CN103436621B - Method and kit for quickly detecting expression quantity of CK19 mRNA (messenger ribonucleic acid) - Google Patents

Abstract

The invention discloses a primer, probe, detection method and kit for detecting expression quantity of CK19 mRNA (messenger ribonucleic acid). The primer comprises a forward primer of which the base sequence is shown as SEQ ID NO:1 and a reverse primer of which the base sequence is shown as SEQ ID NO:2; the base sequence of the probe is shown as SEQ ID NO:3; and the 5' terminal is marked with a reporting fluorophore, and the 3' terminal is marked with a quenching fluorophore. The method disclosed by the invention has the advantages of high detection speed, simple operation process, high specificity, high sensitivity and high reproducibility, can quickly and specifically detect the expression quantity of CK19 mRNA in a detection sample, can be used for correlation detection using CK19 as a marker, and has wide application range and favorable application prospects.

Description

A kind of method of rapid detection CK19mRNA expression amount and test kit thereof

Technical field

The present invention relates to the detection of CK19mRNA expression amount, particularly relate to for the primer of rapid detection CK19mRNA expression amount, probe, detection method and test kit thereof.

Background technology

Cytokeratin (cytokeratin, CK) is the main skeleton albumen in keratinocyte, and the major function of this structural protein is the integrity and the continuity that maintain epithelium.Research finds that cytokeratin has high conservative property and tissue differentiation specificity, and itself and epithelial proliferation and differentiation are closely related, and the cytokeratin be confirmed at present has 20 kinds, i.e. CK1-20.Cytokeratin is as a kind of conventional tumour immunity histological chemistry marker, and its positive expression is more common in epithelial cell, mesothelial cell, cancer, mesothelioma etc.

Cyfra21-1 (CK19) is one of cytokeratin composition be distributed in epithelial cell, it is by KERATIN19(KRT19) molecular weight of genes encoding be 40000 soluble acid peptide molecule, mainly be expressed in monoptychic gland epithelium and mesothelial cell, its base sequence is as shown in SEQ ID NO:7.CK19 in normal state content is extremely low, but there is the expression of more horn of plenty in cancerous tissue, in the kinds cancer comprising melanoma, mammary cancer, colorectal carcinoma, the esophageal carcinoma, head and neck cancer, cancer of the stomach, prostate cancer and lung cancer, all can find the unconventionality expression of CK19 at present, particularly it has higher expression amount, Sensitivity and Specificity in mammary cancer.

In addition, in malignant progression process, usually and deposit tumour cell and be spread in the tissues such as lymphsystem, blood circulation, marrow, liver, kidney or organ, micro metastasis is formed, it is without any clinical manifestation, is also difficult to find in routine inspection and common pathology check.CK19, as one of the mark of correlation thing of Metastasis in Breast Cancer, has been widely used in Metastasis in Breast Cancer in sentinel lymph node, peripheral blood and marrow and has detected and in cancer prognosis diagnosis.Utilize it to carry out micrometastasis detection to sentinel lymph node clinically, can diagnostic accuracy be improved, thus change the Treatment decsion to a part of patient.Particularly when carrying out ALND according to traditional mammary cancer surgery standard to patient, the patient to not yet there is axillary lymphatic metastasis can be avoided to carry out unnecessary traditional operation, in case over-treatment is to disadvantageous effects such as many complication that patient causes.

Method at present for detecting tumour cell in lymphoglandula and marker mainly comprises immunohistochemistry staining method, flow cytometry, immune radiating method, Southern blot, ELISA, Real Time-PCR, RT-PCR etc., wherein RT-PCR method detection time is short, detection sensitivity is high, it utilizes tomour specific expressing gene, can from 10 ⁷1 cancer cells detected in individual peripheral blood cells or myelomonocyte, the detection sensitivity of this technology is more than 10 times of immunohistochemistry staining method, is particularly suitable for applying in operation.Along with going deep into of research, increasing result shows that RT-PCR also can detect false positive Metastasis in Breast Cancer in normal SLN.Therefore, the marker gene multiple RT-PCR technology carrying out detecting that combines with reference gene is utilized to become the focus utilizing CK19 to detect Metastasis in Breast Cancer research gradually.

