 94 DEG C of 2min, 94 DEG C of 15s, 58 DEG C of 15s, 72 DEG C of 30s, read is carried out according to following response procedures Plate, 45cycles, 72 DEG C of 5min, 25 DEG C of 5min.

(7) data analysis uses Excel 2010, and graphics software is handled using PowerPoint 2010.

As a result: under the conditions of high temperature stress, MsMBF1c is by 4.21 times of significant up-regulated expression, under drought stress conditions, MsMBF1c is by 2.21 times of up-regulated expression, and MsMBF1c is by 4.92 times of significant up-regulated expression under arid and high temperature suite stresses.

Embodiment 3: alfalfa MsMBF1c is adjusting the application in arabidopsis germination and seedling heat resistance.

1, the building of MsMBF1c expression vector and transformation of Arabidopsis thaliana

(1) pMD18-MsMBF1c for obtaining case study on implementation 1 and pBI121 passes through BamH I and I digestion of Sma, gel extraction Target fragment constructs pBI121-MsMBF1c Overexpression vector by T4DNA ligase connection (Fermentas), and passes through CaCl₂Plasmid is transformed into Agrobacterium GV3101 bacterial strain by conversion method.

(2) it configures induced medium: weighing 10g sucrose (mass ratio 5%) and be completely dissolved in 200ml distilled water, 20 μ l Silwet (the raw work in Shanghai) surfactant is added before conversion, mixes well.

(3) positive Agrobacterium single colonie is activated from picking on dual anti-(25mg/L Gent+50mg/L Km) plate to be inoculated into In the dual anti-culture medium of 5ml LB, 28 DEG C, 220rpm concussion activation is for 24 hours.

(4) bacterium solution of activation is inoculated into the dual anti-culture medium of 200ml LB 28 DEG C according to the ratio of 1:50,220rpm shake Swing culture 8-12h.

(5) 4000-6000r/min room temperature centrifugation 10-15min collects the agrobatcerium cell of culture, and it is matched with fresh The induced medium set suspends.

(6) by wildtype Arabidopsis thaliana removal flower and silique in the reproductive growth prometaphase, it is outstanding to be directly dipped to Agrobacterium Supernatant liquid infects 30s.

(7) it is stood overnight in darkroom, seed is then harvested under regular culture conditions, is i.e. acquisition T₀For transgenic seed.

2, MsMBF1c transgenic arabidopsis screens

(1) the MsMBF1c transgenic arabidopsis T that will newly receive₀Seed is distributed into every part of 200mg, is respectively charged into 1.5ml centrifugation Guan Zhong.

(2) with 75% ethyl alcohol surface sterilization 1min, 3min then is sterilized with 50%84 thimerosals (clean auntie, commercially available), on It is lower reverse, mix well seed with thimerosal.

(3) it is suspended with sterile water wash seed 3-4 times rear 0.1% agarose, seed is uniformly spread in 1/2MS+ On the culture medium of 300mg/L Ticarcillin/Clavulanate Acid+50mg/L kanamycins, 4 DEG C are protected from light vernalization 3 days.

(4) seed-bearing culture dish will be contained to be transferred in phjytotron, and dark condition culture 3 days, will be transferred to illumination item Continue culture 7-15 days under part, artificial culturing room's condition: temperature is 22 DEG C, humidity 80%, and intensity of illumination is 80-200 μm of ol/ m²/ s, photoperiod are 16h illumination, and 8h is dark.

(5) Arabidopsis thaliana Seedlings by green survival are transferred in Nutrition Soil culture medium, continue to be placed in the growth of illumination cultivation room.

After (6) 3 weeks, 10-100mg fresh leaf tissue is taken to be put into sterile 1.5ml centrifuge tube.

(7) be added 400 μ l extraction buffers (200mM Tris-HCl pH7.5,250mM NaCl, 25mM EDTA, 0.5%SDS), room temperature is ground rapidly.

(8) after the centrifuge tube that turns upside down mixes, 10min is stood.

(9) 12000rpm, room temperature are centrifuged 10min, supernatant are transferred in the dehydrated alcohol of 800 μ l pre-cooling, -20 DEG C of precipitatings 1-2h。

(10) 12000rpm, room temperature are centrifuged 15min, pour into supernatant, drain DNA.

(11) add the 100 abundant dissolving DNAs of μ l sterile water, taking 2 μ l is template, carries out Molecular.

