CN112391478B - Application of exosome mRNA in diagnosis of breast diseases - Google Patents

Abstract

The invention relates to the field of biomedical diagnosis, in particular to application of exosome mRNA in diagnosis of breast diseases. The method can be used for identifying the quality and the malignancy of the breast nodule patient, effectively distinguishing the breast cancer from other malignant tumors to realize accurate diagnosis of the breast cancer, and can monitor the treatment effect of the patient. The invention discovers that the exosome mRNA marker can be used for diagnosing the breast diseases for the first time.

Description

Application of exosome mRNA in diagnosis of breast diseases

Technical Field

The invention relates to the field of biomedical diagnosis, in particular to application of exosome mRNA in diagnosis of breast diseases.

Background

Breast cancer (breast cancer) is one of the most common malignant tumors in women, the incidence rate accounts for 7-10% of various malignant tumors in the whole body, and the breast cancer is second to uterine cancer in women and becomes a main cause threatening the health of women. Its onset is often genetically related and the incidence of disease is higher in women between the ages of 40-60, before and after menopause. It is one of the most common malignant tumors that usually occur in mammary gland epithelial tissues and seriously affect women's physical and mental health and even endanger life. Breast cancer is rare in men, and only about 1-2% of breast patients are males.

In recent years, the incidence rate of breast cancer in China is on a rapid rising trend, and the breast cancer is the top of all tumors of women. Because the cause of breast cancer is not clear, early diagnosis and early comprehensive treatment are the most effective means for preventing and treating breast cancer. It has been shown that the smaller the primary focus, the better the prognosis. The 10-year survival rates of the T4, T3, T2 and T1 breast cancers are 19.7%, 46.0%, 62.6% and 87.8% respectively. The overall survival rate of the micro-cancer with the diameter less than 1cm in 10 years is 90-99%.

At present, the prior early warning and early diagnosis technologies for breast cancer in China mainly comprise the following four technologies:

1. clinical physical examination: regular clinical physical examination is one of the effective methods for early detection of breast cancer. China also develops a series of prevention works of breast cancer, but the general investigation of breast cancer is huge in cost and high in cost/effect ratio.

2. Imaging diagnosis: the imaging examination is mainly performed by molybdenum target X-ray radiography and is assisted by ultrasonic scanning and MRI scanning. The molybdenum target X-ray radiography method can find fine calcifications, but is easy to make missed diagnosis for atypical lesions, especially for dense breast lesions and lesions close to the chest wall. A study reported in the famous British journal of medicine issued 2/11/2014 that annual breast molybdenum target X-ray examination of women 40-59 years old did not reduce the mortality of breast cancer, nor outperformed the diagnosis of general physical examination, and 22% of women were over-diagnosed due to breast molybdenum target X-ray examination (British medical journal,2014,348.). In addition, the mammary gland of female in China is small and compact, which can reduce the positive rate of molybdenum target examination of patients.

3. Early detection of biological targets: the method comprises the mutation analysis of the breast cancer related gene general survey, such as BRCA1 and BRCA2, but most of the current molecular diagnosis researches concern the relationship between the gene polymorphism and the breast cancer, only can provide the susceptibility risk of a patient, and are not suitable for the diagnosis of clinical diseases. In addition, the most common clinical breast cancer serum tumor markers include CA-153, CEA, CA-125 and the like, although the tumor markers can reflect the disease state to a certain extent, the specificity is not high, and the tumor markers can correspondingly exist in other tumors, such as ovarian cancer, pelvic tumor, gastric cancer, colon cancer, liver cancer and the like. CA-153 sensitivity is only reported to be about 50%, expression level in early breast cancer patients is often low, specificity is not high, and the early screening of breast cancer is limited.

4. Puncture biopsy: the pathological examination accuracy of the breast tissue aspiration biopsy is higher, but the invasive operation also can generate false negative results due to insufficient specimen material drawing or different results due to different material drawing parts and the influence of heterogeneity in breast cancer tumors.

In general terms: the following disadvantages exist for the screening of breast nodules: (1) the clinical examination cost is high; (2) the positive omission rate of the imaging diagnosis method is high; (3) at present, the mature biological target can only be used for risk assessment and is not suitable for clinical diagnosis; (4) the needle biopsy is firstly invasive, and has high requirements for a sampler and a puncture site, and different results are easily caused by the influence of external factors. Therefore, there is an urgent need in the art to establish a new breast nodule detection technology, which can diagnose breast cancer objectively, sensitively and stably in an early stage so as to perform timely and targeted treatment, improve the survival quality and survival rate of patients, reduce the medical cost and save social resources.

Disclosure of Invention

Exosomes are generally considered as a class of extracellular vesicles 30-150nm in diameter with intact membrane structures, primarily responsible for substance transport and information transfer between cells, in which cell-specific proteins, lipids and nucleic acids are encapsulated. Existing studies indicate that exosomes play important roles in many physiopathological processes, such as antigen presentation, tumor growth and metastasis, etc. All cells secrete exosomes, whereas tumor cells secrete more exosomes than normal cells.

At present, the research on the correlation between exosomes and cancers is mostly based on the research on exosome MicroRNA and LncRNA, and the correlation between exosome proteins and ovarian cancer and prostate cancer is also reported in some documents^[1-2]. There are few reports on Exosome mRNA studies, representative of which is Exosome Diagnostics, which study prostate cancer based on urine Exosome mRNA^[3]. There has been no study of the association of exosome mrnas with breast cancer for the moment.

Members of the ENAH gene family are involved in actin movement and belong to members of the Ena/VASP protein family. It plays a key role in actin polymerization, and participates in the regulation of actin filament assembly and cell adhesion and movement. ENAH genes have different splice bodies and transcripts, of which MenaINV and 11a are the most studied. Sumanta^[4]It was found that MenaINV expression was increased and 11a expression was decreased in invasive breast cancer cells. Evanthia T^[5]Et al reported that ENAH was expressed in total and one subtype (M) in invasive breast cancer cellsenaINV), either at the protein or mRNA level, late metastatic cancer is expressed at a higher level than early cancer.

