CN114292920B - Group of gastric precancerous lesions and gastric early diagnosis plasma RNA marker combination and application - Google Patents

Abstract

The invention discloses a group of gastric cancer precursor lesions and a combination and application of a blood plasma RNA marker for early diagnosis of gastric cancer. The invention provides the use of an RNA combination for the preparation of any one of the following: a product for diagnosing or aiding in diagnosing gastric cancer and precancerous lesions thereof; screening or assisting in screening for products of gastric cancer and pre-cancerous lesions; products for distinguishing or assisting in distinguishing stomach cancer from pre-cancerous lesions and healthy subjects; distinguishing or assisting in distinguishing whether a patient with premalignant gastric lesions is a product of gastritis or intraepithelial neoplasia; the RNA combination consists of at least two of: CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18. The invention provides a plasma RNA (ribonucleic acid) combination marker and a detection and analysis method for early gastric cancer occurrence and gastric cancer precursor lesion, and provides support for the discovery, diagnosis and treatment of early gastric cancer disease and precancerous lesion stage.

Description

Group of gastric precancerous lesions and gastric early diagnosis plasma RNA marker combination and application

Technical Field

The invention relates to the field of biological medicines, in particular to a group of gastric precancerous lesions and early diagnosis plasma RNA marker combinations and application thereof.

Background

Gastric Cancer (GC) is the fifth most common malignancy worldwide, and is the fourth leading cause of cancer-related death worldwide. According to the global latest cancer data statistics report issued by the world health organization International cancer research institute in 2020, 109 thousands of new cases and 77 thousands of death cases of GC in 2020 are shown. Due to the world population growth, the absolute number of GCs remained stable but the overall performance of GC morbidity was reduced compared to 103 tens of thousands of new cases and 78.3 tens of thousands of deaths for GC worldwide in 2018. 48 ten thousand new cases and 37 ten thousand dead cases of GC in 2020 of China, and the morbidity and the mortality are Gao Judi in malignant tumors. In recent years, under the combined action of many factors such as the enhancement of public health consciousness and the improvement of social medical conditions, the overall GC morbidity is reduced, but the GC mortality is still high, wherein the lower diagnosis rate of Early Gastric Cancer (EGC) is an important factor for leading to the high GC mortality. Because of the fact that patients have poor consciousness on early tumor screening, symptoms before and at the early stage of cancer are not obvious, and the technical means of early tumor screening detection are not perfect, most patients develop to the advanced stage of gastric cancer when first diagnosis is carried out, the treatment of patients with advanced gastric cancer (Advanced gastric cancer, AGC) is often ineffective and the prognosis effect is poor. Investigation shows that EGC patients have more than 90% of survival rate after operation, and AGC patients have only about 30% of survival rate after operation. Therefore, the timely discovery and treatment of EGCs must be appreciated.

Currently, large-scale early tumor screening is not yet feasible due to the lack of suitable screening means. Although gastroscopy in combination with tissue biopsy (tissuebiopsy) is a "gold standard" for tumor detection and diagnosis, gastroscopy is subject to equipment level and physician manipulation, and the detection results are not stable. In addition, gastroscopes are highly harmful to the subject and expensive, and are difficult to apply to large-scale early sieves for tumors, and patients in the precancerous lesion stage, including patients with atrophic gastritis, low grade dysplasia or high grade dysplasia, are difficult to accept and apply these detection methods for various reasons. Meanwhile, the heterogeneity of tumor can not be distinguished by the tissue specimen, which often leads to the phenomenon that the gastroscope result is inconsistent with pathological diagnosis. There are many non-invasive methods for detecting gastric cancer, including carcinoembryonic antigen (CEA), glycoprotein antigen 19-9 (CA 19-9), CA72-4, pepsinogen (PG), etc., but these conventional serum tumor biomarkers have insufficient specificity and sensitivity, and cannot be effectively applied to diagnosis of EGC. Thus, there is an urgent need for a novel, minimally invasive, highly sensitive and specific biomarker to improve diagnostic efficiency of EGCs. Circulating Tumor Cells (CTCs), circulating tumor DNA (circulating tumor DNA, ctDNA), circulating free RNA (cfRNA), and Extracellular Vesicles (EVs) in blood and other body fluids can be non-invasively detected by liquid biopsy (liquiddbiopsy). The first report in 1977 was the rise in free nucleic acid levels in the serum of cancer patients. At the end of the 80 s of the 20 th century, circulating DNA and RNA in the serum of cancer patients were isolated and identified as a tumor source, with tumor specificity. cfRNA is more abundant in body fluids, so research on liquid biopsy markers is increasingly focused on cfRNA. cfrnas include miRNA (microRNA), lncRNA (long non-coding RNA), circRNA (circularRNA), tRNA (transferRNA), etc., almost all types of ncrnas (non-coding RNA) and mRNA (messageRNA). It has been found that cfRNA in plasma can be used as a novel tumor marker to predict various cancers, including gastric cancer, lung cancer, breast cancer, colon cancer, etc. From this, cfRNA in plasma has gained acceptance as a molecular marker for cancer diagnosis and prognosis, which has great potential for application in early tumor diagnosis and screening.

The premalignant lesions refer to pathological changes of gastric mucosa, namely abnormal hyperplasia of gastric mucosa and intestinal metaplasia, which are easy to generate canceration, and are mainly accompanied with chronic atrophic gastritis. Gastric cancer is a multi-step cancerous process, i.e. chronic superficial gastritis- & gt atrophic gastritis- & gt intestinal metaplasia- & gt intraepithelial neoplasia- & gt gastric cancer, during which the lesions present are called precancerous lesions. Chronic atrophic gastritis is susceptible to canceration, and its canceration rate is considered to be: the cancer transformation rate of 5-10 years is 3-5%, the cancer transformation rate of more than 10 years is 10%, the cancer transformation rate of 10 years of low-grade intraepithelial neoplasia is 2.5-35%, and the cancer transformation rate of 10 years of high-grade intraepithelial neoplasia is 10-83%. At present, there are few markers for predicting lung cancer in the pre-lesion stage of gastric cancer, so the markers for detecting whether gastric cancer occurs or not and the high risk degree thereof are of great value.

Disclosure of Invention

The invention aims to provide a group of gastric cancer precursor lesions and a gastric cancer early diagnosis plasma RNA marker combination and application.

In a first aspect, the invention claims the use of an RNA combination as a biomarker in any of the following A1-A4; or, the use of a substance for detecting RNA combinations in any of the following A1-A4:

a1, preparing a product for diagnosing or assisting in diagnosing gastric precancerous lesions;

a2, preparing a product for screening or assisting in screening gastric precancerous lesions;

a3, preparing a product for distinguishing or assisting in distinguishing gastric precancerous lesions from healthy people;

a4, preparing a product for distinguishing or assisting in distinguishing whether a patient with the premalignant gastric cancer is gastritis or intraepithelial neoplasia.