As the publication number Chinese invention patent that is CN101432437A discloses a kind of method of existence of diagnosing mammary cancer or the process of prediction mammary cancer, what comprise that measurement comprises the marker gene of tissue-specific gene (mammaglobin) and non-tissue-specific gene (CK19) is combined in the expression be derived from the cell or tissue sample of patient, and adopt PBGD in contrast, also provided is relevant test kit, primer and probe sequence.But it needs to use MG and CK19 two kinds of goal gene to carry out detection can obtain good sensitivity and specificity simultaneously, operation and result judge relative complex.

And for example publication number is the method that the Chinese invention patent of CN101365800A discloses the CK-19mRNA positive cell quantitatively determined in biological sample, and it utilizes Auele Specific Primer and probe to carry out reverse transcription and qPCR reaction respectively after extraction peripheral blood lymphocytes RNA.But it adopts two-step approach to detect, not only the operating time is long, operation relative complex, but also is easy to produce pollution.Publication number is that the Chinese invention patent of CN101054603A discloses a kind of method for Fast Measurement CK19mRNA and primer thereof and probe, use be positioned at the area hybridization on the First Exon of CK19 gene the first primer and be positioned at First Exon downstream CK19 gene Second Exon on the part of the second primer amplification CK19mRNA of area hybridization, then use the probe in detecting amplified material of two types.This method is short for detection time, can get rid of the interference of people DNA or CK19 pseudogene preferably, but its sensitivity and specificity need further research.

Summary of the invention

Primary and foremost purpose of the present invention be for above-mentioned prior art Problems existing provide a kind of fast and have compared with high specific, susceptibility and repeatability for detecting the primer of CK19mRNA expression amount, probe and detection method and test kit, the inventive method and test kit may be used for assessment of cancer patient (particularly patient with breast cancer) cancer focus transfer case, thus can provide important reference frame for the determination of the early diagnosis of cancer, transfer, recurrence and treatment plan.

In order to achieve the above object, one aspect of the present invention provides a kind of the first primer for detecting CK19mRNA expression amount, comprise the first forward primer and the first reverse primer, the base sequence of wherein said first forward primer is as shown in SEQ ID NO:1, and the base sequence of described first reverse primer is as shown in SEQ ID NO:2.

The present invention provides a kind of the first probe for detecting CK19mRNA expression amount on the other hand, and the base sequence of described first probe is as shown in SEQ ID NO:3, and 5 ' end of described first probe is marked with reporter fluorescence group, and 3 ' end is marked with quenching fluorescence group.

Particularly, described reporter fluorescence group is FAM fluorophor, and described quenching fluorescence group is BHQ1 fluorophor.

Further aspect of the present invention provides a kind of test kit for detecting CK19mRNA expression amount, comprising:

For detecting the first primer of CK19mRNA expression amount, comprise the first forward primer and the first reverse primer, the base sequence of wherein said first forward primer is as shown in SEQ ID NO:1, and the base sequence of described first reverse primer is as shown in SEQ ID NO:2; And

For detecting the first probe of CK19mRNA expression amount, the base sequence of described first probe is as shown in SEQ IDNO:3, and 5 ' end of described first probe is marked with reporter fluorescence group, and 3 ' end is marked with quenching fluorescence group.

Wherein, the reporter fluorescence group on described first probe is FAM fluorophor, and quenching fluorescence group is BHQ1 fluorophor.

Particularly, described test kit comprises CK19 primed probe mixed solution, and it contains 0.4 μM of first forward primer, 0.4 μM of first reverse primer and 0.2 μM of first probe.

Wherein, described test kit also comprises:

For detecting the second primer of reference gene ACTB mrna expression amount, wherein said second primer comprises the second forward primer and the second reverse primer, the base sequence of described second forward primer is as shown in SEQ ID NO:4, and the base sequence of described second reverse primer is as shown in SEQ ID NO:5; And

For detecting the second probe of reference gene ACTB mrna expression amount, the base sequence of wherein said second probe is as shown in SEQ ID NO:6, and 5 ' end of described second probe is marked with reporter fluorescence group, and 3 ' end is marked with quenching fluorescence group.