(12) Molecular Identification is carried out with resistant gene NPT and 35S+ downstream of gene primer respectively, primer sequence is respectively NPTF [5 '-GTGCCCTGAATGAACTGC-3 '], NPTR [5 '-CAATATCACGGGTAGCCA-3 '] 35S [5 '- TCCCACTATCCTTCGCAAG-3 '] with MsMBF1cR [5 '-TCATTTCTTGCCACGCAGTTTAG-3 '] according to formula as below Prepare reaction solution (raw 2 × Taq of the work PCR reaction kit in Shanghai):

(13) DNA cloning is carried out according to following procedure, response procedures are as follows: 94 DEG C of 3min, 94 DEG C of 30s, 58 DEG C of 45s, 72 DEG C 30s, 30cycles, 72 DEG C of 5min, 25 DEG C of 5min.

(14) it takes 5-10 μ l to be loaded to Ago-Gel and carries out electrophoresis detection, select positive transgenic plant.

2, MsMBF1c adjusts arabidopsis heat resistance

(1) material for preparing Analysis of Heat Tolerance selects homozygous unseparated transgenic line from T3 strain；It is purchased from ABRC Buy and obtain mbf1c T-DNA insertion mutation body, referring to overexpression method by MsMBF1c genetic transformation to mbf1c mutant In, obtain the strain that has complementary functions.

(2) referring to positive transgenic plant screening method to MsMBF1c overexpression strain, mbf1c mutant, MsMBF1c complementation mbf1c and wildtype Arabidopsis thaliana carry out surface sterilization.

(3) material disinfected is uniformly sowed in the 9cm culture dish containing 20ml culture medium, each material sowing 30 Seed is put in 4 DEG C and is protected from light purifying 3d.

High-temperature process Seed germination:

(4) culture dish after vernalization is completely immersed in 45 DEG C of thermostat water baths, handles 4h, 4.5h and 5h respectively, each 3 repetitions of time point.

(5) by the material after high-temperature process together with control material, (22 DEG C) cultures 7-10 days are placed under normal condition, often Its statistics germination percentage, was arranged successively photograph according to germinating energy power for the seed of germination after 10 days.

The experiment of high-temperature process survival rate of seedling:

(4) material after vernalization is transferred in illumination box and is cultivated 7 days, material is divided into two groups, by processing group material Material is totally immersed in 42 DEG C of thermostat water baths, carries out high-temperature process 20min, 25min and 30min, 3 weights of each time point It is multiple.

(5) material after high-temperature process is placed in together with control group grown under normal conditions 7d, counts survival rate of seedling, And it captures a photograph.

3, gene expression analysis

(1) 14 -day-old of wild type, MsMBF1c overexpression, mbf1c mutant Arabidopsis plant are taken, at 38 DEG C of high temperature 1h is managed, collects the seedling under normal condition and hot conditions, RNA is extracted, the method for reverse transcription and program are with case study on implementation one, glimmering Light quantitative (qRT-PCR) is tried using SYBR Green Realtime PCR Master Mix plus (TOYUBO, QPK-212) Agent box, prepares reaction solution in accordance with the following methods:

Primer sequence such as table (1)

The primer that table (1) uses.

(2) PCR reaction: 94 DEG C of 2min, 94 DEG C of 15s, 58 DEG C of 15s, 72 DEG C of 30s, read is carried out according to following response procedures Plate, 45cycles, 72 DEG C of 5min, 25 DEG C of 5min.

(3) data analysis uses Excel 2010, and graphics software uses at Photoshop CS6 and PowerPoint2010 Reason.

As a result: MsMBF1c can significantly increase transgenic arabidopsis, and the germination percentage of seed and seedling are deposited under the high temperature conditions Motility rate, the phenotype that alfalfa MsMBF1c energy complement Arabidopsis mbf1c mutant heat resistance weakens.

The expression of HsfA1a is not influenced by high temperature induction by MsMBF1c；Under normal operation, HsfA2, WRKY18 Express downward in mbf1c mutant with DREB2a, and the up-regulated expression in MsMBF1c overexpressing plants, after high temperature induction, HsfA2, WRKY18 and DREB2a are lured in wildtype Arabidopsis thaliana, mbf1c mutant and MsMBF1c overexpressing plants It leads, wherein the thermal induction degree of these genes is substantially less than in wild type and MsMBF1c overexpression in mbf1c mutant Plant；Under normal operation, the expression of HsfA3, HsfB1 and WRKY25 do not have impacted in mbf1c mutant, and It is induced in MsMBF1c overexpressing plants, under the conditions of high temperature stress, the expression of HsfA3, HsfB1 and WRKY25 can be by Induction in various degree, but the induction amplitude in wild type and MsMBF1c overexpressing plants is significantly higher than mbf1c mutation Body.Illustrate that MsMBF1c can participate in the approach of resistance to thermal conditioning that HsfA2-HsfA3 and DREB2a is mediated.