The RNA combination consists of at least two of: CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18.

Wherein CEBPA-AS1, INHBA-AS1, AK001058 and UCA1 are long-chain non-coding RNA (LncRNA); PPBP and RGS18 are mRNA.

Further, the RNA combination may be any of the following:

(a1) INHBA-AS1, AK001058, UCA1 and RGS18;

(a2) CEBPA-AS1, INHBA-AS1, AK001058, UCA1 and RGS18;

(a3) INHBA-AS1, AK001058 and RGS18;

(a4) AK001058 and RGS18;

(a5) CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18.

In A1-A3, the precancerous lesion is preferably an intraepithelial neoplasia.

In A4, the intraepithelial neoplasia may be a low grade intraepithelial neoplasia or a high grade intraepithelial neoplasia.

In a second aspect, the invention claims the use of an RNA combination as a biomarker in any of the following B1-B3; or, the use of a substance for detecting RNA combinations in any of the following B1-B3:

b1, preparing a product for diagnosing or assisting in diagnosing gastric cancer;

b2, preparing a product for screening or assisting in screening gastric cancer;

b3, preparing a product for distinguishing or assisting in distinguishing gastric cancer from healthy people.

The RNA combination consists of at least two of: CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18.

Further, the RNA combination may be any of the following:

(b1) CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18;

(b2) CEBPA-AS1, AK001058, UCA1, PPBP and RGS18;

(b3) CEBPA-AS1, AK001058, UCA1 and RGS18;

(b4) CEBPA-AS1, AK001058 and RGS18;

(b5) AK001058 and RGS18.

Further, the gastric cancer may be early gastric cancer.

In a third aspect, the invention claims the use of an RNA combination as a biomarker in any of C1-C3; or, the use of a substance for detecting RNA combinations in any of the following C1-C3:

c1, preparing a product for diagnosing or assisting in diagnosing digestive tract cancer;

c2, preparing a product for screening or assisting in screening digestive tract cancers;

c3, preparing a product for distinguishing or assisting in distinguishing digestive tract cancer from healthy people.

The RNA combination consists of at least two of: CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18.

Wherein the digestive tract cancer is esophageal cancer or colorectal cancer.

In a fourth aspect, the use of RNA as a biomarker in the manufacture of a product for distinguishing or aiding in distinguishing whether a cancer patient is D1 or D2 as follows; or, the use of a substance for detecting RNA in the preparation of a product for distinguishing or aiding in distinguishing whether a cancer patient is D1 or D2 as follows;

d1, gastric cancer patients;

d2, esophageal cancer patients or colorectal cancer patients.

The RNA is composed of at least one of the following: CEBPA-AS1, INHBA-AS1, AK001058, UCA1 and RGS18.

Further, CEBPA-AS1, INHBA-AS1 and UCA1 are each useful for distinguishing or aiding in distinguishing between gastric cancer patients and esophageal cancer patients, and distinguishing or aiding in distinguishing between gastric cancer patients and colorectal cancer patients. AK001058 can be used to distinguish or assist in distinguishing gastric cancer patients from esophageal cancer patients. RGS18 can be used to distinguish or assist in distinguishing between gastric cancer patients and colorectal cancer patients. Wherein the gastric cancer patient is an early stage gastric cancer patient.

Wherein the cancer patient is a gastric cancer patient (such as an early stage gastric cancer patient), an esophageal cancer patient or a colorectal cancer patient.

In the invention, the nucleotide sequence of CEBPA-AS1 is shown aS SEQ ID No. 1. The nucleotide sequence of INHBA-AS1 is shown aS SEQ ID No. 2. The nucleotide sequence of AK001058 is shown as SEQ ID No. 3. The nucleotide sequence of UCA1 is shown as SEQ ID No. 4. The nucleotide sequence of the PPBP is shown as SEQ ID No. 5. The nucleotide sequence of RGS18 is shown in SEQ ID No. 6.

In the above aspects, the substance may be a substance capable of specifically binding to the RNA or DNA obtained by reverse transcription thereof.

In a specific embodiment of the invention, the substance is a primer pair.

Further, the primer pair for detecting CEBPA-AS1 consists of two single-stranded DNA shown in SEQ ID No.7 and SEQ ID No. 8; the primer pair for detecting INHBA-AS1 consists of two single-stranded DNA shown in SEQ ID No.9 and SEQ ID No. 10; the primer pair for detecting AK001058 consists of two single-stranded DNA shown as SEQ ID No.11 and SEQ ID No. 12; the primer pair for detecting UCA1 consists of two single-stranded DNA shown in SEQ ID No.13 and SEQ ID No. 14; the primer pair for detecting PPBP consists of two single-stranded DNA shown in SEQ ID No.15 and SEQ ID No. 16; the primer pair for detecting RGS18 consists of two single stranded DNA shown as SEQ ID No.17 and SEQ ID No. 18.

Further, the substance also contains a primer pair for detecting the internal reference; the internal reference is 18S rRNA.

The primer pair for detecting the internal reference consists of two single-stranded DNAs shown as SEQ ID No.19 and SEQ ID No. 20.

In each of the above applications, the sample to be tested is plasma. I.e. the RNA is in plasma and the biomarker is in plasma.

The invention provides a plasma RNA combined marker and a detection and analysis method for digestive tract cancers, especially early gastric cancer occurrence and gastric cancer precursor lesions, and provides support for the discovery and diagnosis treatment of clinical gastric cancer early and precancerous lesion phases.

Drawings

FIG. 1 shows the relative expression levels of plasma RNA in patients with gastric precancerous lesions. A: CEBPA-AS1; b: INHBA-AS1; c: AK001058; d: UCA1; e: PPBP; f: RGS18.* P <0.001.

FIG. 2 shows the expression differences of 6 RNAs in plasma of patients with different stages of gastric precancerous lesions. A: CEBPA-AS1; b: INHBA-AS1; c: AK001058; d: UCA1; e: PPBP; f: RGS18.* P <0.05, < P <0.01, < P <0.001, < P <0.0001.

FIG. 3 is an ROC curve analysis of 6 RNAs in plasma of patients with gastric precancerous lesions.

FIG. 4 is an analysis of the ROC curve of different RNA combinations in the plasma of patients with gastric precancerous lesions. C: CEBPA-AS1; i: INHBA-AS1; a: AK001058; u: UCA1; p: PPBP; r: RGS18.