The prior reports about ENAH mRNA mainly comprise tumor cells and model organisms (tumor cell-planted mice) cultured in vitro, rarely adopt obtained human breast cancer tissues or nipple aspirates, and have no reports about expression conditions in exosomes and correlation with breast cancer.

The invention researches the expression level of ENAH mRNA of exosome and simultaneously researches the correlation between the total type and two subtypes MenaINV and 11a of exosome and breast diseases. The expression quantity of two subtypes in exosome is low, the sample detection rate is low, the detection effect has no detection significance, and the total type detection has diagnostic significance.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

the application of the detection agent in preparing a reagent or a kit for breast cancer diagnosis, disease course monitoring and prognosis evaluation;

the detection agent comprises a first detection agent for detecting ENAH mRNA, wherein an increased amount of ENAH mRNA expression is indicative of the severity of breast cancer;

the ENAH mRNA is the total mRNA, which is the sum of the mRNA of the different transcripts of ENAH in the exosomes to be detected.

According to still another aspect of the present invention, it also relates to a diagnostic kit for breast cancer, which contains a detection agent as defined above.

The invention has the beneficial effects that:

1. the invention can complete the identification of breast nodules, auxiliary diagnosis of breast cancer and disease course monitoring.

2. The method can be used for screening and identifying the suspected lesion patients, and can solve the problem of early-stage malignant nodules of the mammary gland which cannot be confirmed by the imaging.

3. The exosome ENAH mRNA marker is found to be used for identifying benign and malignant breast nodules of a human body, assisting in diagnosis of breast cancer and monitoring the course of disease for the first time.

Reference documents:

[1]Jayanthi Lea,Detection of phosphatidylserine-positive exosomes as a diagnostic marker for ovarian malignancies: a proof of concept study.Oncotarget, 2017, Vol. 8, (No. 9), 14395-14407

[2]Mariantonia Logozzi.Increased Plasmatic Levels of PSA-Expressing Exosomes Distinguish Prostate Cancer Patients from Benign Prostatic Hyperplasia:A Prospective Study Cancers 2019,11,1449;doi:10.3390/cancers11101449

[3]James McKiernan.A Prospective Adaptive Utility Trial to Validate Performance of a Novel Urine Exosome Gene Expression Assay to Predict High-grade Prostate Cancer in Patients with Prostate-specific Antigen 2–10 ng/ml at Initial Biopsy.EURURO-7980; No. of Pages 8

[4]Sumanta Goswami,Identification of invasion specific splice variants of the cytoskeletal protein Mena present in mammary tumor cells during invasion in vivo.Clin Exp Metastasis (2009) 26:153-159

[5]Evanthia T.Mena invasive (MenaINV) and Mena11a isoforms play distinct roles in breast cancer cell cohesion and association with TMEM.Clin Exp Metastasis (2011) 28:515-527。

drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a graph of the NTA results of plasma exosomes according to one embodiment of the present invention;

FIG. 2 is a graph illustrating the change in the expression level of a target before and after surgery in accordance with an embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The invention relates to the application of a detection agent in preparing a reagent or a kit for breast cancer diagnosis, disease course monitoring and prognosis evaluation;

the detection agent comprises a first detection agent for detecting ENAH mRNA, wherein an increased amount of ENAH mRNA expression is indicative of the severity of breast cancer;

the ENAH mRNA is the total mRNA, which is the sum of the mRNA of the different transcripts of ENAH in the exosomes to be detected.

Any sample containing exosomes may be used as the test sample in the present application, and exemplary samples may be cell culture supernatant, blood samples (whole blood, serum, plasma), milk, nipple aspirates, nipple discharge, interstitial fluid, lymph fluid, or clarified lysate obtained from a biological tissue sample.

The biological tissue sample is preferably breast tissue, such as cancerous tissue or tissue adjacent to a cancer. The blood sample is preferably a peripheral blood sample.

The sample containing exosomes may be enriched in advance by any one of density gradient centrifugation, ultracentrifugation, ultrafiltration, and polyethylene glycol precipitation.

In the present invention, the detection agent may be a qualitative or quantitative detection agent. For example, in some cases, healthy or benign breast cancer does not peak at a certain number of cycles when ENAH mRNA is detected by PCR, and thus can be qualitatively distinguished from malignant breast cancer.

In some embodiments, the test agent further comprises a second test agent for testing SEPT9 mRNA, wherein a decreased amount of SEPT9 mRNA expression is indicative of increased breast cancer disease and the SEPT9 mRNA is total mRNA that is the sum of the mrnas from the different transcripts of SEPT9 in the exosomes to be tested.

The present invention finds a new marker for breast cancer diagnosis, ENAH mRNA in exosomes, and optionally SEPT9 mRNA.

The invention also provides a technical scheme for diagnosing the breast cancer by combining the ENAH mRNA and the SEPT9 mRNA, which can provide better diagnosis accuracy.

By utilizing the technical scheme, the suspected focus patient can be screened and identified, and the problem of early-stage malignant nodules of the mammary gland which cannot be confirmed by the imaging can be solved.

The term "marker" or "biochemical marker" as used herein refers to a molecule to be used as a target for analyzing a patient test sample. As will be apparent to those skilled in the art, detection of mRNA should not be construed as limited to the particular mRNA sequences from direct transcription of the above-mentioned genes, e.g., as a result of alternative mRNA variants, short chains, or pre-mRNA processing. The nucleotide sequence of the variant has 95%, 96%, 97%, 98%, 99% or more identity to the corresponding marker sequence; short strands are sufficient as long as they represent the specific sequence of the full-length mRNA itself. Obviously, the detection of mRNA levels can also be performed by detecting cDNA.

The diagnosis may be a secondary diagnosis. In the present invention, the term "prognosis" has the meaning known to the person skilled in the art. In one embodiment of the invention, prognosis refers to probability of survival (PFS). Where the subject is a population (2 or more than 2 patients), prognosis can refer to median survival probability or mean survival probability.