Embodiment 4: alfalfa MsMBF1c is adjusting the application in alfalfa high temperature and drought tolerance.

1, the acquisition and screening of MsMBF1c transgenic alfalfa

(1) " the middle lucerne No.1 " alfalfa seed newly received is used into 75% ethyl alcohol surface sterilization 1min, then with 50% 84 thimerosals (clean auntie, commercially available) sterilize 15min, turn upside down, mix well seed with thimerosal.

(2) after using sterile water wash seed 3-4 times, seed is uniformly put and is sowed on 1/2MS culture medium, in artificial culturing room Middle culture 10-20 days, temperature are 22 DEG C, and humidity 80%, intensity of illumination is 80-200 μm of ol/m²/ s, photoperiod are 16h light According to 8h is dark.

(3) tests for sterility is taken, is cut into 3-5mm with scalpel²Explant, with activated Agrobacterium suspend Liquid (+100 μM of acetosyringones of+30% sucrose of MS fluid nutrient medium) infects 10-30min.

(4) explant after infecting is transferred in co-culture medium (MS+2mM TDZ+1mM 6BA), in half-light item 2-3d is co-cultured under part.

(5) explant of co-cultivation is transferred on calli induction media (MS+2mM TDZ+1mM 6BA+50mg/L Km+150mg/L Cr), 15-30d is co-cultured under the conditions of illumination light, average every 10 days subcultures are primary, are cured until growing yellow green Wound.

(6) callus is transferred on differential medium (MS+2mM KT+1mM IAA+50mg/L Km+150mg/L Cr), To seedling differentiation, every 10-15 days subcultures are primary for illumination condition culture.

(7) Transplantation of Regenerated Plantlets to root media (MS+1mM NAA+50mg/L Km+150mg/L Cr) is given birth to Root culture.The seedling of alfalfa grown up to is transplanted in Nutrition Soil after hardening 7-10 days and transplants the plantation of crop field isolation canopy plus generation.

(8) referring to the detection method of arabidopsis transgenic seedling, primer is combined to each using NPT and 35S+MsMBF1c two A strain carries out Molecular Detection.

2, adjusting of the MsMBF1c to alfalfa high temperature and arid

(1) positive transgenic T1 is chosen for strain, it is parallel with wild-type alfalfa to plant in Nutrition Soil, in squaring period Carry out high temperature and Osmotic treatment.

(2) nature high temperature and drought stress environment are simulated using phjytotron, setting program are as follows: 8:00-8: 30 begin to warm to 40 DEG C, maintain to arrive 17:30, and 17:30-18:00 cools to 20 DEG C, maintains to next day 8:00, and stop watering. Plant is observed after 1 week and is damaged situation, the statistics death rate and dead leaf number, and is captured a photograph

As a result: conversion MsMBF1c gene can significantly increase alfalfa to the resistivity of high temperature and arid suite stresses.

Sequence table

<110>Guizhou Province Grass Industry Research Institute

<120>coded sequence of alfalfa Drought and heat resistance gene M sMBF1c and application

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 429

<212> PRT

<213>alfalfa (Medicago satavia)