FIG. 5 shows the relative expression levels of plasma RNA in early gastric cancer patients. A: CEBPA-AS1; b: INHBA-AS1; c: AK001058; d: UCA1; e: PPBP; f: RGS18.Normal: normal group; EGC: early gastric cancer; * P <0.05, < P <0.01, < P <0.001.

FIG. 6 is an ROC curve analysis of each of 6 RNAs in plasma of early gastric cancer patients.

FIG. 7 is an analysis of the ROC curve of different RNA combinations in the plasma of patients with early gastric cancer. C: CEBPA-AS1; i: INHBA-AS1; a: AK001058; u: UCA1; p: PPBP; r: RGS18.

FIG. 8 shows the relative expression levels of 6 RNAs in colorectal/esophageal cancer plasma. A: CEBPA-AS1; b: INHBA-AS1; c: AK001058; d: UCA1; e: PPBP; f: RGS18.* P <0.05, < P <0.01, < P <0.001.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The following examples will refer to 6 plasma RNAs, each as follows:

4 long non-coding RNAs (LncRNA): CEBPA-AS1, INHBA-AS1, AK001058 and UCA1:

2 mRNA: PPBP and RGS18.

The nucleotide sequence of CEBPA-AS1 is shown aS SEQ ID No. 1. The nucleotide sequence of INHBA-AS1 is shown aS SEQ ID No. 2. The nucleotide sequence of AK001058 is shown as SEQ ID No. 3. The nucleotide sequence of UCA1 is shown as SEQ ID No. 4. The nucleotide sequence of the PPBP is shown as SEQ ID No. 5. The nucleotide sequence of RGS18 is shown in SEQ ID No. 6.

Example 1 application of plasma RNA combination in screening gastric cancer precursor lesions

The plasma samples of 120 healthy persons (apparent healthy population from physical examination center for health physical examination, and the standard laboratory detection index results are in the range of the reference interval) and 119 gastric precancerous lesions (including 10 gastritis cases, 53 low-level intraepithelial neoplasia cases and 56 high-level intraepithelial neoplasia cases, and basic information see table 1) are provided by the first medical center of the general liberation army hospital. The age distribution and sex ratio of the healthy population and the premalignant patient population are similar, and no statistical difference exists.

Table 1, 119 cases of basic information of patients with premalignant lesions

Note that: the "result data" includes the number of examples outside the number, and the result of the corresponding information in brackets.

Plasma RNA extraction was performed using the miRNeasy Serum/Plasma Kit, and experimental procedures are described in the specification.

Plasma RNA reverse transcription was performed according to the instructions of the ImProm-II. TM. Reverse transcriptase kit.

The expression level of the related RNA in the blood plasma is based onPremixExTaq real-time quantitative kit instructions.

The reaction system is as follows: 10. Mu.L 2X SYBR Premix Ex Taq, 0.4. Mu.L ROX, 1. Mu.L plasma reverse transcribed cDNA product, 0.4. Mu.L upstream primer (20. Mu.M), 0.4. Mu.L downstream primer (20. Mu.M), 7.8. Mu.L DEPC water.

The reaction conditions for real-time fluorescent quantitative PCR are shown in Table 2. The primer sequences are shown in Table 3.

TABLE 2 real-time fluorescent quantitative PCR reaction conditions

TABLE 3 primer sequences

Gene name	Primer sequence (5 '-3')
		Random primers	NNNNNN
18S rRNA-F	GTAACCCGTTGAACCCCATT(SEQ ID No.19)
		18S rRNA-R	CCATCCAATCGGTAGTAGCG(SEQ ID No.20)
CEBPA-AS1-F	TGCGTCCCTCGCATTCTTTA(SEQ ID No.7)
		CEBPA-AS1-R	GACAGGAGACACTTGAGGGC(SEQ ID No.8)
INHBA-AS1-F	CCTACTACACACAGGGGCTC(SEQ ID No.9)
		INHBA-AS1-R	TTCCAGAAGCTCCTCATGGG(SEQ ID No.10)
AK001058-F	CTGCTTTGCCATTTCCCCTT(SEQ ID No.11)
		AK001058-R	GTTGATGCCACACAGAGGGA(SEQ ID No.12)
UCA1-F	AACCATCAGATCCTTGCCCA(SEQ ID No.13)
		UCA1-R	AATATGTGGAACTGGCCCCA(SEQ ID No.14)
PPBP-F	TGAGACAGAATGAAACAC(SEQ ID No.15)
		PPBP-R	AGGTGATGAATCTGCTG(SEQ ID No.16)
RGS18-F	TGGACTAGAGGCTTTTAC(SEQ ID No.17)
		RGS18-R	ATTTGTTGAGGTCCCTTG(SEQ ID No.18)

Note that: n represents A or T or C or G.

The detection result is expressed as the difference (ΔCt) between the Ct value expressed by the target RNA and the Ct value expressed by the 18S rRNA. Since an increase in Ct value in RT-PCR result analysis means a decrease in the corresponding gene expression level, a decrease in Δct means an up-regulation of the corresponding gene expression compared to the control, and an increase in Δct means a down-regulation of the corresponding gene expression compared to the control. The test working curve (ROC) was calculated as normal human plasma and patient plasma RNA expression values (Δct) using GraphPadPrism software for graphical analysis.

The results are shown in FIGS. 1 to 4.

CEBPA-AS1, INHBA-AS1, AK001058 and UCA1 were significantly up-regulated in plasma of patients with pre-cancerous lesions compared to healthy controls; whereas PPBP and RGS18 expression was significantly down-regulated in plasma of precursor lesion patients (fig. 1).

The results of expression of these six RNAs at different stages of gastric cancer precursor lesions (gastritis, low-grade intraepithelial neoplasia, high-grade intraepithelial neoplasia) showed that their expression was not significantly different from that of gastritis, but was significantly associated with the expression at the low-grade dysplasia and high-grade dysplasia stages (fig. 2).

Analysis of the 6 RNA molecules from CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18 on the test working curve (Receiver operating characteristic, ROC) of the plasma sample expression levels of the precursor lesion patients and healthy subjects showed AUC values of 0.651, 0.639, 0.741, 0.692, 0.721 and 0.773, respectively (FIG. 3).

