CN106434904A - CD133, EpCAM and CK19 combined assay kit for monitoring recurrence or metastasis of hepatocellular carcinoma in real time - Google Patents
CD133, EpCAM and CK19 combined assay kit for monitoring recurrence or metastasis of hepatocellular carcinoma in real time Download PDFInfo
- Publication number
- CN106434904A CN106434904A CN201610806556.9A CN201610806556A CN106434904A CN 106434904 A CN106434904 A CN 106434904A CN 201610806556 A CN201610806556 A CN 201610806556A CN 106434904 A CN106434904 A CN 106434904A
- Authority
- CN
- China
- Prior art keywords
- epcam
- detection
- content
- reagent
- recurrence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of medical biological detection, in particular to a kit used for assaying the expression of CD133, EpCAM and CK19 in circulating tumor cells (CTC) to monitor recurrence or metastasis of hepatocellular carcinoma after post-liver transplantation in real time and a corresponding assaying method of the kit. The invention provides a simple, convenient, quick, economic and accurate assay means for real-time monitoring of the recurrence and the metastasis of the hepatocellular carcinoma, so that a treatment scheme is timely adjusted, the clinical intervention is performed as early as possible, the disease progress is prevented, and the patient prognosis is improved. The invention provides a new means for the diagnosis of the recurrence and the metastasis of the hepatocellular carcinoma after post-liver transplantation and the improvement in the prognosis of the hepatocellular carcinoma.
Description
Technical field
The present invention relates to technical field of biomedical detection, specifically, is one kind for detecting in circulating tumor cell
The expression of CD133, EpCAM and CK19, comes test kit and its phase of monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or transfer
The detection method that answers.
Background technology
Hepatocarcinoma has onset concealment, and progress is fast, and the high feature of case fatality rate, is one of modal malignant tumor in the whole world.
?《Global cancer report 2014》Middle display, China increases cases of cancer height newly and ranks first in the world, wherein the new cases of hepatocarcinoma
All occupy first place in the world with death toll.At present, the sickness rate of China's hepatocarcinoma about 25.7/10 ten thousand, become mortality rate and are only second to stomach
Cancer, the third-largest malignant tumor of pulmonary carcinoma, it is seen that hepatocarcinoma is in the sternness of situation residing for China.
It is limited to existing detection technique level, most of liver cancer patients are in middle and advanced stage when making a definite diagnosis, to disease treatment
Extremely pessimistic；In addition, hepatocarcinoma has higher relapse rate after surgery, and easily there is drug resistance, therefore, although patient's active treatment, but
Wholistic therapy effect and prognosis are still poor, and postoperative five year survival rate is still below 20%.How liver cancer patient is improved in recent years
Prognosis, improves focus and difficult point that survival is always clinician and the research of vast researcher.
At present, the most frequently used Hepatocarcinoma screening and monitoring meanss are alpha-fetoprotein (Alpha in detection blood plasma
Fetoprotein, AFP) level and imaging examination such as liver ultrasound, nuclear magnetic resonance, NMR etc..Although however, AFP is the whole world answering
With widest hepatic carcinoma mark, but its sensitivity (about 40%～65%) and specificity (about 76%～96%) all do not make
People is satisfied with：As gravid woman and neonate, germ cell tumor, some nonmalignant diseases such as hepatitis, liver cirrhosis, congenital biliary
Obturation etc. is likely to the higher phenomenon of AFP occur, and there are about 33% small-sized hepatocarcinomas without there is the elevated phenomenon of AFP.With
Therapeutic Method and the raising of Image detection technical merit, developed country for hepatocarcinoma (<Discovery 3cm) has been remarkably reinforced, but
It is imaging examination, such as nuclear magnetic resonance, NMR also only has 30% for the hepatocarcinoma of 1～2cm.
This improves most important, existing clinical research to patient's prognosis improvement and clinical therapeutic efficacy early to find early treatment
As a result show, after early hepatocarcinoma treatment, five year survival rate is up to 50% or so.If after early hepatocarcinoma diagnosis and treatment or operation of liver cancer treatment
It is capable of the final result of accurate early prediction patient, that will be that postoperative individualized treatment provides decision-making foundation, and this is to patient survival
Directly affect.Therefore, in the urgent need to a kind of new inspection for being capable of early detection liver cancer recurrence or transfer in liver cancer treatment
Survey technology.
Circulating tumor cell (circulating tumor cell, CTC) refers to spin off from solid tumor and enter
The tumor cell of peripheral blood circulation, which is possible to detect in peripheral blood in the extreme early of tumor development.Examined by CTC
It can be that clinical progress, Outcome measure and prognosis evaluation of tumor etc. provide valuable scientific basis to survey, and which has been current
One of focus of tumor liquid biopsy research.CTC is detected in peripheral blood, imply that patient tumors have recurred or shift to incline
To.In addition, CTCs can reflect tumoral character, samples sources difficulty can be solved by the detection of CTC, especially postoperative nothing swells
A difficult problem for the patient tumors progress detection of tumor tissue sample.Therefore, achievable postoperative to liver Transplantation for Hepatocellular Carcinoma by combining CTC detection
Patient tumors recurrence or the early detection of transfer.
CK19 is typically used to the research of primary hepatocarcinoma as a kind of known stem cell labeling thing.CK19 not only may be used
So that substrate is destroyed, cause the change of cellular morphology, epimatrix is also can damage cells, beneficial to Nasopharyngeal neoplasms, migrate, occur more
The biological behaviour of tool aggressive, so as to reduce overall survival.Multinomial clinical research has confirmed, the positive expression of CK19 can
To strengthen multiplication capacity and the aggressive of cell, increase malignancy, ultimately result in patient's prognosis malas.Separately there is scholar
Find, or even after the interference that have adjusted other risk factors, the CK19 positive is still to have a strong impact on poor prognosis after HCC operation in patients
Individual index.CK19 positive expression height, causes patient Yi Fufa and poor prognosis.