<400> 1

Ala Thr Gly Thr Cys Ala Gly Gly Thr Cys Thr Ala Gly Gly Cys Cys

1 5 10 15

Ala Thr Ala Thr Thr Thr Cys Thr Cys Ala Ala Gly Ala Thr Thr Gly

20 25 30

Gly Gly Ala Ala Cys Cys Ala Gly Thr Cys Gly Thr Cys Ala Thr Cys

35 40 45

Cys Gly Cys Ala Ala Gly Ala Ala Ala Gly Cys Thr Cys Cys Cys Ala

50 55 60

Ala Cys Gly Cys Cys Gly Cys Cys Gly Cys Cys Ala Ala Gly Ala Ala

65 70 75 80

Ala Gly Ala Thr Gly Ala Gly Ala Ala Ala Gly Cys Cys Gly Thr Cys

85 90 95

Ala Ala Thr Gly Cys Cys Gly Cys Thr Cys Gly Cys Cys Gly Thr Gly

100 105 110

Cys Cys Gly Gly Cys Gly Cys Cys Gly Ala Thr Ala Thr Cys Gly Ala

115 120 125

Cys Ala Cys Cys Gly Thr Cys Ala Ala Gly Ala Ala Ala Cys Ala Thr

130 135 140

Ala Ala Thr Gly Cys Thr Gly Cys Ala Ala Cys Ala Ala Ala Cys Ala

145 150 155 160

Ala Ala Gly Cys Thr Gly Cys Ala Thr Cys Thr Ala Gly Cys Ala Gly

165 170 175

Cys Ala Cys Thr Thr Cys Ala Thr Thr Gly Ala Ala Cys Ala Cys Thr

180 185 190

Ala Ala Gly Ala Gly Gly Cys Thr Gly Gly Ala Thr Gly Ala Gly Gly

195 200 205

Ala Thr Ala Cys Thr Gly Ala Gly Ala Ala Thr Cys Thr Ala Gly Cys

210 215 220

Thr Cys Ala Thr Gly Ala Thr Cys Gly Thr Gly Thr Ala Cys Cys Ala

225 230 235 240

Ala Cys Thr Gly Ala Ala Cys Thr Cys Ala Ala Gly Ala Ala Gly Gly

245 250 255

Cys Thr Ala Thr Ala Ala Thr Gly Cys Ala Ala Gly Cys Thr Ala Gly

260 265 270

Gly Ala Thr Gly Gly Ala Cys Ala Ala Ala Ala Ala Gly Cys Thr Thr

275 280 285

Ala Cys Thr Cys Ala Gly Thr Cys Thr Cys Ala Gly Cys Thr Thr Gly

290 295 300

Cys Thr Cys Ala Ala Ala Thr Cys Ala Thr Cys Ala Ala Thr Gly Ala

305 310 315 320

Gly Ala Ala Gly Cys Cys Thr Cys Ala Ala Gly Thr Gly Ala Thr Cys

325 330 335

Cys Ala Ala Gly Ala Gly Thr Ala Cys Gly Ala Gly Thr Cys Ala Gly

340 345 350

Gly Gly Ala Ala Ala Gly Cys Cys Ala Thr Thr Cys Cys Ala Ala Ala

355 360 365

Cys Cys Ala Gly Cys Ala Gly Ala Thr Ala Ala Thr Thr Ala Gly Cys

370 375 380

Ala Ala Gly Thr Thr Gly Gly Ala Gly Ala Gly Ala Gly Cys Cys Cys

385 390 395 400

Thr Thr Gly Gly Ala Gly Cys Thr Ala Ala Ala Cys Thr Gly Cys Gly

405 410 415

Thr Gly Gly Cys Ala Ala Gly Ala Ala Ala Thr Gly Ala

420 425

<210> 2

<211> 142

<212> PRT

<213>alfalfa (Medicago satavia)

<400> 2

Met Ser Gly Leu Gly His Ile Ser Gln Asp Trp Glu Pro Val Val Ile

1 5 10 15

Arg Lys Lys Ala Pro Asn Ala Ala Ala Lys Lys Asp Glu Lys Ala Val

20 25 30

Asn Ala Ala Arg Arg Ala Gly Ala Asp Ile Asp Thr Val Lys Lys His

35 40 45

Asn Ala Ala Thr Asn Lys Ala Ala Ser Ser Ser Thr Ser Leu Asn Thr

50 55 60

Lys Arg Leu Asp Glu Asp Thr Glu Asn Leu Ala His Asp Arg Val Pro

65 70 75 80

Thr Glu Leu Lys Lys Ala Ile Met Gln Ala Arg Met Asp Lys Lys Leu

85 90 95

Thr Gln Ser Gln Leu Ala Gln Ile Ile Asn Glu Lys Pro Gln Val Ile

100 105 110

Gln Glu Tyr Glu Ser Gly Lys Ala Ile Pro Asn Gln Gln Ile Ile Ser

115 120 125

Lys Leu Glu Arg Ala Leu Gly Ala Lys Leu Arg Gly Lys Lys

130 135 140

<210> 3

<211> 25

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>with retrieving MsMBF1c in (https: //www.ncbi.nlm.nih.gov/) database in NCBI database The sequence of gene designs the forward primer of gene coded sequence for cloning MsMBF1c sequence with Primer Premier 5.0.

<400> 3

Ala Thr Gly Thr Cys Ala Gly Gly Thr Cys Thr Ala Gly Gly Cys Cys

1 5 10 15

Ala Thr Ala Thr Thr Thr Cys Thr Cys

20 25

<210> 4

<211> 23

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>with retrieving MsMBF1c in (https: //www.ncbi.nlm.nih.gov/) database in NCBI database The sequence of gene designs the reverse primer of gene coded sequence for cloning MsMBF1c sequence with Primer Premier 5.0.