In the present invention, "total mRNA" or "total type" or "total mRNA" means the sum of mRNA of different transcripts of ENAH or SEPT9 in the exosome to be detected as the object of detection.

The ENAH different transcripts mRNA are known to those skilled in the art, e.g. 26 different transcripts recorded on NCBI, with transcript numbers: XM _017001747.1, XM _017001746.2, XM _024448307.1, XM _024448305.1, XM _017001750.1, XM _024448306.1, XM _024448318.1, XM _011544229.2, XM _024448308.1, XM _024448319.1, XM _017001748.1, XM _017001752.1, XM _024448316.1, XM _024448314.1, XM _024448309.1, XM _024448310.1, XM _017001749.1, XM _024448313.1, XM _024448311.1, XM _024448315.1, XM _017001751.1, XM _024448317.1, NM _001377481.1, NM _001377482.1, NM _001008493.3, NM _018212.6, NM _ 001377483.1.

Different transcripts of SEPT9 mRNA are known to the person skilled in the art, for example the 11 different transcripts recorded at NCBI, the transcript numbers being: NM _006640.5, NM _001113491.2, NM _001113492.2, NM _001113493, NM _001113494.1, NM _001113495.2, NM _001113496.2, NM _001293695.2, NM _001293696.2, NM _001293697.2, and NM _ 001293698.2.

Conventional methods for detecting total mRNA are apparently generally of 2 types:

(1) detecting mRNA sequences common to all transcripts;

(2) the expression levels of the above transcripts were measured, respectively, and then summed up.

In some embodiments, the ENAH mRNA is detected by detecting a consensus sequence of the ENAH mRNA different transcripts mRNA.

In some embodiments, the SEPT9 mRNA is detected by detecting a consensus sequence of SEPT9 different transcript mrnas.

The skilled in the art can obtain the consensus sequence by conventional technical means such as BLAST, and for example, the above transcripts can easily know that the ENAH mRNA consensus transcript can detect 3 exons and SEPT9 mRNA consensus transcript can detect 9 exons, and the skilled in the art can design detection primers and probes for detection by using detection segments spanning different exons. Detection primers and probes can be independently designed on any exon for detection.

In some embodiments, the detection agent is used to perform at least one of the following methods:

PCR method, first-generation sequencing, second-generation sequencing, nucleic acid chip, electrophoresis, HPLC, resonance light scattering method and biological mass spectrometry.

In some embodiments, the PCR method is real-time fluorescent quantitative PCR and/or digital PCR.

In some embodiments, the first detection agent is selected from at least one primer pair of l-p:

l: 34 and 35;

m: 36 and 37;

n: 38 and 39;

o:40 and 41;

p: 42 and 43 SEQ ID NO.

In some embodiments, the second detection agent is selected from at least one primer pair of a-f:

a: 1 and 2 SEQ ID NO;

b: 3 and 4;

c: 5 and 6 SEQ ID NO;

d: 7 and 8 SEQ ID NO;

e: 9 and 10;

f: SEQ ID NO 11 and SEQ ID NO 12.

In some embodiments, the detection agent further comprises one or more of an exosome-extracting reagent, a reverse transcriptase, a random primer, a double-strand specific fluorescent dye, a dNTP, a DNA polymerase, an internal reference primer, and water.

The exosome extraction reagent may be used to perform any of the following methods: density gradient centrifugation, ultracentrifugation, ultrafiltration, polyethylene glycol precipitation.

In some embodiments, the double-stranded specific fluorescent dye quantification is selected from any one of ethidium bromide, SYBR Green, PicoGreen, RiboGreen.

In some embodiments, the water is typically nucleic acid and/or nuclease-free water. The Water may be Distilled Water (Distilled Water), Deionized Water (Deionized Water), or Reverse osmosis Water (Reverse osmosis Water).

In some embodiments, the DNA polymerase is selected from any of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4 DNA polymerase, Klenow fragment.

The internal reference primer is a primer for detecting a reference standard, and can be understood as further comprising a sample and/or a reagent required for mRNA measurement standardization. For example, RNA measurements can be made using one or more "housekeeping" mRNAs as a standard for normalization, as will be familiar to those skilled in the art.

In some embodiments, the "housekeeping" mRNA is a ubiquitin mRNA and/or an actin mRNA.

In some embodiments, the reference primer (ubiquitin mRNA) is selected from at least one primer pair of g-k:

g: 13 and 14;

h: 15 and 16;

i: 17 and 18;

j: 19 and 20;

k: 21 and 22, respectively.

In some embodiments, the reference primer (actin mRNA) is selected from at least one primer pair of q-t:

q: 49 and 50;

r: 51 and 52;

s: 53 and 54 SEQ ID NO;

t: SEQ ID NO:55 and SEQ ID NO: 56.

In some embodiments, the detection agent further comprises a probe.

In some embodiments, the probe comprises a probe with at least one nucleotide sequence shown in SEQ ID NO. 44-48, and the SEQ ID NO. 44-48 and the primer pairs in l-p are sequentially corresponding and matched for use.

In some embodiments, the probe comprises a probe with at least one of SEQ ID NO 23-28, and the SEQ ID NO 23-28 and the primer pairs in a-f are sequentially corresponding and matched for use.

In some embodiments, the probe comprises a probe with at least one nucleotide sequence shown in SEQ ID NO. 29-SEQ ID NO. 33, and the SEQ ID NO. 29-SEQ ID NO. 33 are sequentially corresponding to and matched with the primer pairs in g-k.

In some embodiments, the probe comprises a probe with at least one of SEQ ID NO 57-SEQ ID NO 60, and the SEQ ID NO 57-SEQ ID NO 60 and the primer pairs in q-t are sequentially corresponding and matched for use.

In some embodiments, the probe carries a detectable label.