Particularly, the reporter fluorescence group on described second probe is HEX fluorophor, and quenching fluorescence group is BHQ1 fluorophor.

Especially, described test kit comprises ACTB primed probe mixed solution, and it contains second forward primer of 0.4 μM of-10nM, second probe of second reverse primer of 0.4 μM of-10nM and 0.4 μM of-10nM, preferably include 20nM second forward primer, 20nM second reverse primer and 10nM second probe.

Wherein, described test kit also comprises the reagent carried out needed for real-time fluorescence quantitative RT-PCR, and these reagent all can obtain from commercial channels.

Test kit of the present invention also can carry out supporting the use rapid detection CK19mRNA expression amount with RT-PCR kit, and described RT-PCR kit is preferably Rotor-Gene Multiplex RT-PCR Kit.

When supporting the use with RT-PCR kit, this test kit only can comprise above-mentioned the first primer for detecting CK19mRNA expression amount and the first probe, can also comprise above-mentioned the second primer for detecting reference gene ACTBmRNA expression amount and the second probe.

Further aspect of the present invention provides the application of a kind of mentioned reagent box in rapid detection CK19mRNA expression amount.

Particularly, described application comprises: utilize described test kit to adopt real-time fluorescence quantitative RT-PCR to detect sample CK19mRNA expression amount.

Further aspect of the present invention provides a kind of test kit for detecting patient with breast cancer CK19mRNA expression amount, comprises described first primer and described first probe.

Particularly, the described test kit for detecting patient with breast cancer CK19mRNA expression amount comprises described second primer and described second probe further.

Further aspect of the present invention provides a kind of method for detecting CK19mRNA expression amount, comprises the steps:

A) by using the first primer described in claim 1 to carry out the CK19mRNA of amplified sample, the amplified material of CK19mRNA is formed;

B) by using the amplified material of CK19mRNA described in the first probe in detecting described in claim 2 or 3, the expression amount of CK19mRNA is obtained.

Particularly, before amplified sample CK19mRNA, first from sample, extracting total serum IgE, is then the CK19mRNA that template carrys out amplified sample with total serum IgE.

Wherein, the described method for detecting CK19mRNA expression amount also comprises:

C) use second forward primer of base sequence as shown in SEQ ID NO:4 and the reference gene ACTB mRNA of the second reverse primer amplified sample of base sequence as shown in SEQ IDNO:5, form the amplified material of ACTB mRNA;

D) use the amplified material of ACTB mRNA as described in second probe in detecting of base sequence as shown in SEQ ID NO:6, obtain the expression amount of ACTB mRNA.

The method of the invention using internal reference Gene A CTB as reference, can effectively be avoided false-negative generation, thus have stronger suitability while detection sample CK19mRNA expression amount.

Particularly, the inventive method adopts Rotor-Gene Q real-time fluorescence quantitative PCR instrument to carry out.

Especially, the inventive method adopts Rotor-Gene Multiplex RT-PCR Kit test kit to carry out described amplification, and amplification reaction system is: 2X Rotor-Gene Multiplex RT-PCR Master Mix:12.5 μ L; 20XCK19 primed probe mixed solution: 1.25 μ L; 20X ACTB primed probe mixed solution: 1.25 μ L; ReverseTranscriptase Mix:0.25 μ L; RNA:1 μ L; DEPC water: 8.75 μ L; Reaction cumulative volume is 25 μ L.

Wherein, containing 0.4 μM of first forward primer in described 20X CK19 primed probe mixed solution, 0.4 μM of first reverse primer and 0.2 μM of first probe; Containing 20nM second forward primer in described 20X ACTB primed probe mixed solution, 20nM second reverse primer and 10nM second probe;

Particularly, the reaction conditions of described amplification is: 50 DEG C of reverse transcription 5min, 95 DEG C are activated HotStarTaq PlusDNA Polymerase(and are included in Reverse Transcriptase Mix) 30s, 40 circulations: 95 DEG C of sex change 1s, 60 DEG C extend 6s(fluorescence signal collection).

The accompanying software of Rotor-GeneQ real-time fluorescence quantitative PCR instrument is adopted to carry out the analysis of Ct value to data results of the present invention, wherein: CK19Ct≤30, ACTB Ct≤36 are positive sample; CK19Ct > 30, ACTB Ct≤36 are negative sample; ACTB Ct > 36 is invalid sample.