CD133 is considered as the most important mark of the liver-cancer stem cell for finding so far.Multinomial it is experimentally confirmed that
CD133+ cell and the signal transduction of tumor, immunologic escape, radiotherapy opposing and drug resistance etc. have important dependency.Research table
Bright, the liver cancer patient life cycle of CD133 strongly expressed is substantially short compared with CD133 weak expression group.Sasaki etc. is in the research of hepatocarcinoma
Find, the expression of CD133 is related to the Overall survival of HCC patient, cytoplasmic expression CD133 is impact HCC patients overall survival
The risk factor of highly significant.The CD133 expression of detection Peripheral Blood of Patients with Hepatocellular Carcinoma, analyzes which with clinical pathologic characteristic, tumor distal end
The mutual relation of transfer etc., with important clinical meaning.
EpCAM is a kind of transmembrane glycoprotein for all having expression in many epithelial tissue of the mankind, tumor tissues and stem cell,
Including almost all of adenocarcinoma, some scale cancer, retinocytoma and hepatocarcinoma.EpCAM is not only the mark of tumor cell proliferation,
And the surface marker of liver-cancer stem cell.Studies have found that in liver cancer patient body, there is circulating stem cell sample EpCAM+ cell, can
An important indicator as the postoperative prognosis malas of hepatocarcinoma radical excision.The research of Du etc. finds, EpCAM is in metastatic gastric carcinoma
In compared with the substantially high expression of non-metastatic gastric cancer.The research such as Osta finds, expression of the EpCAM in breast cancer tissue is normal group
100～1000 times for knitting.It can be seen that, EpCAM can promote the Invasion and Metastasis of tumor cell, and which is in predicting tumors metastasis tendency, judgement
There is important indicative function in tumor prognosis.
CD133, EpCAM, CK19 or all can be used as independent prognostic factor, but its independent prognostic still has larger limitation
Property, there is certain false negative rate.And these three tumor markerses are joined together by detection kit of the present invention and detection method,
Collectively as the index of the postoperative detection of liver Transplantation for Hepatocellular Carcinoma, the biological behaviour of hepatocarcinoma can be preferably assessed, makes testing result more accurate
Really, prognosis is more accurate.Have not yet to see tri- tumor target of CD133, the EpCAM and CK19 expression combined monitoring liver cancer of application CTC
The pertinent literature report of post-transplantation recurrence or transfer.
Content of the invention
It is an object of the invention to provide one group is capable of the special of monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or transfer
Property molecular marked compound.
Another object of the present invention is to providing a kind of for detecting CD133, EpCAM and CK19 in circulating tumor cell
Expression, comes detectable or the test kit of monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or transfer, and its corresponding detection
Method.
To achieve these goals, the main technical schemes of the present invention are：
The present invention is by being enriched with Peripheral Blood of Patients with Hepatocellular Carcinoma circulating tumor cell (CTC) and detecting in circulating tumor cell
The expression of tri- kinds of tumor markerses of CD133, EpCAM and CK19, to realize answering liver cancer patient after liver transplantation tumor
Send out, transfer carries out monitor in real time.
First, circulating tumor cell is collected using the method that difference is mutually enriched with.Erythrocyte is removed by density gradient centrifugation,
Again leukocyte is removed by the method that immunomagnetic beadses are combined with density gradient centrifugation, finally harvest circulating tumor cell CTC.
Secondly, RNA extracting is carried out to the circulating tumor cell being enriched to, reverse transcription acquisition is carried out to the mRNA for obtaining
CDNA, then the expression of its tri- kinds of tumor markers of CD133, EpCAM and CK19 is monitored by real-time fluorescence quantitative PCR.
Finally, with GAPDH as internal reference, three kinds of tumor target expressions of results pass throughCalculate.Set up CTC separately and combine three kinds of tumor marks
Individually carry out liver cancer recurrence or transfer is detected, and CTC detects liver cancer recurrence or transfer while combining three kinds of tumor marks, i.e.,：CTC-
QPCR (CD133) detection, CTC-qPCR (EpCAM) detection, CTC-qPCR (CK19) detection, CTC-qPCR (CD133+EpCAM+
CK19) detect.While passing judgment on jointly testing result using ROC curve and two kinds of methods of inspection of X 2 test.Except above packet
Interpretation of result, in addition defines three tumor marks while another kind of criterion of detection have binomial or three carrying out interpretation of result
Positive for the CTC-qPCR testing result positive, only one positive or be all negative for CTC-qPCR testing result the moon
Property.Shown in the result of ROC curve and the analysis of two kinds of methods of inspection of X 2 test table 1 specific as follows.Two kinds of analysis results all show
Binomial or three positives are that the Sensitivity and Specificity of three tumor mark joint-detection of positive interpretation standard is optimal, and ROC curve
Inspection shows which individually detects with significant difference with respect to other tumor marks.
1 ROC curve of table and two kinds of method of inspection analysis results of X 2 test
As fully visible, CTC combines independent tumor while the sensitivity of three kinds of tumor mark joint inspections of joint and specificity are superior to CTC
The detection of mark.Three tumor markerses are unanimously raised as joint-detection index, by increasing capacitance it is possible to increase the spy of the test kit detection
The opposite sex.Individually tumor markerses analysis detection sensitivity is relatively low, is easily caused positive patient and fails to pinpoint a disease in diagnosis, and three molecule joint-detection are quick
Perception is higher, reduces and fails to pinpoint a disease in diagnosis patient.
A first aspect of the present invention, providing one group can be effective for Hepatocarcinoma Recurrence After Liver Transplantation, transfer diagnosis and liver
The specific molecular marker thing of cancer Index for diagnosis, the molecular marked compound is CD133, EpCAM and CK19.
Detect that the corresponding maturation body sequence of specific probe used by the molecular marked compound is as shown in table 2 below：
2 probe primer of table maturation body sequence table
A second aspect of the present invention, provides CD133, EpCAM and CK19 postoperative multiple in preparation monitor in real time liver Transplantation for Hepatocellular Carcinoma
Application in the detectable that sends out or shift or test kit.