<400> 4

Thr Cys Ala Thr Thr Thr Cys Thr Thr Gly Cys Cys Ala Cys Gly Cys

1 5 10 15

Ala Gly Thr Thr Thr Ala Gly

20

<210> 5

<211> 24

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>with retrieving MsMBF1c in (https: //www.ncbi.nlm.nih.gov/) database in NCBI database The sequence of gene designs forward primer with Primer Premier 5.0 and is used for MsMBF1c gene expression analysis.

<400> 5

Cys Ala Ala Thr Gly Ala Gly Ala Ala Gly Cys Cys Thr Cys Ala Ala

1 5 10 15

Gly Thr Gly Ala Thr Cys Cys Ala

20

<210> 6

<211> 22

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>with retrieving MsMBF1c in (https: //www.ncbi.nlm.nih.gov/) database in NCBI database The sequence of gene designs reverse primer with Primer Premier 5.0 and is used for MsMBF1c gene expression analysis.

<400> 6

Thr Gly Cys Cys Ala Cys Gly Cys Ala Gly Thr Thr Thr Ala Gly Cys

1 5 10 15

Thr Cys Cys Ala Ala Gly

20

<210> 7

<211> 18

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>it is carried with retrieval PBI121 in (https: //www.ncbi.nlm.nih.gov/) database in NCBI database The sequence of NPT gene on body designs forward primer with Primer Premier 5.0 and screens MsMBF1c for Molecular Detection Overexpression positive transgenic plant.

<400> 7

Gly Thr Gly Cys Cys Cys Thr Gly Ala Ala Thr Gly Ala Ala Cys Thr

1 5 10 15

Gly Cys

<210> 8

<211> 18

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>it is carried with retrieval PBI121 in (https: //www.ncbi.nlm.nih.gov/) database in NCBI database The sequence of NPT gene on body designs reverse primer with Primer Premier 5.0 and screens MsMBF1c for Molecular Detection Overexpression positive transgenic plant.

<400> 8

Cys Ala Ala Thr Ala Thr Cys Ala Cys Gly Gly Gly Thr Ala Gly Cys

1 5 10 15

Cys Ala

<210> 9

<211> 19

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>it is carried with retrieval PBI121 in (https: //www.ncbi.nlm.nih.gov/) database in NCBI database 35S promoter sequence on body designs forward primer with Primer Premier 5.0 and screens MsMBF1c for Molecular Detection Overexpression positive transgenic plant.

<400> 9

Thr Cys Cys Cys Ala Cys Thr Ala Thr Cys Cys Thr Thr Cys Gly Cys

1 5 10 15

Ala Ala Gly

<210> 10

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HSFA1a gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects HSFA1a changes in gene expression.

<400> 10

Cys Cys Ala Gly Cys Thr Thr Thr Gly Thr Thr Cys Gly Cys Cys Ala

1 5 10 15

Gly Thr Thr Ala

20

<210> 11

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HSFA1a gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects HSFA1a changes in gene expression.

<400> 11

Ala Gly Cys Cys Ala Thr Thr Gly Ala Ala Cys Cys Thr Thr Gly Ala

1 5 10 15

Cys Cys Cys Thr

20

<210> 12

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HsfA2 gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects HsfA2 changes in gene expression.

<400> 12

Gly Gly Ala Ala Gly Cys Ala Gly Cys Gly Thr Thr Gly Gly Ala Thr

1 5 10 15

Gly Thr Gly Ala

20

<210> 13

<211> 23

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HsfA2 gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects HsfA2 changes in gene expression.

<400> 13

Thr Ala Gly Ala Thr Cys Thr Thr Gly Gly Cys Thr Gly Thr Cys Cys

1 5 10 15

Cys Ala Ala Thr Cys Cys Ala

20

<210> 14

<211> 21

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HsfA3 gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects HsfA3 changes in gene expression.

<400> 14

Gly Thr Thr Gly Ala Thr Gly Ala Cys Cys Cys Gly Ala Cys Thr Cys

1 5 10 15

Thr Thr Gly Ala Cys

20

<210> 15

<211> 23

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HsfA3 gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects HsfA3 changes in gene expression.