Particularly, sample of the present invention comprises containing of all biogenetic derivations or suspects the material containing CK19, as blood, marrow, lymphoglandula, tumour cell, mammary tissue etc.; Described sample is preferably people's sentinel lymph node, people's tumour or people's mammary gland, more preferably people's sentinel lymph node.

Relative to prior art, the present invention has the following advantages:

1, CK19 primer of the present invention and probe is adopted to carry out the multiple qRT-PCR amplification of single stage method, the expression of CK19mRNA in sample can be detected specifically, its detection speed is fast, detection sensitivity is high, and it is simple to operate, within about 40 minutes, whole operation can be completed, be particularly suitable for carrying out rapid detection in operation;

2, the inventive method adopts reference gene ACTB as reference simultaneously, reference gene ACTB mrna expression is stablized, not only can effectively avoid false-negative generation, but also can correct the expression amount of goal gene preferably, thus improving sensitivity and the repeatability of the method, detected result is more accurately and reliably;

3, the inventive method specificity is good, and has higher accuracy and sensitivity, the CK19mRNA specific amplification being low to moderate 100pg/ μ L can be detected, can be applicable to, in the correlation detection using CK19 as marker, have wide range of applications; Particularly may be used for assessment patient with breast cancer cancer focus transfer case, thus important reference frame can be provided for the determination of the early diagnosis of mammary cancer, transfer, recurrence and treatment plan.

Accompanying drawing explanation

Fig. 1 is the typical curve of CK19mRNA;

Fig. 2 is the typical curve of ACTB mRNA;

Fig. 3 is the amplification curve of patient with breast cancer's sentinel lymph node tissue samples CK19mRNA;

Fig. 4 is the amplification curve of patient with breast cancer's sentinel lymph node tissue samples ACTB mRNA;

Fig. 5 is the detected through gel electrophoresis figure of the primer pair 1-6PCR amplified production in reference examples 1;

Fig. 6 is the detected through gel electrophoresis figure of the primer pair 7-10PCR amplified production in reference examples 1;

Fig. 7 is the amplification curve of the CK19mRNA of employing primer pair 1,3,5,6,8,9 in reference examples 1;

Fig. 8 is the amplification curve of CK19mRNA in specific amplification test;

Fig. 9 is the amplification curve of ACTB mRNA in specific amplification test;

Figure 10 is the amplification curve of CK19mRNA in amplification sensitivity tests;

Figure 11 is the amplification curve of ACTB mRNA in amplification sensitivity tests;

Figure 12 is the amplification curve of CK19mRNA in amplification reperformance test;

Figure 13 is the amplification curve of ACTB mRNA in amplification reperformance test;

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiments are only exemplary, do not form any restriction to scope of the present invention.It will be understood by those skilled in the art that and can modify to the details of technical solution of the present invention and form or replace down without departing from the spirit and scope of the present invention, but these amendments and replacement all fall within the scope of protection of the present invention.

Embodiment

One, material

1, experiment sample: four routine patient with breast cancer's sentinel nodal tissues, derive from Beijing hospital;

2, total RNA extraction reagent box: RNeasy Mini Kit is purchased from QIAGEN(Cat.74104);

3, the multiple qRT-PCR test kit of single stage method: Rotor-Gene Multiplex RT-PCR Kit is purchased from QIAGEN(Cat.204972);

4, for detecting the first primer and first probe of CK19mRNA expression amount, sequence is as follows, is synthesized and mark by QIAGEN company;

First forward primer: 5 '-CCATTGAGAACTCCAGGATT-3 ' (SEQ ID No.1)

First reverse primer: 5 '-CCCTGCGCAGGCCGTTGATGT-3 ' (SEQ ID No.2)

First probe: 5 '-FAM-ACAATGCCCGTCTGGCTGCAGA-BHQ1-3 ' (SEQ ID No.3)

5, for detecting the second primer and second probe of reference gene ACTB mrna expression amount, sequence is as follows, is synthesized and mark by QIAGEN company;

Second forward primer: 5 '-TCACCCACACTGTGCCCATCTA-3 ' (SEQ ID No.4)

Second reverse primer: 5 '-GCCGCGCTCGGTGAGGATCTT-3 ' (SEQ ID No.5)

Second probe: 5 '-HEX-TCCCCCATGCCATCCTGCGTCT-BHQ1-3 ' (SEQ ID No.6)

6, positive reference substance: human breast cancer cell total serum IgE, Breast adenocarcinoma(MCF-7) total RNA, purchased from Ambion(Cat.AM7846), its concentration is 50ng/ μ L.