Described detectable or test kit are supervised by the content for detecting CD133, EpCAM and CK19 in circulating tumor cell
Control Hepatocarcinoma Recurrence After Liver Transplantation or transfer.
Described detectable is to detect the reagent of CD133 content, EpCAM content and CK19 content in circulating tumor cell
Combination.
Described test kit comprising the reagent of CD133 content in detection circulating tumor cell, the reagent of EpCAM content and
The reagent of CK19 content.
In described detection biological sample, the reagent of CD133 content, is selected from：There is the specific PCR of detection visit to CD133
Pin primer etc..
In described detection biological sample, the reagent of EpCAM content, is selected from：There is the specific PCR of detection visit to EpCAM
Pin primer etc..
In described detection biological sample, the reagent of CK19 content, is selected from：There is the specific PCR probe of detection to CK19
Primer etc..
Described circulating tumor cell from：Fresh tumor tissue or peripheral blood whole blood available from object.
A third aspect of the present invention, provide a species specificity and sensitivity all fabulous CTC joint CD133, EpCAM,
Tri- tumor mark of CK19 detects the test kit of Hepatocarcinoma Recurrence After Liver Transplantation or transfer jointly.
Described test kit be by detecting in 7.5mL peripheral blood whole blood CD133, EpCAM, CK19 in circulating tumor cell
Expression, the recurrence of the postoperative tumor of real-time monitoring liver Transplantation for Hepatocellular Carcinoma or transfer, to take intervening measure, medicine to control as early as possible
Treat or change therapeutic scheme, prevent the development further of hepatocarcinoma.
Described test kit is comprising the reagent of CD133 content, EpCAM in the circulating tumor cell in detection peripheral blood whole blood
The reagent of content, and the reagent of CK19 content.
Described test kit be by CTC enrichment system, RNA extraction system, reverse transcription system, probe primer system and in real time
Fluorescent quantitation system constitutes.
Described CTC enrichment system reagent is constituted mainly by harvesting buffer, immunomagnetic beadses, separating medium, erythrocyte
Reason liquid composition；
Described RNA extraction system reagent is constituted mainly Carrier RNA, RNA lavation buffer solution, dehydrated alcohol etc.；
Described RNA extraction system also includes two important consumptive material ingredients, i.e. gDNA Filter column, RNA Filter column.
Described primer system is by general reverse transcription primer, three specificity real-time quantitative PCR primers and internal control primer
Composition, in a preferred embodiment of the invention, described primer system is specially：
General reverse transcription primer sequence：TGCTGTCAACGATACGCTACGTAACGGCATGACAGTGTTTTTTTTTTT
TTTTTTTTT(SEQ ID NO：9)；
The specificity real-time quantitative PCR upstream and downstream primer of three tumor mark CD133, EpCAM, CK19 and internal control primer GAPDH and
Its correspondent probe sequence information and relevant parameter are as shown in table 3 below：
3 probe primer sequence information table of table
The primer of test kit of the present invention is to check in CD133, EpCAM, CK19 and internal reference according to known bioinformatics
The ripe body sequence of GAPDH and design and (refer to http://microrna.sanger.ac.uk/sequences/), glimmering in real time
Fluorescent Quantitative PCR primer is all designed by 5 primer-design software of Primer.
In the test kit of the present invention, reverse transcription system, real time fluorescent quantitative system can be the conventional selections of this area.
Described reverse transcription system is made up of reverse transcription, reverse transcription system buffer and RNase inhibitor；
Described real time fluorescent quantitative system is by GoldenStar Mix, three tumor marks (CD133, EpCAM, CK19) and internal reference
(GAPDH) probe primer reagent composition.
In a preferred embodiment of the invention, the test kit of the present invention, concrete composition is as follows：
1) 10X concentration CRC buffer (10X Concentrated CRC Buffer), 1 bottle, 13mL/ bottle；
2) Saite CTC separating liquid (Cytelligen CTC Separation Matrix), 1 bottle, 6mL/ bottle；
3) Saite immunomagnetic beadses (Cytelligen Immuno-magnetic Beads), 1 pipe, 200 μ l/ are managed；
4) Carrier RNA, 1 pipe, 75 μ l/ are managed；
5) gDNA Filter column, 1；
6) RNA Filter column, 1；
7) Buffer RW1,1 pipe, 600 μ l/ are managed；
8) Buffer RW2,1 pipe, 1.2mL/ is managed；
9) RNase Free Water, 1 pipe, 1mL/ is managed；
10) dehydrated alcohol, 1 pipe, 1mL/ is managed；
11) Oligo 18T, 1 pipe, concentration:10 μM, 1 μ l/ is managed；
12) Radom primer, 1 pipe, concentration:10 μM, 1 μ l/ is managed；
13) dNTP, 1 pipe, 5 μ l/ are managed；
14) 5X reverse transcription buffer, 1 pipe, 5 μ l/ are managed；
15) RNase Inhibitor, 1 pipe, 1 μ l/ is managed；
16) reverse transcription, 1 pipe, enzyme activity unit 200U/ μ l, 1 μ l/ is managed；
17) GoldenStar Mix, 1 pipe, 20 μ l/ are managed；
18) real-time fluorescence quantitative PCR specific primer and probe：
CD133 special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CD133 special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
EpCAM special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
EpCAM special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CK19 special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CK19 special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
GAPDH special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
GAPDH special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CD133 specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
EpCAM specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CK19 specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
GAPDH specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
19)dd H2O (distilled water) 1 is managed, and 2ml/ is managed.
Present invention also offers above-mentioned CTC joint tri- tumor mark of CD133, EpCAM, CK19 detects that liver Transplantation for Hepatocellular Carcinoma is postoperative jointly
The application in the detection of recurrence or transfering reagent box.