The term "label" as used herein refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect and that can be attached to a nucleic acid or protein. Labels include, but are not limited to, dyes; radiolabels, e.g.³²P; binding moieties such as biotin; haptens such as digoxin; a luminescent, phosphorescent, or fluorescent moiety; and a fluorescent dye alone or in combination with a portion of the emission spectrum that can be suppressed or shifted by Fluorescence Resonance Energy Transfer (FRET). Labels can provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. Labels can be charged moieties (positive or negative) or alternatively, can be charge neutral. The label may comprise or be combined with a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly (e.g., direct sequence read) without a label.

In some embodiments, the label is a fluorophore, colorimetric label, quantum dot, biotin, and other label molecules that can be used for detection (e.g., alkyne groups for raman diffraction imaging, cyclic olefins for click reactions, priming groups for polymer labeling), and can also be selected from polypeptide/protein molecules, LNA/PNA, unnatural amino acids and their analogs (e.g., peptidomimetics), unnatural nucleic acids and their analogs (nucleomimetics), and nanostructures (including inorganic nanoparticles, NV-centers, aggregation/assembly-induced emission molecules, rare earth ion ligand molecules, polyoxometalate, etc.).

In some embodiments, the probe is a self-quenching probe, the 5 'end is labeled with a fluorescence emitting group, and the 3' end is labeled with a quenching group.

In some embodiments, the fluorescent emitting group is selected from any one of FAM, HEX, TET, NED, ROX, CY5, CY3, Texas Red, TFAM, SYBR Green I, VIC, and JOE;

in some embodiments, the quencher group is selected from any one of TAMRA, BHQ, Dabcyl, Eclipse, and NFQ-MGB.

According to still another aspect of the present invention, it also relates to a diagnostic kit for breast cancer, which contains a detection agent as defined above.

According to still another aspect of the present invention, it also relates to a method for diagnosing breast cancer, which comprises quantitatively detecting ENAH mRNA and/or SEPT9 mRNA in exosomes of a blood sample using the detection agent or kit as defined above.

The increase or decrease is usually significant, and determining whether the subject has a significant difference compared to the healthy population/benign tumor control group/initial state (baseline) of the subject can be performed using statistical methods well known in the art, and using confidence intervals and/orpThe value is confirmed. In some embodiments, the confidence interval may be 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9%, or 99.99% andpthe value may be 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, or 0.0001.

It is easy to understand that the ratio of ENAH mRNA expression level to SEPT9 mRNA expression level will make the analysis of the data more significant, since both increased ENAH mRNA expression level and decreased SEPT9 mRNA expression level can be used as indicators of the increased breast cancer; therefore, it is preferable to diagnose the breast cancer by measuring the ratio of the expression amount of ENAH mRNA to the expression amount of SEPT9 mRNA.

Further, a threshold value of the ratio of the expression level of ENAH mRNA to the expression level of SEPT9 mRNA (hereinafter referred to as R) may be set according to different test samples and different test purposes, for example, R.gtoreq.0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5 is positive sample (e.g., malignant breast cancer sample), preferably R.gtoreq.1.19 is positive.

Embodiments of the present invention will be described in detail with reference to examples.

In the following examples, when the quantitative PCR is performed by the double-strand specific fluorescent dye, only the ENAH mRNA (at least one of l to p) and/or SEPT9 mRNA (at least one of a to f), and the mRNA internal reference primer (at least one of g to k and q to t) are used; if the probe method is adopted for detection, a corresponding probe is also needed. The sequences of the primers and probes are shown below:

a：

SEPT9 mRNA upstream primer sequence: AGCAGGGCTTCGAGTTCAAC (SEQ ID NO: 1);

SEPT9 mRNA downstream primer sequence: CGGCTGATTTTGGATTTGAA (SEQ ID NO: 2);

SEPT9 mRNA probe sequence: ATCCACCTTAATCAACACCC (SEQ ID NO: 23);

b：

SEPT9 mRNA upstream primer sequence: ATCAAGTCCATCACGCACGA (SEQ ID NO: 3);

SEPT9 mRNA downstream primer sequence: CCCGAACCCTGGTGTGTC (SEQ ID NO: 4);

SEPT9 mRNA probe sequence: CCGGACGCCTTTCTCCTC (SEQ ID NO: 24);

c：

SEPT9 mRNA upstream primer sequence: CGGGGACCACATCAACAAC (SEQ ID NO: 5);

SEPT9 mRNA downstream primer sequence: TGATGTTGACCTCCTCCTGC (SEQ ID NO: 6);

SEPT9 mRNA probe sequence: CAGCCCATCATGAAGTTCATC (SEQ ID NO: 25);

d：

SEPT9 mRNA upstream primer sequence: GCGTCCACTGCTGCCTCTA (SEQ ID NO: 7);

SEPT9 mRNA downstream primer sequence: ACCTTGCTCAGGCGTTTCA (SEQ ID NO: 8);

SEPT9 mRNA probe sequence: CCACCGGCCACCCTCAG (SEQ ID NO: 26);

e：

SEPT9 mRNA upstream primer sequence: CCACTTCAAACAGCGGATCA (SEQ ID NO: 9);

SEPT9 mRNA downstream primer sequence: CCGAGTCCTCATCAAATTCCT (SEQ ID NO: 10);

SEPT9 mRNA probe sequence: CAGACCTGCTGTCCAACGGC (SEQ ID NO: 27);

f：

SEPT9 mRNA upstream primer sequence: TACCAGGTCAACGGCAAGAG (SEQ ID NO: 11);

SEPT9 mRNA downstream primer sequence: CGCAGGTAGGCAAACTCACA (SEQ ID NO: 12);

SEPT9 mRNA probe sequence: CCATCGAAGTTGAAAACACCAC (SEQ ID NO: 28);

g：

UBC mRNA upstream primer sequence: TGGGTCGCAGTTCTTGTTTG (SEQ ID NO: 13);

UBC mRNA downstream primer sequence: ACCTCGAGGGTGATGGTCTT (SEQ ID NO: 14);