7, negative controls: people's spleen total serum IgE, Human spleen total RNA, purchased from Ambion(Cat.AM7970), its concentration is 50ng/ μ L.

Two, CK19mRNA expression amount measuring method

In Rotor-Gene Q real-time fluorescence quantitative PCR instrument, adopt Rotor-Gene Multiplex RT-PCR Kit test kit to carry out the multiple qRT-PCR amplification of single stage method, wherein amplification reaction system is:

2X Rotor-Gene Multiplex RT-PCR Master Mix:12.5 μ L; 20X CK19 primed probe mixed solution: 1.25 μ L; 20X ACTB primed probe mixed solution: 1.25 μ L; Reverse Transcriptase Mix:0.25 μ L; RNA:1 μ L; DEPC water: 8.75 μ L; Reaction cumulative volume is 25 μ L; Wherein, containing 0.4 μM of first forward primer in 20X CK19 primed probe mixed solution, 0.4 μM of first reverse primer and 0.2 μM of first probe; Containing 20nM second forward primer in 20XACTB primed probe mixed solution, 20nM second reverse primer and 10nM second probe;

Amplification reaction condition is: 50 DEG C of reverse transcription 5min, 95 DEG C are activated HotStar Taq Plus DNA Polymerase(and are included in Reverse Transcriptase Mix) 30s, 40 circulations: 95 DEG C of sex change 1s, 60 DEG C extend 6s(fluorescence signal collection);

The accompanying software of Rotor-Gene Q real-time fluorescence quantitative PCR instrument is adopted to analyze data results.

Three, people's sentinel lymph node sample CK19mRNA expression amount is measured

1, production standard curve

Positive reference substance (MCF-7 total serum IgE) is mixed in table 3 ratio with negative controls (people's spleen total serum IgE), obtained sample 1-7, then get 1 μ L respectively and carry out single stage method qRT-PCR amplification according to the method described above, the typical curve made is shown in Fig. 1, Fig. 2, wherein X-coordinate represents RNA concentration, and ordinate zou represents Ct value.

Table 1 typical curve sample moiety and content

Sample	1	2	3	4	5	6	7
								MCF-7 total serum IgE (%)	100	90	70	50	30	10	0
People's spleen total serum IgE (%)	0	10	30	50	70	90	100

2, CK19mRNA expression amount is measured

Get each 30mg of four routine human breast carcinoma patient sentinel nodal tissue clinical sample 1-4, ordinary method is adopted to utilize RNeasy Mini Kit test kit to extract total serum IgE, the total serum IgE of obtained human breast carcinoma patient sentinel nodal tissue clinical sample 1-4 respectively, adopt BioPhotometer nucleic acid-protein determinator to detect its concentration, the results are shown in Table 4;

According to the method described above with the total serum IgE of human breast carcinoma patient sentinel nodal tissue clinical sample 1-4 for template carries out single stage method multiple qRT-PCR amplification, in contrast with positive reference substance and negative controls, measurement result is in table 4 and Fig. 3, Fig. 4 simultaneously.

CK19mRNA expression amount in table 2 human breast carcinoma patient sentinel nodal tissue clinical sample

Sample ID	Total rna concentration (ng/ μ l)	CK19Ct value	ACTBCt value
				Positive reference substance	50	18.13	12.38
Sample 1	164.7	22.33	15.14
				Sample 2	148.1	22.87	15.49
Sample 3	39.6	21.32	14.76
				Sample 4	24.3	23.13	15.33
Negative controls	50	31.69	18.80

As seen from the results in Table 2: adopt the sentinel lymph node tissue samples of the inventive method to four routine human breast carcinoma patients to carry out the detection of CK19mRNA expression amount, detected result shows according to the analysis of Ct value: four routine patient with breast cancer's results are positive sample, in addition positive reference substance detected result is positive, negative controls detected result is negative, illustrate that the inventive method can detect that CK19mRNA's in the sentinel nodal tissue of human breast carcinoma patient is specific expressed, and specificity is good, accuracy is high, can be applicable in the correlation detection using CK19 as marker, particularly be applied to and rapidly the CK19mRNA expression amount of patient with breast cancer detected in art, thus the transfer of assessment patient with breast cancer cancer focus, for the early diagnosis of mammary cancer, transfer, the determination of recurrence and treatment plan provides important reference frame.