By detecting tri- tumor mark expression of CD133, EpCAM, CK19 in liver Transplantation for Hepatocellular Carcinoma postoperative patient peripheral blood CTC,
Can primarily determine that whether the patient has liver cancer recurrence or metastasis tendency, make a definite diagnosis to make to check further, in time adjustment treatment
Scheme.
A third aspect of the present invention, provides a kind of simple and efficient, economic, accurate CTC and combines CD133, EpCAM, CK19
Three tumor marks detect the detection method of the mentioned reagent box of Hepatocarcinoma Recurrence After Liver Transplantation or transfer jointly.
Described detection method is：Peripheral blood whole blood is extracted, and circulating tumor cell is collected with the method that difference is mutually enriched with；To richness
The circulating tumor cell for collecting carries out RNA extracting；By reverse transcription system, RNA reverse transcription is become cDNA；Use real-time fluorescence quantitative PCR
System detectio CD133, EpCAM and the content of CK19.
Monitor in real time of the present invention, refer to patient's after liver transplantation every three months using test kit of the present invention and
Detection method is detected, monitors tumour progression by testing result, and tumor generally now is (but the iconography of micro- cancer embolus under mirror
Can not detect) or before there is naked eyes cancer embolus.
The present invention is by detecting CD133, EpCAM, CK19 in liver Transplantation for Hepatocellular Carcinoma postoperative patient Peripheral Circulation tumor cell
Three tumor mark expressions, real-time monitoring patient's after liver transplantation liver cancer recurrence and transfer, to carry out clinical intervention as early as possible, prevent
Disease progression, improves patient's prognosis.The present invention is liver Transplantation for Hepatocellular Carcinoma post operative diagnosis liver cancer recurrence and transfer, improves the prognosis of hepatocarcinoma
There is provided new means.
Description of the drawings
Fig. 1：Tri- tumor mark of CD133, EpCAM, CK19 expression in liver Transplantation for Hepatocellular Carcinoma pre-operative patients Peripheral Circulation tumor cell
Situation is compared with Survival；(caption：Define in three tumor mark detection of expression, three results are being labeled as in figure for feminine gender
0；It is positive to be labeled as 1 to have result；It is positive to be labeled as 2 to have binomial result；Three results are the labelling of the positive
For 3.)
Fig. 2：CD133 in Hepatocarcinoma Recurrence After Liver Transplantation first trimester peripheral blood in patients circulating tumor cell, EpCAM,
Tri- tumor mark expression of CK19 is compared with Survival；(caption：Define in three tumor mark detection of expression, three results are feminine gender
Be labeled as 0 in figure；It is positive to be labeled as 1 to have result；It is positive to be labeled as 2 to have binomial result；Three results
Be the positive is labeled as 3.)
Fig. 3：Tri- tumor mark CTC-qPCR joint detection results of CD133, EpCAM, CK19 are compared with survival of patients.(caption：Fixed
In adopted three tumor mark detection of expression, have binomial or three positive for the CTC-qPCR testing result positive, in figure is labeled as 2；Fixed
Justice only has a positive or is all the negative for CTC-qPCR testing result of feminine gender, and in figure is labeled as 1.)
Specific embodiment
The specific embodiment for the present invention being provided with reference to embodiment elaborates.
Agents useful for same of the present invention and raw material are all commercially available or can prepare by literature method.Unreceipted tool in the following example
The experimental technique of concrete conditions in the establishment of a specific crime, generally according to normal condition such as Sambrook et al.《Molecular cloning：Lab guide》(New
York：Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to normal condition, or
According to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage ratio and number are calculated by weight.
Embodiment 1：Prepare the test kit (amount of 1 person-portion) of the present invention
The kit forms of the present invention are as follows：
1) 10X Concentrated CRC Buffer, 1 bottle, 13mL/ bottle；
2) Cytelligen CTC Separation Matrix, 1 bottle, 6mL/ bottle；
3) Cytelligen Immuno-magnetic Beads, 1 pipe, 200 μ l/ are managed；
4) Carrier RNA, 1 pipe, 75 μ l/ are managed；
5) gDNA Filter column, 1；
6) RNA Filter column, 1；
7) Buffer RW1,1 pipe, 600 μ l/ are managed；
8) Buffer RW2,1 pipe, 1.2mL/ is managed；
9) RNase Free Water, 1 pipe, 1mL/ is managed；
10) dehydrated alcohol, 1 pipe, 1mL/ is managed；
11) Oligo 18T, 1 pipe, concentration:10 μM, 1 μ l/ is managed；
12) Radom primer, 1 pipe, concentration:10 μM, 1 μ l/ is managed；
13) dNTP, 1 pipe, 5 μ l/ are managed；
14) 5X reverse transcription buffer, 1 pipe, 5 μ l/ are managed；
15) RNase Inhibitor, 1 pipe, 1 μ l/ is managed；
16) reverse transcription, 1 pipe, enzyme activity unit 200U/ μ l, 1 μ l/ is managed；
17) GoldenStar Mix, 1 pipe, 20 μ l/ are managed；
18) real-time fluorescence quantitative PCR specific primer and probe：
CD133 special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CD133 special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
EpCAM special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
EpCAM special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CK19 special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CK19 special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
GAPDH special primer F, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
GAPDH special primer R, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CD133 specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
EpCAM specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
CK19 specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
GAPDH specific probe, 1 pipe, concentration:10 μM, 100 μ l/ are managed；
19)dd H2O (distilled water) 1 is managed, and 2ml/ is managed.
The ripe body sequence that the present invention checks in corresponding primer according to known bioinformatics is as follows：
CD133 maturation body sequence：
(F)5’AAUGACCCUCUGUGCUUGGU3’(SEQ ID NO：1)；
(R)5’GGAUUGAUAGCCCUGUUGGA3’(SEQ ID NO：2)；
CK19 maturation body sequence：
(F)5’UGAUAGUGAGCGGCAGAAUC3’(SEQ ID NO：3)；
(R)5’CUCCAAAGGACAGCAGAAGC3’(SEQ ID NO：4)；
EpCAM maturation body sequence：
(F)5’GGCCGUAAACUGCUUUGUGA3’(SEQ ID NO：5)；
(R)5’AGCCCAUCAUUGUUCUGGAG3’(SEQ ID NO：6)；
GAPDH maturation body sequence：
(F)5’ACACCCACUCCUCCACCUUU3’(SEQ ID NO：7)；
(R)5’UUCCUCUUGUGCUCUUGCUG3’(SEQ ID NO：8)；
Reverse transcription primer and real-time quantitative PCR primer are all designed by 5 primer-design software of Primer, give birth to work by Shanghai
Biological engineering limited company is responsible for primer synthesis.