ROC analysis was performed in combination with the expression levels of different species of RNA molecules. When all 6 RNA molecules were combined, the AUC value was 0.805. When any one RNA molecule was randomly removed, ROC curve analysis was performed in combination with the remaining 5 RNA molecules, wherein the AUC value for the C & I & a & U & R combination was 0.819, which is the combination with the largest AUC value among all 5 RNA combinations. When 2 RNA molecules were randomly removed, ROC curve analysis was performed in combination with the remaining 4 RNA molecules, and the AUC value of the I & A & U & R combination was 0.820 at the maximum among the 4 RNA combinations. When 3 RNA molecules were randomly removed, ROC curve analysis was performed in combination with the remaining 3 RNA molecules, and the AUC value of the I & A & R combination was 0.815 at the maximum among the 3 RNA combinations. When 4 RNA molecules were randomly removed, ROC curve analysis was performed in combination with the remaining 2 RNA molecules, where the AUC value for the A & R combination was 0.809 at the maximum of 2 RNA combinations. Finally, it was found that a combination of 4 RNA molecules of I & A & U & R, including INHBA-AS1, AK001058, UCA1 and RGS18, could be used aS candidate molecular markers for diagnosis of precursor lesions (FIG. 4). Wherein C, I, A, U, P, R represent CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18 (initials), respectively.

Example 2 application of plasma RNA combination in screening gastric cancer

Control plasma of 120 healthy persons (apparent healthy population from physical examination center for physical examination, and standard laboratory detection index results within the range of reference interval) and plasma samples of 143 early gastric cancer patients (basic information is shown in table 4) are provided by the first medical center of the general Hospital of the free army. The age distribution and sex ratio of the healthy population and the early gastric cancer patient population are similar, and no statistical difference exists.

Table 4, basic information of 143 cases of early gastric cancer patients

Note that: the "result data" includes the number of examples outside the number, and the result of the corresponding information in brackets.

Plasma RNA extraction, RNA reverse transcription and RT-PCR analysis procedures (including RT-PCR, ROC curve plotting, etc.) are described in example 1.

The results are shown in FIGS. 5 to 7.

CEBPA-AS1, INHBA-AS1, AK001058 and UCA1 showed significant up-regulation in early stage gastric cancer patient plasma and PPBP and RGS18 showed significant down-regulation in early stage gastric cancer patient plasma compared to healthy controls (FIG. 5).

ROC curve analysis of expression levels of 4 lncRNA CEBPA-AS1, INHBA-AS1, AK001058, UCA1 and 2 mRNA PPBP, RGS18 in early stage gastric cancer patient and healthy subject plasma samples showed AUC values of 0.587, 0.606, 0.681, 0.683, 0.739 and 0.801, respectively (fig. 6).

When all 6 RNA molecules were combined, the AUC value for C & I & a & U & P & R was 0.845. When any one RNA molecule was randomly removed and ROC curve analysis was performed in combination with the remaining 5 RNA molecules, the AUC value of the C & a & U & P & R combination was 0.843, which was the combination with the largest AUC value among all 5 RNA combinations. When 2 RNA molecules were randomly removed, ROC curve analysis was performed in combination with the remaining 4 RNA molecules, and the C & A & U & R combination, the AUC value was 0.840 at the maximum among the 4 RNA combinations. When 3 RNA molecules were randomly removed, ROC curve analysis was performed in combination with the remaining 3 RNA molecules, and the C & A & R combination, the AUC value was 0.835, which was the largest among the 3 RNA combinations. When 4 RNA molecules were randomly removed, the remaining 2 RNA molecules were combined for analysis in combination with the ROC curve, and the A & R combination had an AUC value of 0.823 at the maximum among the 2 RNA combinations. Finally, a 6-RNA combination C & I & A & U & P & R, including CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18, was found to be candidate molecular markers for diagnosing early gastric cancer (FIG. 7). Wherein C, I, A, U, P, R represent CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18 (initials), respectively.

Example 3 use of plasma RNA for screening and differentiating between digestive tract cancers

The plasma samples of 120 healthy persons (apparent healthy population from physical examination center for physical examination, and standard laboratory detection index result in the range of reference interval), 42 other types of digestive tract cancers (11 colorectal cancers, 31 esophageal cancers, basic information is shown in table 5) and 143 early gastric cancer patients (basic information is shown in table 4) are provided by the first medical center of the general Hospital of the free army. The age distribution and sex ratio of each group of people are similar, and no statistical difference exists.

Tables 5 and 42 basic information of other types of digestive tract cancers

Note that: the "result data" includes the number of examples outside the number, and the result of the corresponding information in brackets.

Plasma RNA extraction, RNA reverse transcription and RT-PCR analysis procedures are described in example 1.

The results are shown in FIG. 8.

The expression levels of CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18 have significant differences in healthy (normal) and esophageal/colorectal cancers; the expression levels of CEBPA-AS1, INHBA-AS1 and UCA1 have significant differences in early gastric and esophageal/colorectal cancers; the expression level of AK001058 has significant differences in early gastric and esophageal cancers; the expression level of RGS18 has a significant difference in early gastric and colorectal cancers; the expression level of PPBP showed no variability in both early gastric and esophageal/colorectal cancers. The above results indicate that the 6 RNA molecules are not differentially expressed specifically for gastric cancer. However, since the detection sample size is small, the above results only play a role of prompt, and a comparative analysis of a large sample is still required. The results suggest that the expression of these plasma RNAs may be a universal digestive tract cancer early warning detection biomarker.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

<110> military medical institute of the military academy of China's civil liberation army

<120> combination of gastric cancer precursor lesions and gastric cancer early diagnosis plasma RNA markers and application thereof