Reference examples 1 10 kinds contrast primer amplification Performance comparision

1. adopt One step RT-PCR to carry out primer screening

10 kinds, for detecting primer and the probe thereof of CK19mRNA expression amount, are synthesized by Life-Tech company, and its base sequence is as follows:

Primer pair 1 and probe:

Forward primer F (5'-3'): AGATGAGCAGGTCCGAGGTTA (SEQ ID No.8)

Reverse primer R (5'-3'): CCTGATTCTGCCGCTCACTATCA (SEQ ID No.9)

Probe (5'-3'): ACCCTTCAGGGTCTTGAGATT (SEQ ID No.10)

Primer pair 2 and probe:

Forward primer F (5'-3'): TCGACAACGCCCGTCTG (SEQ ID No.11)

Reverse primer R (5'-3'): CCACGCTCATGCGCAG (SEQ ID No.12)

Probe (5'-3'): CCGAACCAAGTTTGAGACGGAACAGG (SEQ ID No.13)

Primer pair 3 and probe:

Forward primer F (5'-3'): CCCGCGACTACAGCCACTA (SEQ ID No.14)

Reverse primer R (5'-3'): CTCATGCGCAGAGCCTGTT (SEQ ID No.15)

Probe (5'-3'): ACCATTGAGAACTCCAGGATTGTCC (SEQ ID No.16)

Primer pair 4 and probe:

Forward primer F (5'-3'): AGATCGACAACGCCCGT (SEQ ID No.17)

Reverse primer R (5'-3'): AGAGCCTGTTCCGTCTCAAA (SEQ ID No.18)

Probe (5'-3'): TGGCTGCAGATGACTTCCGAACC (SEQ ID No.19)

Primer pair 5 and probe:

Forward primer F (5'-3'): CAGATCGAAGGCCTGAAGGA (SEQ ID No.20)

Reverse primer R (5'-3'): CTTGGCCCCTCAGCGTACT (SEQ ID No.21)

Probe (5'-3'): GCCTACCTGAAGAAGAACCATGA (SEQ ID No.22)

Primer pair 6 and probe: i.e. the first primer used in the present invention and probe

First forward primer: 5 '-CCATTGAGAACTCCAGGATT-3 ' (SEQ ID No.1)

First reverse primer: 5 '-CCCTGCGCAGGCCGTTGATGT-3 ' (SEQ ID No.2)

First probe: 5 '-FAM-ACAATGCCCGTCTGGCTGCAGA-BHQ1-3 ' (SEQ ID No.3)

Primer pair 7 and probe:

Forward primer F (5'-3'): ACCATTGAGAACTCCAGGATTGTC (SEQ ID No.23)

Reverse primer R (5'-3'): CTCATGCGCAGAGCCTGTT (SEQ ID No.24)

Probe (5'-3'): CAGATGACTTCCGAACCAAGTTTG (SEQ ID No.25)

Primer pair 8 and probe:

Forward primer F (5'-3'): ATTCCGCTCCGGGCACC (SEQ ID No.26)

Reverse primer R (5'-3'): GCAGCTCAATCTCAAGACCC (SEQ ID No.27)

Probe (5'-3'): GGATGCTGAAGCCTGGTTCA (SEQ ID No.28)

Primer pair 9 and probe:

Forward primer F (5'-3'): CATGAAAGCTGCCTTGGAAGA (SEQ ID No.29)

Reverse primer R (5'-3'): TGATTCTGCCGCTCACTATCAG (SEQ ID No.30)

Probe (5'-3'): GCATATCCAGGCGCTGATCA (SEQ ID No.31)