The primer sequence of design is as follows：
1) general reverse transcription primer sequence：TGCTGTCAACGATACGCTACGTAACGGCATGACAGTGTTTTTTTTTTT
TTTTTTTTT(SEQ ID NO：9)；
2) the special real-time quantitative PCR primer sequence of CD133：
(F)5’AATGACCCTCTGTGCTTGGT3’(SEQ ID NO：10)；
(R)5’GGATTGATAGCCCTGTTGGA3’(SEQ ID NO：11)；
The special real-time quantitative PCR primer sequence of CK19：
(F)5’TGATAGTGAGCGGCAGAATC3’(SEQ ID NO：13)；
(R)5’CTCCAAAGGACAGCAGAAGC3’(SEQ ID NO：14)；
The special real-time quantitative PCR primer sequence of EpCAM：
(F)5’GGCCGTAAACTGCTTTGTGA3’(SEQ ID NO：16)；
(R)5’AGCCCATCATTGTTCTGGAG3’(SEQ ID NO：17)；
The special real-time quantitative PCR primer sequence of GAPDH：
(F)5’ACACCCACTCCTCCACCTTT3’(SEQ ID NO：19)；
(R)5’TTCCTCTTGTGCTCTTGCTG3’(SEQ ID NO：20)；
Preparing includes the test kit of following constituent：CTC enrichment reagents (Saite company), micro RNA extraction agent
(Magen company), dehydrated alcohol, general reverse transcription primer (100 μ l/ pipe concentration:10 μM), real-time quantitative PCR specific primer
(100 μ l/ pipe concentration:10 μM), RNase Free Water (1000 μ l/ pipe), ddH2O (2000 μ l/ pipe).
ddH2O does not contain RNase, DNase and proteinase, for dissolving reverse transcription primer, the real-time quantitative spy of synthesis
Specific probes primer, and as respective sample or the thinned water of primer.
General reverse transcription primer：It is responsible for primer by Shanghai Sheng Gong biological engineering limited company to synthesize, purity is PAGE
Level, the primer ddH after synthesis2O dissolves, final concentration of 10 μM.
Specificity real-time quantitative PCR primer：Designed by 5 primer-design software of Primer, work biological engineering is given birth to by Shanghai
Limited company is responsible for primer synthesis, and purity is that PAGE level, the primer after synthesis uses dd H respectively2O dissolves, and final concentration of 10
μM.
Embodiment 2：The detection method of the test kit of embodiment 1
First, sample collection：
Sample needed for detection is peripheral blood whole blood, and sample collection is easy and little to patient trauma's property, can achieve continuous prison
Survey.By can realize the reality of liver cancer recurrence or transfer to the detection of tri- tumor markerses of CD133, EpCAM, CK19 in whole blood
When monitor, by Hepatocarcinoma Recurrence After Liver Transplantation or transfer diagnosis reach a new high.
Sample collection：The peripheral blood of patient 7.5mL is collected in special BD blood taking tube (BD company ACD anticoagulant tube), softly
Turn upside down mixing, store under room temperature condition (15-30 degree Celsius), in 48h, deliver to test in laboratory.
2nd, in whole blood sample circulating tumor cell CTC enrichment：
2.1 preparation of reagents and preheating：
2.1.1 the preparation of 1 × Concentrated CRC Buffer：In clean 200mL graduated cylinder add 13mL10 ×
Concentrated CRC Buffer, adds ultra-pure water to 130mL, and the vial that cleaning is poured in mixing into is closed, places into water
27 DEG C of bath is preheated at least 20 minutes, takes out labelled, the dated name of an article, is prepared date, effect duration, is prepared people, obtain final product 1 ×
Concentrated CRC Buffer.
2.1.2 before testing, Cytelligen CTC Separation Matrix preheats at least 20 points for 27 DEG C in water-bath
Clock.
2.2 experimental procedure:
2.2.1 blood plasma is removed：
Yellow lid sample tube used by censorship is overturned end to end and is mixed, separately take a blank pipe and add water and corresponding weigh trim, Yu Chang
In warm centrifuge, 800g (or 1956rpm) is centrifuged 8 minutes；The sample supernatant that abandons after centrifugation is inhaled, to above reddish brown precipitation
At 5mm；Blood taking tube is overturned end to end and is mixed, and is poured 50mL centrifuge tube A into, then is drawn 1 × Concentrated CRC with 1mL rifle
Buffer 1mL is washed 2 times, and cleaning mixture is incorporated to centrifuge tube A.
2.2.2 erythrocyte is removed：
The 50ml centrifuge tube B of cleaning is taken, adds 3mL Cytelligen CTC Separation Matrix with 5mL liquid-transfering gun
Enter centrifuge tube B；With 5mL pipet, the blood suspension in A pipe is slowly added to B pipe Cytelligen CTC along wall
Separation Matrix top layer, then liquid-transfering gun absorption 1mL1 × Concentrated CRC Buffer 1mL washing A pipe, edge
Wall is slowly incorporated to B pipe；Trim, 450g (1467rpm) is centrifuged 8 minutes.After centrifugation, blood suspension can be divided into three layers.In transfer
Between tunica albuginea layer liquid and the supernatant to 50mL centrifuge tube C, discard red blood cell layer.If supernatant is less than 7.5mL, then plus 1 ×
HCTC buffer vertically shakes up liquid to 7.5ml.