<130> GNCLN220664

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 2252

<212> RNA

<213> Artificial sequence

<400> 1

cccuccuccu gccugcccua ggcgcccgua uccagccacg gccgggagcc caggaguauc 60

ccgaggcugc acgggguagg gguggggggc ggagggcgag ucuuggucuu gagcugcugg 120

ggcgcggauu cucuuucaaa gccagaacca ggccuguccc ggacccgcgu cccggggagg 180

cugcagcgca gagcagcggg gcuggggccg guggggggcc guuugggacg cgcggagagg 240

uccugagcgc gguggcucug cgucuccuag cucugaucuc caggcuaccc cugugauucc 300

gcgcagaggu accucucgga ggacgccggg gucccauggg cggcgccgcg cagggcgcua 360

ggaccccgcg gggagcggag gcggccucgg cccgggagcc uggaggaccu ggccggucga 420

uccgcccggg cuggaaaacu uucuuuauaa uuacuucucc aggucggagc gcgcggcuug 480

cuaggcgcgc ggggccggcg cuguuacccg gcguggaguc gccgauuuuu uuuccugcgg 540

gaccgcgggg ccccccagac uagcggagcu ggacgccggg gcgagcacgg ggaggggcgc 600

accgagggag gagacaaacu uaacucuggg gccgggauuc cgaggcgggg gccgcagccc 660

ucgaggcccg aagccaccgc uuccuccccc gccuccccau ucaggugggc gccaacggcg 720

ggagcgaggg uguccaggcc gccgggcugc cagguccgag cacgcacagg gagaacucug 780

cccagugguu cgccgggcgc uguagucccc gggauccuag ggaccgaggc ggccaggccc 840

uggggccccu ugagugcggc agcuaaugcu cucaccgcgg cgggggaagg agcuugccac 900

cgagaccccc agccacgugc gucccucgca uucuuuaccg gggccggggu ggcggcuacg 960

gaccgucagc ugggcccaga uggagucuug ggagcccuca agugucuccu guccuugccc 1020

gcgccgcccc ucgccacugg cgcugaggcc ugacgccgcc ugcgucccgg cuagaggcgc 1080

gcuugccuac aggugaggga agacccccuu caccgacagu ggccuuaggc cuggcaaggc 1140

gccacgaccc gcccaggagc cccggagggg gcacagcuaa aaacaccgcu ggagagcccc 1200

gagcuuccac gacgaucgca guaaagaagc aguuucaucu gggcaacgca cacugcgcuu 1260

uaaucaaguu ccuauucaac auagucccag ugauuaauag cccaacugcu ucguuuucgg 1320

uccagagcuc auaaacaaga uauuuuuagc uugacgcuuu uggacgggag ggaguaaaaa 1380

ccagauacgu uaaauaaaua ucccgaugug agccggagag cugcuugcug agccaaaugc 1440

aggacccauu cauauagcau ucaccugugg agggagaccu ggacggaaau caaaaagcac 1500

caagagcgau uugcguuuuu uucugcggug cuaaaacuaa uggcuuuucc uaccuaggaa 1560

caaagaaacg ccacuguaca ugcacgguuc ccggccugug gaguuguggg aggaaggcga 1620

ugucuggccu uuuuugcaca gcugcuguug ccugcccaga gaucgggaac ucugccccgu 1680

aggacuggaa gaaaccucag uaaugggaau aagacuuugu ccaauagggg gcugaugaau 1740

gugugggggc gacaauggca aggaguggga cucccggccc gggguucgcc aaccccaggg 1800

gccacagguc cuccuacaau ugaaccagaa uucacccacc cgggccugcc cugugcaggg 1860

ugccgagagc ccagggaugc augagagggu ggcuccugcc ucugggaacu gggacagugg 1920

gagagacgga uaaguuguca cacagaggcu gcugggagga aggaggagac agaaggagua 1980

ggggauggga cuucauucau ucaucaaaug cacacgaggc acaaauggga aucaagggug 2040

gaugugcugu gaugaagaga aguccugccc ugaacaaggu ggcgcugugg aggaggcaga 2100

gaucagauuu gucugcggag guguuaugga cugaacugug ucccugcccc aaauuccuau 2160

guugaaggcc uaacccccau gugacuguau uuggagauaa ggcuuuuagg aagucauuaa 2220

agugagauga ugucauaaaa aaaaaaaaaa aa 2252

<210> 2

<211> 1887

<212> RNA

<213> Artificial sequence

<400> 2

uccuucuccu gguguccauu ucuggaacug cuauuuguau auugcaugau auuuuaucag 60

gaaaaaauau aaaacagauc uaauuucaug aaaaugcugu ugccauaaug cucaggagaa 120

cagggggaag agagagauuc aagucuuccu aaugucuacc uuauaugcag agccuuggaa 180

agaugggcaa augcucugug acaagccacc aggguagacu gguacugaaa agacccuacu 240

acacacaggg gcucuguccc uggcuggaaa guuacaaguc agccuaccuc ucugugaucu 300

gguuuccaca ccuacuacuc uuuaucccau gaggagcuuc uggaaacuaa aauagcagcu 360

gcccagguag aagaguguug accaaaggac acaucaccag cacagacugu uaaucaugug 420

acuagagaaa acucucaugg uggcauucaa auuuccauau ccuucuucua uggaaauuuc 480

ugagagaccc agaaaagaag cguaacgacg agggaaagug auuccugcag accugaacau 540

uccagacuua ccaggugauc cagcugucug ucagcgggaa gaggcugagg cgcccccuuc 600

uggugcaucu gaauaguaag aaacccugug uagaaagaaa cccuguagca auugggcacc 660

uucuccguga ucugucugcu uccaauacca aaaauuguug cuuuuuaaau gacauccauc 720

cuaagcuuaa aaaagacgca uauuauuugu auaaaauguu gaagacgcag aacaaaaaau 780

guaaaucaca uguaaucauc ccuuccagaa auaaucguua uuaaaauuuc uguguaugug 840

uaaaaaaaaa aauugcaauc cuacuguaau auaauccugu auacugauau uuuucaccua 900

ucacuguaug uugagcauuu ucaauaguca aauuauuucu ugaaaauauu aaugacuggg 960

gaguaaccuu ucaaauaggu gugucuuuau uuuuaaacca guccacaauu auuguauauu 1020

gaagucauuu cccaaauuuu guaaguauaa guauugcauc cauccuuaua uguauuuaaa 1080

ugcaucucuu auuauuuccu ugagauaagu uccuagaagu ggaaucacug gauuuaaaaa 1140

uguggacaua uuuaugccag acgcgguggg ucaugccugu aaucccagca cuuugggaga 1200

cugaagcagg uggaucacuu gaggucagga guucaagacc agccuggcca acauagugaa 1260

accccaucuc uacuaaaauu acaaaaauua gccgggugug guagugcacg ccuguaaucc 1320

cagcuacuca ggaggcugag gcauaagaau cacuugaacu caggaggcgg agguugcagu 1380

gagccaagau ggcaccacug cgcuccaguc ugggcgacag aguaagacuu caucucaaaa 1440

auaaauaaau aaaauuaaaa uuaaauaaga uaaauaaaaa auaaaaaugu ggacauauuu 1500

aaaucuucau auauauuacc aaaugcccuc cugaaaguuu uuaccuguua cauuccaacc 1560

aauaguguaa gggcaugacu cuuucccugu guuuugggau ggauguuauc aaaguucucu 1620

cccacccagg ccaaguaugg uauaugcuuu gauuuaauuu gaauuuuuaa auuauuauuu 1680

aaaauggaca uuuuguuguc cauuugaaca acuuucuuuu gagucacugu ucauguucuu 1740

ugcccauugu uucucuuuua uuaguaagaa cccuauuguc auuuuuauau uuuaaauaaa 1800

auuucauugu auauacauuu auauuaucua uaguaaagua uauuuuauua uuaaugagaa 1860

cuuuuuauau uaaagauccu aaccuac 1887

<210> 3

<211> 1631