UBC mRNA probe sequence: TGCAGATCTTCGTGAAGACTCTG (SEQ ID NO: 29);

h：

UBC mRNA upstream primer sequence: GGATTTGGGTCGCAGTTCTTG (SEQ ID NO: 15);

UBC miRNA downstream primer sequence: GTGTCACTGGGCTCAACCTC (SEQ ID NO: 16);

UBC mRNA probe sequence: TCACTTGACAATGCAGATCTT (SEQ ID NO: 30);

i：

UBC mRNA upstream primer sequence: GGGTCGCAGTTCTTGTTTGT (SEQ ID NO: 17);

UBC mRNA downstream primer sequence: AACCTCGAGGGTGATGGTCT (SEQ ID NO: 18);

UBC mRNA probe sequence: TCACTTGACAATGCAGATC (SEQ ID NO: 31);

j：

UBC mRNA upstream primer sequence: GGTCGCAGTTCTTGTTTG (SEQ ID NO: 19);

UBC mRNA downstream primer sequence: TCGAGGGTGATGGTCTTA (SEQ ID NO: 20);

UBC mRNA probe sequence: ACTTGACAATGCAGATCTT (SEQ ID NO: 32);

k：

UBC mRNA upstream primer sequence: TCGCAGTTCTTGTTTGTG (SEQ ID NO: 21);

UBC mRNA downstream primer sequence: TCGAGGGTGATGGTCTTA (SEQ ID NO: 22);

UBC mRNA probe sequence: AATGCAGATCTTCGTGAAGACTC (SEQ ID NO: 33);

l：

ENAH mRNA upstream primer sequence: ATCACCATACAGGCAACAACA (SEQ ID NO: 34);

ENAH mRNA downstream primer sequences: CAACCCTTTAGGAATGGCA (SEQ ID NO: 35);

ENAH mRNA probe sequence: TCCTGCCCACCACTCTGAA (SEQ ID NO: 44);

m：

ENAH mRNA upstream primer sequence: ACTGGATTCAGCAGAGTTCAT (SEQ ID NO: 36);

ENAH mRNA downstream primer sequences: AGTTTATCACGACCTGATGGT (SEQ ID NO: 37);

ENAH mRNA probe sequence: CTATCACCATACAGGCAACAA (SEQ ID NO: 45);

n：

ENAH mRNA upstream primer sequence: CTATCACCATACAGGCAACAA (SEQ ID NO: 38);

ENAH mRNA downstream primer sequences: ATGGCACAGTTTATCACGAC (SEQ ID NO: 39);

ENAH mRNA probe sequence: TGCCCACCACTCTGAATGT (SEQ ID NO: 46);

o：

ENAH mRNA upstream primer sequence: ACATTCAGAGTGGTGGGCA (SEQ ID NO: 40);

ENAH mRNA downstream primer sequences: GATTGTACTTCAACCCTTTAGGA (SEQ ID NO: 41);

ENAH mRNA probe sequence: ACCATCAGGTCGTGATAAACT (SEQ ID NO: 47);

p：

ENAH mRNA upstream primer sequence: GGTGCCAGCTGGTGGCTCAACTGGA (SEQ ID NO: 42);

ENAH mRNA downstream primer sequences: TGTAGCTTGATTGTACTTCAACC (SEQ ID NO: 43);

ENAH mRNA probe sequence: TGGGCAGGAAGATTCAGGA (SEQ ID NO: 48).

q：

ACTB mRNA upstream primer sequence: CGCCAGCTCACCATGGAT (SEQ ID NO: 49);

ACTB mRNA downstream primer sequence: GATGGAGGGGAAGACGGC (SEQ ID NO: 50);

ACTB mRNA probe sequence: CATGTGCAAGGCCGGCT (SEQ ID NO: 57).

r：

ACTB mRNA upstream primer sequence: AGGCACCAGGGCGTGAT (SEQ ID NO: 51);

ACTB mRNA downstream primer sequence: CCGTGCTCGATGGGGTAC (SEQ ID NO: 52);

ACTB mRNA probe sequence: GCCCAGAGCAAGAGAGGCA (SEQ ID NO: 58).

s：

ACTB mRNA upstream primer sequence: CGCGAGAAGATGACCCAGA (SEQ ID NO: 53);

ACTB mRNA downstream primer sequence: GTACGGCCAGAGGCGTACA (SEQ ID NO: 54);

ACTB mRNA probe sequence: AGCCATGTACGTTGCTATC (SEQ ID NO: 59).

t：

ACTB mRNA upstream primer sequence: CAGCCTTCCTTCCTGGGC (SEQ ID NO: 55);

ACTB mRNA downstream primer sequence: GCGTACAGGTCTTTGCGGA (SEQ ID NO: 56);

ACTB mRNA probe sequence: CAACTCCATCATGAAGT (SEQ ID NO: 60).

Example 1

In the following examples, analysis was performed by ENAH mRNA assay designed to run on a fluorescent quantitative PCR assay platform to detect expression levels of ENAH mRNA in tissue exosomes and plasma exosomes. And detecting by using a Lightcycle480 platform.

The experimental method is as follows:

1, plasma treatment:

whole blood was collected using EDTA and plasma was obtained by centrifugation at room temperature over 2 hours. Centrifugation conditions: 1500g, 10 min, aspirate supernatant, centrifuge again: 15000g, centrifuging for 10 minutes, and sucking supernatant, namely the separated plasma.

2, exosome identification:

2mL of Plasma was filtered through a 0.2 μm filter, and after exosomes were enriched using QIAGEN Kit (exo-RNeasy Serum/Plasma Midi Kit), exosomes were eluted using exosome-eluting solution to obtain structurally intact exosomes. The extracted exosomes were identified using particle tracking analysis technique and plasma exosomes NTA are shown in figure 1. As can be seen from the figure: the particle size is 40-200nm, the main peak is about 140nm, and the particle size accords with the particle size range of exosome.