Primer pair 10 and probe:

Forward primer F (5'-3'): ATTCCGCTCCGGGCACC (SEQ ID No.32)

Reverse primer R (5'-3'): CGCTGATCAGCGCCTG (SEQ ID No.33)

Probe (5'-3'): GGATGCTGAAGCCTGGTTCA (SEQ ID No.34)

By above-mentioned 10 kinds of primers and probe thereof, use ABI9700PCR instrument, adopt Rotor-Gene MultiplexRT-PCR Kit test kit to carry out One step RT-PCR amplification, wherein amplification reaction system is:

2X Rotor-Gene Multiplex RT-PCR Master Mix:12.5 μ L; Reverse Transcriptase Mix:0.25 μ L; Final concentration is the forward primer F of 0.4uM, and final concentration is the reverse primer R of 0.4uM; MCF-7 total serum IgE 1uL; DEPC water supplies reaction cumulative volume to 25 μ L.

Amplification program is: 50 DEG C of reverse transcription 5min, 95 DEG C are activated HotStar Taq Plus DNA Polymerase(and are included in Reverse Transcriptase Mix) 30s, 40 circulations: (72 DEG C extend 30s for 94 DEG C of sex change 30s, 57 DEG C of annealing 30s); 72 DEG C extend 10min;

Often pair of primer pair all does multiple pipe.

Table 3

Number in Fig. 5 and Fig. 6

Primer pair

Result

1	Primer pair 1	There is amplification
			2	Primer pair 1	There is amplification
3	Primer pair 2	Without amplification
			4	Primer pair 2	Without amplification
5	Primer pair 3	There is amplification
			6	Primer pair 3	There is amplification
7	Primer pair 4	Without amplification
			8	Primer pair 4	Without amplification
9	Primer pair 5	There is amplification (weak)
			10	Primer pair 5	There is amplification (weak)
11	Primer pair 6	There is amplification
			12	Primer pair 6	There is amplification
13	Primer pair 7	Without amplification
			14	Primer pair 7	Without amplification
15	Primer pair 8	There is amplification
			16	Primer pair 8	There is amplification
17	Primer pair 9	There is amplification
			18	Primer pair 9	There is amplification
19	Primer pair 10	Without amplification
			20	Primer pair 10	Without amplification

Amplified production is carried out detected through gel electrophoresis, and detected result is as shown in Fig. 5, Fig. 6 and table 3, and wherein in Fig. 5 and Fig. 6, M is depicted as 100bp DNA Ladder Marker(purchased from TaKaRa company, article No. 3422A).Result shows: by above-mentioned amplification, and only primer pair 1,3,5,6,8,9 has amplification, and all the other primer pairs are without amplification.

Two, single stage method RT-qPCR screening is carried out to 6 pairs of primers that single stage method reverse transcription PCR filters out

In Rotor-Gene Q real-time fluorescence quantitative PCR instrument, adopt Rotor-Gene Multiplex RT-PCR Kit test kit to carry out single stage method RT-qPCR amplification, wherein amplification reaction system is:

2X Rotor-Gene Multiplex RT-PCR Master Mix:12.5 μ L; 20X CK19 primed probe mixed solution: 1.25 μ L; Reverse Transcriptase Mix:0.25 μ L; MCF-7 total serum IgE 1uL; DEPC water supplies reaction cumulative volume to 25 μ L; Wherein, 0.4 μM of first forward primer, 0.4 μM of first reverse primer and 0.2 μM of first probe is contained in 20X CK19 primed probe mixed solution.

Amplification reaction condition is: 50 DEG C of reverse transcription 5min, and 95 DEG C are activated HotStarTaq Plus DNA Polymerase(and are included in Reverse Transcriptase Mix) 30s, 40 circulations: 95 DEG C of sex change 1s, 60 DEG C extend 6s(fluorescence signal collection);

Adopt the accompanying software of Rotor-Gene Q real-time fluorescence quantitative PCR instrument to analyze data results, detected result as shown in Figure 7.

As shown in Figure 7, above-mentioned 6 amplification curves are corresponding in turn to primer pair and probe is 6,3,1,8,9,5, and its Ct value becomes large successively.So from the angle of detection efficiency, the primer pair 6 that the present invention selectes is optimal selections.In patent document to the sensitivity of primer pair 6 and probe thereof, special etc. in be described in detail.