<212> RNA

<213> Artificial sequence

<400> 3

auuuacuaau gaggcaguuu gcaaagacug ucccugaagu guaguguagu cuuucagggg 60

gauucauuua guaagcuaga uugauuuaac cugguacugu acuagcauag ggucaaauac 120

gugucaucag agaccugggu augaccaggc uuacaaaacu caggaacaaa cucagauucc 180

uacugaccuc aaccaacuaa acuaggccaa auuucuccgu guacaaaaug gaccacguua 240

uuuacaaucc acguggugga gaagauggua gacaugugga gagaguuugg ccaggugcuc 300

cauucuaggu cuuuuuccag uuucucaaag gcagaacauu ggcuccuaau uauuugccau 360

ggauauuugc uuccuguucu ggagcuaugu uguaagacag cugugugaug uccaucauuc 420

uugacuccag aaugaagaca gggcuugcug uuuucugucc uguugguauc aucuguugcc 480

uuggcgauca cucagugaug agucgucagu auuuugacau gucccagugc uugcuguaca 540

agaggggacu cagaucaaca ggaagacucu gaagacagga accugcaugg uaucuuacau 600

cuuugauacu ugggugcuga uaugaagcag aguuguugau uuacuuuauc uaggcccuuc 660

uuucaucuca ccuggaucaa gcaacugaga aguguaucag gagacacugg auacauaucu 720

cuaugaaaua gagagggcca ucgcagggcc ugguacuuaa cuacauuaac guucuaaaac 780

ccaguuuggu uuacguuguc uuucacagua guauauuuag cucuucucug gaaaguugug 840

gguuaauaua auucuuaaac augaaaaugu aauuaaacac accacgagag aacaauauuc 900

caggagacuu aauagugauu acuuucuuca aucaggaaau cguuucagug ccuccuuugu 960

aggaaugcuu uguuuuguga uggguuuucu uaaagaagag cacaccuccg uccaaucucc 1020

ugagacagcc acgucuccgc ugacauccca cugugaugcu uucagauagu cagugaaugu 1080

uucugauaac cuucauccag uaucugaaac acaaugugag agauuauauu guuuuagaua 1140

auaacauccc auuuaguuga cuaaaaucuu ccaaacucug aaagcugcac acugcuacuc 1200

cagagagugc aggucuuagc ucuucuccuu ucugacuuca agaugaaucu uugggacgau 1260

guuucuggug cuugguccac agugauucac uuuugaagga gaggccacau gacaugaacu 1320

gccugguguu acaaccuagc uaacauauuu gaugcuacuc cuguugucug uacugcuuau 1380

ucaaguagua uucuaaguua uguuacuaaa aaacauggug gguaaagcac aauccuaccc 1440

aucauugucc uccaaaauaa uuguaugaca uacacggccc agcccauugc ccucccugca 1500

ucucugugcu gcuuugccau uuccccuucu acccagccuc cucaaggggu accuuggugg 1560

auauuucagu acuuaaaacc agacuguaau cauaaccucc cucugugugg caucaauaaa 1620

uagccaaacu c 1631

<210> 4

<211> 2314

<212> RNA

<213> Artificial sequence

<400> 4

ugacauucuu cuggacaaug agucccauca ucucuccacc augcaccuug ugacucccuc 60

cucugcugac aacagauaac caccuuuaac uguaacuuuc cacagccuac cccagcccua 120

uaaagcugcc ccucuccuau cucccuucgc ugacucucuu uucagacuca gcccacuugc 180

acccaaguga auuaacagcc uuguugcuca cacaaagccu guuuaggugg ucuucuauac 240

ggacaugcuu gacacuuggu gccaaaaucu gggccagggg gacuccuucg ugagaccggc 300

ccccuguccu ggcccucauu ccgugaagag auccaccugc gaccucgggu ccucagacca 360

gcccaaggaa caucucacca auuucaaauc ggaucuccuc ggcuuagugg cugaagacug 420

augcugcccg aucgccucag aagccccuug gaccaucaca gaugccgagc uucggguaac 480

ucuuacggug gaggauuccc agccauauga agacacccua gcuggacgau caguccuugu 540

caaaagucug accccucaaa cucuacagcc ucaauggacc agacccuacc cggucauuua 600

uagcacacca acugccgucc aucugcagga cccucuccau uggguucacc auuccagaau 660

aaagccaugc ccaucagaca gccagcuuga ucucuccucu uccuccugga agccacaaga 720

uuaggccgag agccgaucag acaaacaacc uacaacccuu aagcuccugg cagcgcccag 780

ccaaggccau gcuuccaugc aacacuccuu ccaaauggcc aucccagcau gcuuccaagc 840

aggcuucauc cguuccucug gacccucauc ucuuaagacc ugccgccuau aaaaaggauu 900

auaucuugag acccuauccu cuaaaauuuu uuccacaccc aaaacaaaaa aucucugggu 960

caaaagucua aaacgcuuag gcuggcaacc aucagauccu ugcccauggu guccucaagc 1020

cuacucucau gaaauggaca acaguacacg cauauggggc caguuccaca uauuuggcaa 1080

ccagaccagc auccaggaca acacaaagua uguuguuugu uguuagaggg cuugggacau 1140

uucacucuuu gccagccuca gcuuaaucca ggagacaaag auuauuuucc uuauuaucuc 1200

uucugcauag gaucugcaau cagaacuauu gaacuucucc auucagaccg ccacucacac 1260

cuaugggaaa aggguaaugu aucaucggcu uagcaacagg gaauacuauu cguaugaugg 1320

aaaaugggga caaaaggcuu ugguacauaa aacauuauuc cuuccuuggc cuaaaaacuc 1380

aucgccaccu acauuaaagc uaauaugccu gauuacuguu uuuagagaac uuauuuuauu 1440

agggcaguuc caagcucaaa aauacgcuaa cuggcaccuu guuagcuaca uaaaaaugca 1500

cccuagaccc gaaacuuacu agacucauua uaaaauuuuc uuuaaggugu ccacgcaguc 1560

ccuggucaca cuugaagcag uccggagaaa uaucagcccu accccaguaa uccccagaag 1620

gaacuuacac uuuuuuuuaa ucuuuuccua caacuucaua uuuuauaaau aaaaagacaa 1680

aaaugucagg ccugugagcu gaagcuuagc cauuguaacc ccugugaccu gcacauaucc 1740

guccaggugg ccugcaggag ccaagaaguc uggagcagcc gaaaaaccac aaagaaguga 1800

aacagccagu uccugccuua acuaauuaac ccaccuuacg acauuccacc auuaugacuu 1860

guccaccauu augacuuguu ccugcccugc cccaacugau caaucaaccc ugugacauuc 1920

uucuccugga caaugagucc caucaucucu ccaccaugca ccuugugacc cccuccucug 1980

cugaggauaa ccaccuuuaa cuguaacuuu ccacgccuac ccaagcccua uaaagcugcc 2040

ccucuccuau cucccuucac ugacucucuu uucggacuca gcccacuugc acccaaguga 2100

auuaacagcc uuguugcuca cacaaagccu gauugggugu cuucuauacg gacacgcgug 2160

acaggaaccu caacccaaag gcagucugau gaggugucua agauaaaagu agcggcacaa 2220

aggcuuuugu aaacagaggc guuucaugug guuuuccuuu ccuuuccuua uaugugaaaa 2280

ggugacagaa aagaaaucuu ccuaaaagag ucag 2314

<210> 5

<211> 1307

<212> RNA

<213> Artificial sequence

<400> 5

acuuaucugc agacuuguag gcagcaacuc acccucacuc agaggucuuc ugguucugga 60

aacaacucua gcucagccuu cuccaccaug agccucagac uugauaccac cccuuccugu 120

aacagugcga gaccacuuca ugccuugcag gugcugcugc uucugucauu gcugcugacu 180

gcucuggcuu ccuccaccaa aggacaaacu aagagaaacu uggcgaaagg caaagaggaa 240