3, extracting plasma exosome RNA:

2mL of Plasma was filtered through a 0.2 μm filter, and Plasma exosome RNA was extracted using QIAGEN Kit (exo-RNeasy Serum/Plasma Midi Kit), according to the Kit instructions.

Note: the commercial exosome mRNA extraction kit is recommended to avoid introducing DNA pollution and prevent nonspecific amplification in subsequent detection. If necessary, DNA digestion with DNase I may be carried out, followed by RT-PCR detection.

4, PCR detection:

the detection was carried out in One-Step using SuperScript III Platinum ™ One-Step qRT-PCR Kit, the specific PCR reaction system and procedure are shown in Table 1, and a positive control (positive cell line: total RNA extracted from MCF-7) and a negative control (RNA not reverse transcribed) were set simultaneously to monitor the detection process.

5, analyzing results:

ACTB as internal reference, 1000X 2^-ΔΔCTCalculating the expression amount of ENAH, 2^-ΔΔCT=2^{- [ CT (target, sample) -CT (reference, sample)]- [ CT (target, positive)Sexual control) -CT (internal control, positive control)]}The sample target was not amplified and the CT value was calculated as 45. Data analysis was performed using GraphPad Prism software.

TABLE 1 one-step Probe PCR reaction System

TABLE 2 one-step Probe PCR reaction procedure

Example 2

The detection sample type of the embodiment is as follows: plasma. A total of 39 patients were enrolled and all were shown to have nodules by imaging. 19 breast malignant nodule samples, specifically 11 ductal carcinoma in situ with micro-infiltration, 7 ductal carcinoma in situ, and 1 lobular carcinoma in situ; 20 benign nodules of the breast, in particular 13 fibroadenomas, 5 papillomas, 2 ductal epitheliosis.

Plasma exosome extraction, RNA extraction and detection are described in example 1. The results are shown in Table 3.

Table 3: identification of benign and malignant breast nodules

As a result: 19 breast malignant nodules, 14 positive readings with sensitivity: 73.68 percent; 20 breast benign nodules, 18 negative in interpretation, with specificity: 90 percent.

And (4) conclusion: the expression level of ENAH mRNA in plasma exosome in malignant nodules of mammary glands is higher than that of benign nodules, and the ENAH mRNA can be used for identifying benign and malignant nodules of mammary glands.

Example 3

The detection sample type of the embodiment is as follows: plasma was pooled into 91 samples. Of these, 37 cases of breast cancer: 3 cases of moderate ductal carcinoma in situ, 5 cases of high-grade ductal carcinoma in situ, 17 cases of invasive ductal carcinoma, 3 cases of lobular carcinoma in situ, and 9 cases of invasive lobular carcinoma; 54 non-breast cancer: 13 lung cancers, 10 colorectal cancers, 13 benign diseases of the breast (7 mastitis, 4 papillomas, 2 ductal epithelial hyperplasia) and 18 healthy people.

Plasma exosome extraction, RNA extraction and detection are described in example 1. The results are shown in Table 4.

Table 4: breast cancer auxiliary diagnosis

As a result: 37 breast cancers, 28 positive, sensitivity: 75.68 percent; 54 cases of non-breast cancer, 47 cases were negative and had the following specificity: 87.04%, wherein: 13 lung cancers, 10 negative, specificity: 76.92%, 10 colorectal cancers, 8 positive, specificity: 80%, 13 cases of benign breast diseases, 12 cases of negativity, 92.31% specificity: 18 healthy people, 17 negative, specificity: 94.44 percent.

And (4) conclusion: the expression level of ENAH mRNA in the plasma exosomes in breast cancer is higher than that of breast benign diseases and other tumors, and the ENAH mRNA in the plasma exosomes has certain breast tumor specificity and breast tissue specificity, so that the ENAH mRNA expression level in the plasma exosomes can be used for auxiliary diagnosis of the breast cancer.

Example 4

The detection sample type of the embodiment is as follows: plasma, 7 breast cancer patients (2 ductal carcinoma in situ, grade ductal carcinoma in situ with infiltration of focal zone in 1 case, ductal carcinoma in situ with micro-infiltration in 1 case, lobular carcinoma in situ in 1 case, and invasive lobular carcinoma in 2 cases) were grouped, and samples were collected before and 7-10 days after the operation of each patient. The monitoring capability of the target on the treatment effect of the breast cancer is examined by detecting the change of the expression level of ENAH mRNA in the matched plasma exosomes of 7 patients before and after operation.

Plasma exosome extraction, RNA extraction and detection are described in example 1. The results are shown in Table 5. The trend chart of the detection result is shown in figure 2.

TABLE 5 Breast cancer course monitoring

As a result: in 7 cases of breast cancer preoperative and postoperative paired samples, the content of ENAH mRNA in postoperative exosomes is reduced, and the reduction rate of 6 cases is more than 50%.

And (4) conclusion: this suggests that ENAH mRNA expression levels in exosomes may be effective in monitoring the effectiveness of breast cancer therapy.

Example 5

Grouping samples: example 491 plasma samples in group were tested simultaneously for ENAH and SEPT9 mRNA expression in plasma exosomes and the clinical assay performance of the two gene combination assay (relative content of ENAH/relative content of SEPT 9) was examined.

Plasma exosome extraction, RNA extraction and detection are described in example 1. The results are shown in Table 6.

TABLE 6

As a result: the two genes are jointly detected, the ratio of relative quantitative values is judged, 37 cases of breast cancer and 31 cases of breast cancer are detected to be positive, and the sensitivity is as follows: 83.78 percent; 54 cases of non-breast cancer, 49 cases tested negative and had the specificity: 90.74%, wherein: 13 lung cancers, 11 negative, specificity: 84.62%, 10 colorectal cancers, 9 positive, specificity: 90%, 13 cases of benign breast disease, 12 cases of negative, 92.31% specificity: 18 healthy people, 17 negative, specificity: 94.44 percent.