2.2.3 the preparation of Immune-magnetic beads：
Draw 200 μ l Cytelligen Immune-magnetic beads to add in the flat centrifuge tube of 2mL, then at flat
1 × Concentrated CRC Buffer 1mL is added in the centrifuge tube of bottom, soft piping and druming is mixed, and is placed in magnetic frame (BEAVER)
After upper placement 1 minute, supernatant is abandoned with 1ml liquid-transfering gun.Add 1 × Concentrated CRC Buffer 200 with 1mL liquid-transfering gun again
μ l, obtains final product Immune-magnetic beads；
2.2.4 adsorb leukocyte
The 200 μ l of Immune-magnetic beads of preparation is added in 50mL centrifuge tube C, should be with side Deca during addition
While the mode for rocking centrifuge tube C is carried out.After mixing, centrifuge tube inclination (about 30 degree) is positioned on shaking table, 130rpm shakes 20 points
Clock.
2.2.5 Immune-magnetic beads (leukocyte) is removed：
3ml Cytelligen CTC Separation Matrix is added in clean 50ml centrifuge tube D, then will be upper
Immune-magnetic beads suspension in step is slowly added at D tube wall liquid level with 5mL pipet
Cytelligen CTC Separation Matrix top layer, after trim, 450g (1467rpm) is centrifuged 8 minutes.After centrifugation, will
The all of above liquid of Immune-magnetic beads is transferred to 50ml centrifuge tube E, retains to Immune-magnetic
Above beads at 100 μ l.The removal of leukocyte is achieved.1 × Concentrated CRC is added then at centrifuge tube E
Buffer is overturned and is mixed to volume 45mL, and after trim, 700g (1830rpm) is centrifuged 5 minutes；Abandoned with vacuum liquid-absorbing pumping after centrifugation
Supernatant is added 1 × Concentrated CRC Buffer 0.5mL, makes 1mL liquid-transfering gun softly blow and beat precipitate to 1mL, after
Liquid is transferred to the flat centrifuge tube of 2mL, notes retaining sample-adding pipette tips.
2.2.6 remnants Immune-magnetic beads (leukocyte) are removed：
Flat for upper step 2mL centrifuge tube is placed in magnetic frame upper 3 minute, the pipette tips for retaining at the 2nd minute along flat from
In heart pipe, Immune-magnetic beads offside wall gently blows and beats liquid 1～2 time, and 15 ° of rotating centrifugal pipe；Use after 1 minute
1mL liquid-transfering gun is transferred to flat for 2mL centrifugation liquid in pipe in 1.5mL centrifuge tube.
2.2.7 collect CTC cell：
By 1.5mL centrifuge tube shelf in 15mL centrifuge tube upper end, trim, overturn and mix, remove after room temperature 1050g centrifugation 3min
Supernatant, abandons as far as possible only, but should not encounter cell precipitation.The CTC cell being enriched to is carried out RNA extracting immediately.
3rd, circulating tumor cell RNA extracting：
75 μ l Carrier RNA are added in the CTC cell centrifugation pipe being enriched to, and fully dispel mixing cell, high speed whirlpool
Rotation 2min.Cell pyrolysis liquid is fully transferred in the gDNA Filter column on 2ml collecting pipe, 4 DEG C, 12000x g is centrifuged 1min.
GDNA Filter column is abandoned, 70% ethanol of equimultiple volume is added, fully piping and druming is mixed, transfer mixed liquor to the RNA on 2mL collecting pipe
In Filter column, 4 DEG C, 8000x g is centrifuged 1min.The liquid that abandons in collecting pipe, adds 600 μ l Buffer RW1 on pillar, and 4
DEG C, 8000x g is centrifuged 1min.The liquid that abandons in collecting pipe, adds 600 μ l Buffer RW2 (having used ethanol dilution) in pillar
On, 4 DEG C, 10000x g is centrifuged 1min.The liquid that abandons in collecting pipe, add 600 μ l Buffer RW2 (use ethanol dilution) in
On pillar, 4 DEG C, 8000x g is centrifuged 1min.The liquid that abandons in collecting pipe, 4 DEG C, 13000x g is centrifuged void column 3min, and pillar is turned
1.5mL centrifuge tube is moved to, adds 20ul RNase Free Water central to pillar, on ice standing 5min, 4 DEG C, 13000x g
Centrifugation 1min, the liquid resorption in centrifuge tube to pillar film central authorities stands 2min on ice, and 4 DEG C, 13000x g is centrifuged 1min,
Pillar is discarded, that is, completes the extracting of RNA.Put forward RNA concentration is determined using NanoDrop1000 and its quality is assessed, work as A260/
During ratio (1.8-2.2) of A280, meet detection by quantitative requirement, next step reaction can be carried out.
4th, mRNA reverse transcription becomes cDNA
4.1 reagents prepare
By sample, Oligo DT, Radom primer, dNTP, 5 × reverse transcription Buffer, RNase Inhibitor, anti-
Transcriptase M-MLV (200U/ μ l) takes out from refrigerator and is placed on ice.
4.2 preparation reaction systems are as follows：
By above reaction system after 70 DEG C of water-bath 5min, it is immediately placed on ice.
4.3 prepare reverse transcription system according to following system：
Slightly it is centrifuged after fully mixing, is reacted in PCR instrument (ABI9700).Response procedures are：
50℃ 60min
70℃ 10min
4℃ ∞
Tip head, EP pipe used by above step etc. are RNase Free consumptive material.
5th, Real-time PCR quantification of mrna
5.1 reagents prepare
Sample reverse transcription product, GoldenStar Mix, CD133 special primer and its correspondent probe, EpCAM are specifically drawn
Thing and its correspondent probe, CK19 special primer and its correspondent probe, GAPDH special primer and its correspondent probe, take from refrigerator
Go out to be placed on ice.