<400> 15

Gly Ala Gly Gly Ala Thr Cys Cys Cys Ala Ala Ala Cys Thr Ala Cys

1 5 10 15

Gly Ala Ala Gly Cys Thr Ala

20

<210> 16

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HSFB2a gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects HSFB2a changes in gene expression.

<400> 16

Ala Ala Ala Cys Ala Gly Thr Thr Gly Thr Thr Gly Cys Thr Cys Cys

1 5 10 15

Thr Thr Cys Gly

20

<210> 17

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HSFB2a gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects HSFB2a changes in gene expression.

<400> 17

Gly Ala Thr Ala Ala Ala Cys Cys Ala Cys Cys Ala Thr Thr Cys Cys

1 5 10 15

Cys Ala Gly Thr

20

<210> 18

<211> 22

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HSFB1 gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects HSFB1 changes in gene expression.

<400> 18

Thr Cys Ala Gly Cys Thr Cys Ala Ala Cys Ala Cys Thr Thr Ala Cys

1 5 10 15

Gly Gly Ala Thr Thr Thr

20

<210> 19

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis HSFB1 gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects HSFB1 changes in gene expression.

<400> 19

Gly Ala Cys Thr Cys Ala Gly Ala Ala Gly Gly Cys Gly Ala Ala Cys

1 5 10 15

Cys Ala Ala Cys

20

<210> 20

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis WRKY25 gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects WRKY25 changes in gene expression.

<400> 20

Gly Cys Gly Thr Thr Gly Ala Cys Thr Gly Thr Thr Ala Cys Gly Ala

1 5 10 15

Ala Gly Ala Thr

20

<210> 21

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis WRKY25 gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects WRKY25 changes in gene expression.

<400> 21

Ala Thr Thr Gly Thr Gly Ala Ala Ala Thr Cys Gly Gly Ala Ala Gly

1 5 10 15

Ala Gly Gly Thr

20

<210> 22

<211> 22

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis WRKY18 gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects WRKY18 changes in gene expression.

<400> 22

Thr Gly Cys Cys Thr Ala Cys Thr Gly Ala Ala Ala Cys Ala Thr Cys

1 5 10 15

Gly Gly Ala Cys Ala Cys

20

<210> 23

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis WRKY18 gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects WRKY18 changes in gene expression.

<400> 23

Ala Cys Gly Gly Thr Gly Cys Ala Ala Ala Cys Gly Ala Gly Cys Ala

1 5 10 15

Thr Cys Thr Ala

20

<210> 24

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis DREB2a gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects DREB2a changes in gene expression.

<400> 24

Ala Ala Ala Gly Gly Thr Ala Ala Ala Gly Gly Ala Gly Gly Ala Cys

1 5 10 15

Cys Ala Gly Ala

20

<210> 25

<211> 20

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis DREB2a gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects DREB2a changes in gene expression.

<400> 25

Gly Cys Cys Ala Ala Ala Gly Gly Ala Cys Cys Ala Thr Ala Cys Ala

1 5 10 15

Thr Ala Gly Cys

20

<210> 26

<211> 24

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis Actin7 gene in Tair database Part designs the forward primer of gene, and the method for fluorescent quantitation detects Actin7 changes in gene expression.

<400> 26

Gly Ala Thr Ala Thr Thr Cys Ala Gly Cys Cys Ala Cys Thr Thr Gly

1 5 10 15

Thr Cys Thr Gly Thr Gly Ala Cys

20

<210> 27

<211> 24

<212> PRT

<213>alfalfa (Medicago satavia)

<220>

<223>then soft with Primer Premier 5.0 with the sequence for retrieving arabidopsis Actin7 gene in Tair database Part designs the reverse primer of gene, and the method for fluorescent quantitation detects Actin7 changes in gene expression.

<400> 27

Cys Ala Thr Gly Thr Thr Cys Gly Ala Thr Thr Gly Gly Ala Thr Ala

1 5 10 15

Cys Thr Thr Cys Ala Gly Ala Gly

20

Specification nucleotide and amino acid sequence table

1

Claims

1. a kind of coded sequence of alfalfa Drought and heat resistance gene M sMBF1c, it is characterised in that: it has as in sequence table Nucleotide sequence shown in SEQ ID NO:1；Or with the more of amino acid sequence shown in SEQ ID NO:2 in polynucleotide Nucleotide.

2. a kind of application of the coded sequence of alfalfa Drought and heat resistance gene M sMBF1c as described in claim 1, feature Be: its heat resistance for being used to adjust plant germination and Seedling Stage, and adjusting plant are resistance to arid and high temperature in growth phase By property.