And (4) conclusion: according to the results, the plasma exosomes ENAH and SEPT9 are jointly detected, the sample is interpreted by using the ratio of the expression levels of the two genes (the relative content value of the ENAH/the relative content value of SEPT 9), the detection performance is greatly improved compared with that of a single target (ENAH), and the detection sensitivity of the breast cancer is improved from 75.68% to 83.78%; the detection specificity is improved from 87.04% to 90.74%.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Jiangsu is the genuine biological medicine technology corporation; suzhou Promeide medical laboratory Co., Ltd

<120> application of exosome mRNA in diagnosis of breast diseases

<160> 60

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> artificial sequence

<400> 1

agcagggctt cgagttcaac 20

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<400> 2

cggctgattt tggatttgaa 20

<210> 3

<211> 20

<212> DNA

<213> artificial sequence

<400> 3

atcaagtcca tcacgcacga 20

<210> 4

<211> 18

<212> DNA

<213> artificial sequence

<400> 4

cccgaaccct ggtgtgtc 18

<210> 5

<211> 19

<212> DNA

<213> artificial sequence

<400> 5

cggggaccac atcaacaac 19

<210> 6

<211> 20

<212> DNA

<213> artificial sequence

<400> 6

tgatgttgac ctcctcctgc 20

<210> 7

<211> 19

<212> DNA

<213> artificial sequence

<400> 7

gcgtccactg ctgcctcta 19

<210> 8

<211> 19

<212> DNA

<213> artificial sequence

<400> 8

accttgctca ggcgtttca 19

<210> 9

<211> 20

<212> DNA

<213> artificial sequence

<400> 9

ccacttcaaa cagcggatca 20

<210> 10

<211> 21

<212> DNA

<213> artificial sequence

<400> 10

ccgagtcctc atcaaattcc t 21

<210> 11

<211> 20

<212> DNA

<213> artificial sequence

<400> 11

taccaggtca acggcaagag 20

<210> 12

<211> 20

<212> DNA

<213> artificial sequence

<400> 12

cgcaggtagg caaactcaca 20

<210> 13

<211> 20

<212> DNA

<213> artificial sequence

<400> 13

tgggtcgcag ttcttgtttg 20

<210> 14

<211> 20

<212> DNA

<213> artificial sequence

<400> 14

acctcgaggg tgatggtctt 20

<210> 15

<211> 21

<212> DNA

<213> artificial sequence

<400> 15

ggatttgggt cgcagttctt g 21

<210> 16

<211> 20

<212> DNA

<213> artificial sequence

<400> 16

gtgtcactgg gctcaacctc 20

<210> 17

<211> 20

<212> DNA

<213> artificial sequence

<400> 17

gggtcgcagt tcttgtttgt 20

<210> 18

<211> 20

<212> DNA

<213> artificial sequence

<400> 18

aacctcgagg gtgatggtct 20

<210> 19

<211> 18

<212> DNA

<213> artificial sequence

<400> 19

ggtcgcagtt cttgtttg 18

<210> 20

<211> 18

<212> DNA

<213> artificial sequence

<400> 20

tcgagggtga tggtctta 18

<210> 21

<211> 18

<212> DNA

<213> artificial sequence

<400> 21

tcgcagttct tgtttgtg 18

<210> 22

<211> 18

<212> DNA

<213> artificial sequence

<400> 22

tcgagggtga tggtctta 18

<210> 23

<211> 20

<212> DNA

<213> artificial sequence

<400> 23

atccacctta atcaacaccc 20

<210> 24

<211> 18

<212> DNA

<213> artificial sequence

<400> 24

ccggacgcct ttctcctc 18

<210> 25

<211> 21

<212> DNA

<213> artificial sequence

<400> 25

cagcccatca tgaagttcat c 21

<210> 26

<211> 17

<212> DNA

<213> artificial sequence

<400> 26

ccaccggcca ccctcag 17

<210> 27

<211> 20

<212> DNA

<213> artificial sequence

<400> 27

cagacctgct gtccaacggc 20

<210> 28

<211> 22

<212> DNA

<213> artificial sequence

<400> 28

ccatcgaagt tgaaaacacc ac 22

<210> 29

<211> 23

<212> DNA

<213> artificial sequence

<400> 29

tgcagatctt cgtgaagact ctg 23

<210> 30

<211> 21

<212> DNA

<213> artificial sequence

<400> 30

tcacttgaca atgcagatct t 21

<210> 31

<211> 19

<212> DNA

<213> artificial sequence

<400> 31

tcacttgaca atgcagatc 19

<210> 32

<211> 19

<212> DNA

<213> artificial sequence

<400> 32

acttgacaat gcagatctt 19

<210> 33

<211> 23

<212> DNA

<213> artificial sequence

<400> 33

aatgcagatc ttcgtgaaga ctc 23

<210> 34

<211> 21

<212> DNA

<213> artificial sequence

<400> 34

atcaccatac aggcaacaac a 21

<210> 35

<211> 19

<212> DNA

<213> artificial sequence

<400> 35

caacccttta ggaatggca 19

<210> 36

<211> 21

<212> DNA

<213> artificial sequence

<400> 36

actggattca gcagagttca t 21

<210> 37

<211> 21

<212> DNA

<213> artificial sequence

<400> 37

agtttatcac gacctgatgg t 21

<210> 38

<211> 21

<212> DNA

<213> artificial sequence

<400> 38

ctatcaccat acaggcaaca a 21

<210> 39

<211> 20

<212> DNA

<213> artificial sequence

<400> 39

atggcacagt ttatcacgac 20

<210> 40

<211> 19

<212> DNA

<213> artificial sequence

<400> 40

acattcagag tggtgggca 19

<210> 41

<211> 23

<212> DNA

<213> artificial sequence

<400> 41

gattgtactt caacccttta gga 23

<210> 42

<211> 25

<212> DNA

<213> artificial sequence

<400> 42

ggtgccagct ggtggctcaa ctgga 25

<210> 43

<211> 23

<212> DNA

<213> artificial sequence

<400> 43

tgtagcttga ttgtacttca acc 23

<210> 44

<211> 19

<212> DNA

<213> artificial sequence

<400> 44

tcctgcccac cactctgaa 19

<210> 45

<211> 21

<212> DNA

<213> artificial sequence

<400> 45

ctatcaccat acaggcaaca a 21

<210> 46

<211> 19

<212> DNA

<213> artificial sequence

<400> 46

tgcccaccac tctgaatgt 19

<210> 47

<211> 21

<212> DNA

<213> artificial sequence

<400> 47

accatcaggt cgtgataaac t 21

<210> 48

<211> 19