Test example 1 specific amplification is tested

Sample 1 is 100%MCF-7 total serum IgE sample, and sample 2 is the mixing sample of 70%MCF-7 total serum IgE and 30% people's spleen total serum IgE, and sample 3 is the mixing sample of 30%MCF-7 total serum IgE and 70% people's spleen total serum IgE, and sample 4 is 100% people's spleen total serum IgE sample;

Sample 1-4 is carried out according to the method described above the multiple qRT-PCR amplification of single stage method, amplification curve as shown in Figure 8, Figure 9, amplification shows: use primer of the present invention and probe, the specific amplification of CK19 gene accurately can be detected in tumor tissues extract, and in nonneoplastic tissue, there will not be the remarkable amplification of this gene, illustrate that primer of the present invention and probe can carry out specific amplification to CK19 gene thus, and specificity is good.

Test example 2 increases sensitivity tests

Positive reference substance MCF-7 total serum IgE is diluted, obtained concentration is the sample 1-5 of 50ng/ μ L, 10ng/ μ L, 1000pg/ μ L, 100pg/ μ L and 50pg/ μ L respectively, carry out the multiple qRT-PCR amplification of single stage method according to the method described above, test result is in table 4, amplification curve is shown in Figure 10, Figure 11, result shows: use primer of the present invention and probe the CK19mRNA specific amplification being low to moderate 100pg/ μ L can be detected, illustrate that the inventive method susceptibility is good, highly sensitive.

Table 4 increases susceptibility results

Specimen coding	Sample concentration	CK19Ct value	ACTB Ct value
				1	50ng/μL	17.11	21.04
2	10ng/μL	18.01	21.52
				3	1000pg/μL	19.97	22.09
4	100pg/μL	20.50	22.25
				5	50pg/μL	29.13	23.38

Test example 3 increases reperformance test

MCF-7 total serum IgE by sample 1(50ng/ μ L) and the MCF-7 total serum IgE of sample 2(100pg/ μ L) carry out the multiple qRT-PCR amplification of single stage method according to the method described above, each sample repeated test three times, test result is in table 5, amplification curve is shown in Figure 12, Figure 13, result shows: the inventive method accuracy is good, and multiplicity is high.

Table 5 increases repeated result

Claims (4)

1. for detecting a test kit for CK19mRNA expression amount, it is characterized in that, comprising:

For detecting the first primer of CK19mRNA expression amount, wherein said first primer comprises the first forward primer and the first reverse primer, the base sequence of described first forward primer is as shown in SEQ ID NO:1, and the base sequence of described first reverse primer is as shown in SEQ ID NO:2;

For detecting the first probe of CK19mRNA expression amount, the base sequence of wherein said first probe is as shown in SEQ ID NO:3, and 5 ' end of described first probe is marked with reporter fluorescence group, and 3 ' end is marked with quenching fluorescence group;

And ThermoScript II mixed solution, wherein said ThermoScript II mixed solution comprises ThermoScript II reverse transcriptasewith warm start archaeal dna polymerase HotStarTaq Plus DNA Polymerase.

2. test kit as claimed in claim 1, it is characterized in that, the reporter fluorescence group of described first probe is FAM fluorophor, and the quenching fluorescence group of described first probe is BHQ1 fluorophor.

3. test kit as claimed in claim 1, is characterized in that, also comprise:

For detecting the second primer of reference gene ACTB mrna expression amount, wherein said second primer comprises the second forward primer and the second reverse primer, the base sequence of described second forward primer is as shown in SEQ ID NO:4, and the base sequence of described second reverse primer is as shown in SEQ ID NO:5; And

For detecting the second probe of reference gene ACTB mrna expression amount, the base sequence of wherein said second probe is as shown in SEQ ID NO:6, and 5 ' end of described second probe is marked with reporter fluorescence group, and 3 ' end is marked with quenching fluorescence group.

4. test kit as claimed in claim 3, it is characterized in that, the reporter fluorescence group of described second probe is HEX fluorophor, and the quenching fluorescence group of described second probe is BHQ1 fluorophor.