Original upstream and downstream primer is prepared into 100 μM of primer aqueous solution respectively, takes each 10 μ l of the upstream and downstream primer, adds phase
5 μ l of probe is answered, adds 75 μ l RNase Free H2O is prepared into 10 μM of probe primer mixed liquor, the primer mixed liquor
Can avoid light place in 4 DEG C of Refrigerator stores.
5.2 it is as follows to prepare reaction system：
Expanded according to following PCR response procedures：
Whole PCR course of reaction is supervised by the ABI-7500 real-time PCR of Applied Biosystems company of the U.S.
Survey.
According to above-mentioned real-time quantitative PCR condition, the reverse transcription product of each sample prepared by early stage is detected.Per sample
Each primer all does 3 parallel multiple pipes, takes its mean value feedback, and each PCR is determined includes negative (water) control.For preventing
Pollution, all reactions are all carried out in the cleaning laboratory table in prefecture, and template is added and primer adds in same district operation.For preventing from drawing
Thing dimer and non-specific amplification, all reactions are all operated on ice.
With GAPDH as internal reference, eventually throughIn method calculating circulating tumor cell, CD133, EpCAM, CK19's is relative
Expression.In three tumor mark testing results, it is the CTC-qPCR joint detection results positive to have binomial or three positive definition；Only
It is CTC-qPCR joint detection results feminine gender to have a positive or be all negative definition.The CTC-qPCR joint inspection result positive
Can determine whether as liver cancer recurrence or transfer.
Embodiment 3：The expression monitoring of liver-transplantation patients circulating tumor cell CD133, EpCAM, CK19 and prognosis
Detection kit is prepared according to embodiment 1, according to embodiment 2 kit test method to carrying out the liver of liver transplantation
Cancer patient P1 and P2 carries out the expression monitoring of preoperative and postoperative CD133, EpCAM, CK19.Postoperative carried out every three months once with
Visit sampling detection, the expression according to patient CD133, EpCAM, CK19 is predicted, judge liver cancer recurrence or transfer simultaneously and
When take corresponding treatment measure or adjustment therapeutic scheme.Concrete monitoring situation is as follows：
(1) peripheral blood collection is carried out to liver cancer patient P1 and P2 before carrying out orthotopic liver transplantation, and blood taking tube used is taken a blood sample for BD
Pipe, collection capacity is 7.5mL, room temperature preservation, delivers to test in laboratory in 48h.
(2) apply test kit of the present invention to be detected according to the detecting step of embodiment 2, record and analyze testing result.
Testing result see the table below 4.
(3) patient is carried out 3 months after orthotopic liver transplantation, gathers peripheral blood, inspection according to the peripheral blood collection method of step (1)
The same step of survey method (2), testing result see the table below 3.It can be seen that, through Post operation, it is substantially good that the situation of two patient of P1, P2 has
Turn.
(4) postoperative 6 months monitoring results show that two patient tumors are no substantially in progress, and can continue former therapeutic scheme.
(5) monitor within postoperative 9 months, patient P1 tri- all shows as feminine gender, and therapeutic outcome is preferable；Patient P2 has two results
Assume the positive, indicate tumour progression, have recurrence or metastasis tendency.By CT examination, patient's right lung is found further to patient P2
There are micro metastasis.
(6) postoperative 12 months, patient P1 was demonstrated by positive findingses, and tumor gets along with tendency, and indication may have drug resistance
Appearance etc., therapeutic scheme need to be adjusted in time；Patient P2 shows as three positive findingses, and indication status of patient is still to pernicious
Exhibition.
(7) postoperative 15 months, patient P1 showed full negative findings, and tumour progression is controlled, and new therapeutic scheme is feasible；
Patient P2 is dead in postoperative 14 months.
Table 4：Before liver cancer patient P1, P2 transplantation of liver and monitoring after operation result
Tri- indexs of CD133, EpCAM, CK19 be can be seen that through preoperative and Follow-up After monitoring result while monitoring, can
With Accurate Prediction result.
By detect patient CD133, EpCAM, CK19 expression can with monitor in real time patient tumors development situation, and
When prediction, judge recurrence or the transfer of hepatocarcinoma, be postoperative individualized treatment offer decision-making foundation.
Embodiment 4：
The present invention collects liver Transplantation for Hepatocellular Carcinoma postoperative patient (48) peripheral blood by clinical, and follow up time continues 18 months,
Feelings were expressed every three months with above-mentioned detection method detection peripheral blood in patients CTC situation and tri- tumor mark of CD133, EpCAM, CK19
Condition.Statistical analysiss evaluate independent CTC detection, single tumor mark Molecular Detection and three tumor mark molecule joint-detection efficiency.As a result such as
Shown in Fig. 1, Fig. 2, Fig. 3, the sensitivity of CTC joint tri- tumor mark detection of expression of CD133, EpCAM, CK19 and specificity are above
The independent detection of CTC joint individual molecule.There is intersection in view of in figure curve, there is Confounding Factor, Tarone- is used again to result
Ware is checked, and compares discovery, preoperative Single Molecule Detection result no significant difference (table 5) two-by-two through result；March before recurrence
Three joint-detection, three positive findingses are all variant with Quan Yin, positive and double positive findingses of individual event, P value respectively 0.003,
0.040th, 0.032 (table 6)；Define during three joint-detection double sun and three sun for joint inspection positive findingses, the complete cloudy and individual event of definition
Positive for joint inspection negative findings, analysis result finds, joint inspection positive findingses have significant difference, P value with joint inspection negative findings
For 0.023 (table 7), with statistical significance.
What the preoperative testing result of table 5 was survived compares two-by-two
Table 6 recurs comparing two-by-two for front testing result existence
Table 7 is overall to be compared
Test of Equality to the survival distribution of positive varying level.
Below the preferred embodiment to the invention is illustrated, but the invention be not limited to described
Embodiment, those of ordinary skill in the art can also make a variety of equivalents without prejudice to the invention spirit on the premise of
Modification or replacement, the modification of these equivalents or replacement are all contained in the application claim limited range.
Claims (9)
1.CD133, EpCAM and CK19 are preparing detectable or the reagent of monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or transfer
Application in box.