<212> DNA

<213> artificial sequence

<400> 48

tgggcaggaa gattcagga 19

<210> 49

<211> 18

<212> DNA

<213> artificial sequence

<400> 49

cgccagctca ccatggat 18

<210> 50

<211> 18

<212> DNA

<213> artificial sequence

<400> 50

gatggagggg aagacggc 18

<210> 51

<211> 17

<212> DNA

<213> artificial sequence

<400> 51

aggcaccagg gcgtgat 17

<210> 52

<211> 18

<212> DNA

<213> artificial sequence

<400> 52

ccgtgctcga tggggtac 18

<210> 53

<211> 19

<212> DNA

<213> artificial sequence

<400> 53

cgcgagaaga tgacccaga 19

<210> 54

<211> 19

<212> DNA

<213> artificial sequence

<400> 54

gtacggccag aggcgtaca 19

<210> 55

<211> 18

<212> DNA

<213> artificial sequence

<400> 55

cagccttcct tcctgggc 18

<210> 56

<211> 19

<212> DNA

<213> artificial sequence

<400> 56

gcgtacaggt ctttgcgga 19

<210> 57

<211> 17

<212> DNA

<213> artificial sequence

<400> 57

catgtgcaag gccggct 17

<210> 58

<211> 19

<212> DNA

<213> artificial sequence

<400> 58

gcccagagca agagaggca 19

<210> 59

<211> 19

<212> DNA

<213> artificial sequence

<400> 59

agccatgtac gttgctatc 19

<210> 60

<211> 17

<212> DNA

<213> artificial sequence

<400> 60

caactccatc atgaagt 17

Claims (17)

1. The application of the detection agent in preparing a reagent or a kit for breast cancer diagnosis or disease course monitoring,

the detection agent comprises a first detection agent for detecting ENAH mRNA, wherein an increased amount of ENAH mRNA expression is indicative of the severity of breast cancer;

the ENAH mRNA is total mRNA which is the sum of mRNA of different ENAH transcripts in the exosomes to be detected;

the detection agent also contains a second detection agent, the second detection agent is used for detecting SEPT9 mRNA, wherein the reduced expression level of SEPT9 mRNA is an indication of the aggravation of the breast cancer, and the SEPT9 mRNA is total mRNA which is the sum of mRNA of SEPT9 different transcripts in the exosomes to be detected.

2. Use according to claim 1, wherein the exosomes are selected from blood sample exosomes.

3. The application of claim 1 or 2, wherein said ENAH mRNA is detected by detecting a consensus sequence of different transcripts of ENAH mRNA.

4. Use according to claim 3, wherein the detection agent is used to perform at least one of the following methods:

PCR method, first-generation sequencing, second-generation sequencing, nucleic acid chip, electrophoresis, HPLC, resonance light scattering method and biological mass spectrometry.

5. Use according to claim 4, wherein the PCR method is real-time fluorescent quantitative PCR and/or digital PCR.

6. The use of claim 3, wherein the first detection agent is selected from at least one primer pair of l-p:

l: 34 and 35;

m: 36 and 37;

n: 38 and 39;

o:40 and 41;

p: 42 and 43 SEQ ID NO.

7. The use according to any one of claims 4 to 6, wherein the detection agent further comprises one or more of an exosome-extracting reagent, a reverse transcriptase, a random primer, a double strand-specific fluorescent dye, dNTPs, a DNA polymerase, a probe, an internal reference primer and water.

8. The application of claim 7, wherein the probe comprises a probe with at least one nucleotide sequence of SEQ ID NO 44-48, and the SEQ ID NO 44-48 and the primer pairs in l-p are sequentially corresponding and matched for use.

9. The use according to claim 8, wherein the probe is detectably labeled.

10. The use of claim 8 or 9, wherein the probe is a self-quenching probe, the 5 'end is labeled with a fluorescence emitting group, and the 3' end is labeled with a quenching group.

11. The application of the detection agent in preparing a reagent or a kit for breast cancer diagnosis or disease course monitoring,

the detection agent comprises a first detection agent for detecting ENAH mRNA, wherein an increased amount of ENAH mRNA expression is indicative of the severity of breast cancer;

the ENAH mRNA is total mRNA which is the sum of mRNA of different ENAH transcripts in the exosomes to be detected;

the first detection agent is at least one primer pair selected from the group consisting of l-p:

l: 34 and 35;

m: 36 and 37;

n: 38 and 39;

o:40 and 41;

p: 42 and 43 SEQ ID NO.

12. Use according to claim 1, wherein the exosomes are selected from blood sample exosomes.

13. The use of claim 11 or 12, wherein the detection agent further comprises one or more of an exosome-extracting reagent, a reverse transcriptase, a random primer, a double strand-specific fluorescent dye, a dNTP, a DNA polymerase, a probe, an internal reference primer and water.

14. The application of claim 13, wherein the probe comprises a probe with at least one nucleotide sequence of SEQ ID NO 44-48, and the SEQ ID NO 44-48 and the primer pairs in l-p are sequentially corresponding and matched for use.

15. The use according to claim 13, wherein the probe is detectably labeled.

16. The use of claim 14 or 15, wherein the probe is a self-quenching probe, the 5 'end is labeled with a fluorescence emitting group, and the 3' end is labeled with a quenching group.

17. A diagnostic kit for breast cancer, comprising the detection agent according to any one of claims 1 to 16.

Images