agucuagaca gugacuugua ugcugaacuc cgcugcaugu guauaaagac aaccucugga 300

auucauccca aaaacaucca aaguuuggaa gugaucggga aaggaaccca uugcaaccaa 360

gucgaaguga uagccacacu gaaggauggg aggaaaaucu gccuggaccc agaugcuccc 420

agaaucaaga aaauuguaca gaaaaaauug gcaggugaug aaucugcuga uuaauuuguu 480

cuguuucugc caaacuucuu uaacucccag gaaggguaga auuuugaaac cuugauuuuc 540

uagaguucuc auuuauucag gauaccuauu cuuacuguau uaaaauuugg auauguguuu 600

cauucugucu caaaaaucac auuuuauucu gagaagguug guuaaaagau ggcagaaaga 660

agaugaaaau aaauaagccu gguuucaacc cucuaauucu ugccuaaaca uuggacugua 720

cuuugcauuu uuuucuuuaa aaauuucuau ucuaacacaa cuugguugau uuuuccuggu 780

cuacuuuaug guuauuagac auacucaugg guauuauuag auuucauaau ggucaaugau 840

aauaggaauu acauggagcc caacagagaa uauuugcuca auacauuuuu guuaauauau 900

uuaggaacuu aauggagucu cucagugucu uaguccuagg augucuuauu uaaaauacuc 960

ccugaaaguu uauucugaug uuuauuuuag ccaucaaaca cuaaaauaau aaauugguga 1020

auaugaaucu uauaaacugu gguuagcugg uuuaaaguga auauauuugc cacuaguaga 1080

acaaaaauag augaugaaaa ugaauuaaca uaucuacaua guuauaauuc uaucauuaga 1140

augagccuua uaaauaagua caauauagga cuucaaccuu acuagacucc uaauucuaaa 1200

uucuacuuuu uucaucaaca gaacuuucau ucauuuuuua aacccuaaaa cuuauaccca 1260

cacuauucuu acaaaaauau ucacaugaaa uaaaaauuug cuauuga 1307

<210> 6

<211> 2145

<212> RNA

<213> Artificial sequence

<400> 6

aguucugcau uucugcagag acagaaagaa acgcagcucu ugacuucuuu uuuguaaaca 60

uuacuguaag aguugugaua acuuuuuauu cuacuaugua uauguaugga auaguauuaa 120

uaaaugaacu agggaaggau guaauaaauu agacaucucu ucauuuuaga gagaagaugg 180

aaacaacauu gcuuuucuuu ucucaaauaa auauguguga aucaaaagaa aaaacuuuuu 240

ucaaguuaau acaugguuca ggaaaagaag aaacaagcaa agaagccaaa aucagagcua 300

aggaaaaaag aaauagacua agucuucuug ugcagaaacc ugaguuucau gaagacaccc 360

gcuccaguag aucugggcac uuggccaaag aaacaagagu cuccccugaa gaggcaguga 420

aaugggguga aucauuugac aaacugcuuu cccauagaga uggacuagag gcuuuuacca 480

gauuucuuaa aacugaauuc agugaagaaa auauugaauu uuggauagcc ugugaagauu 540

ucaagaaaag caagggaccu caacaaauuc accuuaaagc aaaagcaaua uaugagaaau 600

uuauacagac ugaugcccca aaagagguua accuugauuu ucacacaaaa gaagucauua 660

caaacagcau cacucaaccu acccuccaca guuuugaugc ugcacaaagc agaguguauc 720

agcucaugga acaagacagu uauacacguu uucugaaauc ugacaucuau uuagacuuga 780

uggaaggaag accucagaga ccaacaaauc uuaggagacg aucacgcuca uuuaccugca 840

augaauucca agauguacaa ucagauguug ccauuugguu auaaagaaaa uugauuuugc 900

ucauuuuuau gacaaacuua uacaucugcu ucuaacauau cgcauguuua uguuaagauu 960

uggucccauc cuuuaaacug aaauauguca ugugaaauua uuuuaaaaau guaaaaacaa 1020

aacuuucugc uaacaaaaua cauacaguau cugccaguau auucuguaaa accuucuauu 1080

ugaugucauu ccauuuauaa ucagaaaaaa aacuuauuuc uuaaucaaaa ggcaguacaa 1140

aaaaaguaau aauguuuuau aagauuguag aguuaaguaa aaguuaagcu uuugcaaagu 1200

ugucaaaagu ucaaacaaaa gucuaguugg gauuuuuuac caaagcagca uaauaugugu 1260

uauauaaaca uaauaauacu cagauaucca aauguucaga uagcauuuuu cauaaugaau 1320

guucucuuuu uuuugguaau aguguagaag ugaucugguu cuuacaaugg gagaugaaga 1380

acauuuauua uuggguuacu acuaacccug ucccaagaau aguaauauca ccucuaguua 1440

uaagccagca acaggaacuu uugugaagac acauucaucu cuacagaacu ucagauuaaa 1500

uauaaucuag auuaaugacu gagaauaaga uccacauuug aacucauucc uaagugaaca 1560

uggacguacc caguuauaca aaguacuucu guuggucaca gaaacaugac cagauuuugc 1620

auaucuccag guagggaacu aaguagacua ccuuaucacc ggcuaagaaa acuugcuacu 1680

aaacuauuag gccaucaaug gcuugaauaa aaaccagaga agguuuuucc caggacgucu 1740

cauguuuggc ccuuuagaau ugggguagaa aucagaaaug agaugagggg aagaagcaag 1800

gagucuaagg cccuagcgau uugggcaucu gccacauugg uucauauuca gaaaguguua 1860

ucucauugau uauauucuug uuaagcaaau cuccuuaagu aauuauuauu caaauaagau 1920

uauacucaua caucuauaug ucacuguuuu aaagagauau uuaauuuuua auguguguua 1980

cauggucugu aaauauuugu auuuaaaaau gccaugcauu aggcuuugga aauuuaaugu 2040

uaguugaaau guaaaaugug aaaacuuuag aucauuugua guaauaaaua uuuuuaacuu 2100

cauucauaca guuaaguuua ucugacaaua aaagcucuga cugaa 2145

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

tgcgtccctc gcattcttta 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

gacaggagac acttgagggc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

cctactacac acaggggctc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence

<400> 10

ttccagaagc tcctcatggg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

ctgctttgcc atttcccctt 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

gttgatgcca cacagaggga 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

aaccatcaga tccttgccca 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

aatatgtgga actggcccca 20

<210> 15

<211> 18

<212> DNA

<213> Artificial sequence

<400> 15

tgagacagaa tgaaacac 18

<210> 16

<211> 17

<212> DNA

<213> Artificial sequence

<400> 16

aggtgatgaa tctgctg 17

<210> 17

<211> 18

<212> DNA

<213> Artificial sequence

<400> 17

tggactagag gcttttac 18

<210> 18

<211> 18

<212> DNA

<213> Artificial sequence

<400> 18

atttgttgag gtcccttg 18

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

gtaacccgtt gaaccccatt 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

ccatccaatc ggtagtagcg 20

Claims (13)

1. Use of an rna combination as a biomarker in any of the following A1-A3:

   a1, preparing a product for diagnosing or assisting in diagnosing gastric precancerous lesions;

   a2, preparing a product for screening or assisting in screening gastric precancerous lesions;

   a3, preparing a product for distinguishing or assisting in distinguishing gastric precancerous lesions from healthy people;

   the RNA combination is any one of the following:

   (a1) INHBA-AS1, AK001058, UCA1 and RGS18;

   (a2) CEBPA-AS1, INHBA-AS1, AK001058, UCA1 and RGS18;

   (a3) INHBA-AS1, AK001058 and RGS18;

   (a4) AK001058 and RGS18;

   (a5) CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18.
2. 2. Use of a substance for detecting RNA combinations in any of the following A1-A3:

   a1, preparing a product for diagnosing or assisting in diagnosing gastric precancerous lesions;

   a2, preparing a product for screening or assisting in screening gastric precancerous lesions;

   a3, preparing a product for distinguishing or assisting in distinguishing gastric precancerous lesions from healthy people;

   the RNA combination is any one of the following:

   (a1) INHBA-AS1, AK001058, UCA1 and RGS18;

   (a2) CEBPA-AS1, INHBA-AS1, AK001058, UCA1 and RGS18;

   (a3) INHBA-AS1, AK001058 and RGS18;

   (a4) AK001058 and RGS18;

   (a5) CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18.
3. 3. The use according to claim 2, characterized in that: the substance is a primer pair.
4. 4. A use according to claim 3, characterized in that: the primer pair for detecting CEBPA-AS1 consists of two single-stranded DNA shown in SEQ ID No.7 and SEQ ID No. 8; the primer pair for detecting INHBA-AS1 consists of two single-stranded DNA shown in SEQ ID No.9 and SEQ ID No. 10; the primer pair for detecting AK001058 consists of two single-stranded DNA shown as SEQ ID No.11 and SEQ ID No. 12; the primer pair for detecting UCA1 consists of two single-stranded DNA shown in SEQ ID No.13 and SEQ ID No. 14; the primer pair for detecting PPBP consists of two single-stranded DNA shown in SEQ ID No.15 and SEQ ID No. 16; the primer pair for detecting RGS18 consists of two single stranded DNA shown as SEQ ID No.17 and SEQ ID No. 18.
5. 5. Use according to claim 3 or 4, characterized in that: the substance also contains a primer pair for detecting an internal reference; the internal reference is 18S rRNA.
6. 6. The use according to claim 5, characterized in that: the primer pair for detecting the internal reference consists of two single-stranded DNAs shown as SEQ ID No.19 and SEQ ID No. 20.
7. Use of rna combinations as biomarkers in any of the following B1-B3

   B1, preparing a product for diagnosing or assisting in diagnosing gastric cancer;

   b2, preparing a product for screening or assisting in screening gastric cancer;

   b3, preparing a product for distinguishing or assisting in distinguishing stomach cancer from healthy people;

   the RNA combination is any one of the following:

   (b1) CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18;

   (b2) CEBPA-AS1, AK001058, UCA1, PPBP and RGS18;

   (b3) CEBPA-AS1, AK001058, UCA1 and RGS18;

   (b4) CEBPA-AS1, AK001058 and RGS18;

   (b5) AK001058 and RGS18.
8. 8. Use of a substance for detecting RNA combinations in any of the following B1-B3:

   b1, preparing a product for diagnosing or assisting in diagnosing gastric cancer;

   b2, preparing a product for screening or assisting in screening gastric cancer;

   b3, preparing a product for distinguishing or assisting in distinguishing stomach cancer from healthy people;

   the RNA combination is any one of the following:

   (b1) CEBPA-AS1, INHBA-AS1, AK001058, UCA1, PPBP and RGS18;

   (b2) CEBPA-AS1, AK001058, UCA1, PPBP and RGS18;

   (b3) CEBPA-AS1, AK001058, UCA1 and RGS18;

   (b4) CEBPA-AS1, AK001058 and RGS18;

   (b5) AK001058 and RGS18.
9. 9. Use according to claim 7 or 8, characterized in that: the gastric cancer is early gastric cancer.
10. 10. The use according to claim 8, characterized in that: the substance is a primer pair.
11. 11. The use according to claim 10, characterized in that: the primer pair for detecting CEBPA-AS1 consists of two single-stranded DNA shown in SEQ ID No.7 and SEQ ID No. 8; the primer pair for detecting INHBA-AS1 consists of two single-stranded DNA shown in SEQ ID No.9 and SEQ ID No. 10; the primer pair for detecting AK001058 consists of two single-stranded DNA shown as SEQ ID No.11 and SEQ ID No. 12; the primer pair for detecting UCA1 consists of two single-stranded DNA shown in SEQ ID No.13 and SEQ ID No. 14; the primer pair for detecting PPBP consists of two single-stranded DNA shown in SEQ ID No.15 and SEQ ID No. 16; the primer pair for detecting RGS18 consists of two single stranded DNA shown as SEQ ID No.17 and SEQ ID No. 18.
12. 12. Use according to claim 10 or 11, characterized in that: the substance also contains a primer pair for detecting an internal reference; the internal reference is 18S rRNA.
13. 13. The use according to claim 12, characterized in that: the primer pair for detecting the internal reference consists of two single-stranded DNAs shown as SEQ ID No.19 and SEQ ID No. 20.