2. CD133, EpCAM and CK19 according to claim 1 prepare monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or
Application in the detectable of transfer or test kit, it is characterised in that described detectable or test kit are circulated by detection
The content monitoring Hepatocarcinoma Recurrence After Liver Transplantation of CD133, EpCAM and CK19 or transfer in tumor cell.
3. CD133, EpCAM and CK19 according to claim 1 prepare monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or
Application in the detectable of transfer or test kit, it is characterised in that described detectable is in detection circulating tumor cell
The combination of the reagent of CD133 content, EpCAM content and CK19 content.
4. CD133, EpCAM and CK19 according to claim 1 prepare monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or
Application in the detectable of transfer or test kit, it is characterised in that described test kit is comprising in detection circulating tumor cell
The reagent of CD133 content, the reagent of EpCAM content, and the reagent of CK19 content.
5. postoperative in preparation monitor in real time liver Transplantation for Hepatocellular Carcinoma according to claim 2-4 arbitrary described CD133, EpCAM and CK19
Recurrence or transfer detectable or test kit in application, it is characterised in that described circulating tumor cell from：Available from right
The fresh tumor tissue of elephant or peripheral blood whole blood.
6. CD133, EpCAM and the CK19 according to claim 3 or 4 is preparing monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation
Transfer detectable or test kit in application, it is characterised in that CD133 content in described detection circulating tumor cell
Reagent, the reagent of EpCAM content, and the reagent of CK19 content, be selected from：To CD133, EpCAM or CK19, there is detection special
The PCR primer of property.
7. CD133, EpCAM and CK19 combined detection kit of a kind of monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation or transfer,
Characterized in that, described test kit comprising detection peripheral blood whole blood in circulating tumor cell in CD133 content reagent,
The reagent of EpCAM content, and the reagent of CK19 content.
8. CD133, EpCAM and CK19 of monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation according to claim 7 or transfer
Combined detection kit, it is characterised in that described test kit be by CTC enrichment system, RNA extraction system, reverse transcription system,
Probe primer system and real time fluorescent quantitative system composition；Described probe primer system includes：
The special real-time quantitative PCR primer of CD133, such as SEQ ID NO:10 and SEQ ID NO:Shown in 11；
The special real-time quantitative PCR primer of CK19, such as SEQ ID NO:13 and SEQ ID NO:Shown in 14；
The special real-time quantitative PCR primer of EpCAM, such as SEQ ID NO:16 and SEQ ID NO:Shown in 17.
9. a kind of CD133 using monitor in real time Hepatocarcinoma Recurrence After Liver Transplantation as claimed in claim 7 or 8 or transfer,
The detection method of EpCAM and CK19 combined detection kit, it is characterised in that described detection method is：Extract peripheral blood complete
Blood, collects circulating tumor cell with the method that difference is mutually enriched with；RNA extracting is carried out to the circulating tumor cell being enriched to；By inverting
RNA reverse transcription is become cDNA by recording system；With real-time fluorescence quantitative PCR system detectio CD133, EpCAM and the content of CK19.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610806556.9A CN106434904A (en) | 2016-09-07 | 2016-09-07 | CD133, EpCAM and CK19 combined assay kit for monitoring recurrence or metastasis of hepatocellular carcinoma in real time |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610806556.9A CN106434904A (en) | 2016-09-07 | 2016-09-07 | CD133, EpCAM and CK19 combined assay kit for monitoring recurrence or metastasis of hepatocellular carcinoma in real time |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434904A true CN106434904A (en) | 2017-02-22 |
Family
ID=58164630
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610806556.9A Pending CN106434904A (en) | 2016-09-07 | 2016-09-07 | CD133, EpCAM and CK19 combined assay kit for monitoring recurrence or metastasis of hepatocellular carcinoma in real time |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434904A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586839A (en) * | 2017-09-28 | 2018-01-16 | 复旦大学附属中山医院 | Circulating tumor cell multiple markers combined detection kit and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103436621A (en) * | 2013-04-27 | 2013-12-11 | 北京明谛生物医药科技有限公司 | Method and kit for quickly detecting expression quantity of CK19 mRNA (messenger ribonucleic acid) |
| CN104781007A (en) * | 2012-11-09 | 2015-07-15 | 霍夫曼-拉罗奇有限公司 | In vitro capture and analysis of circulating tumor cells |
-
2016
- 2016-09-07 CN CN201610806556.9A patent/CN106434904A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104781007A (en) * | 2012-11-09 | 2015-07-15 | 霍夫曼-拉罗奇有限公司 | In vitro capture and analysis of circulating tumor cells |
| CN103436621A (en) * | 2013-04-27 | 2013-12-11 | 北京明谛生物医药科技有限公司 | Method and kit for quickly detecting expression quantity of CK19 mRNA (messenger ribonucleic acid) |
Non-Patent Citations (5)
| Title |
|---|
| DONG WOO KANG等: "Targeting phospholipase D1 attenuates intestinal tumorigenesis by controlling β-catenin signaling in cancer-initiating cells", 《JEM》 * |
| N. SUMRU BAYIN: "（THE ROLE OF FLT3 IN HEPATOCELLULAR CARCINOGENESIS", 《A THESIS SUBMITTED TO THE DEPARTMENT OF MOLECULAR BIOLOGY AND GENETICS AND THE INSTITUTE OF ENGINEERING AND SCIENCE OF BILKENT UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE》 * |
| ROMY ZEMEL等: "Expression of liver-specific markers in naive adipose-derived mesenchymal stem cells", 《LIVER INTERNATIONAL》 * |
| TARO YAMASHITA等: "EpCAM-positive hepatocellular carcinoma cells are tumor initiating cells with stem/progenitor cell features", 《GASTROENTEROLOGY》 * |
| ZHEN ZENG等: "Impact of stem cell marker expression on recurrence of TACE-treated hepatocellular carcinoma post liver transplantation", 《BMC CANCER》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586839A (en) * | 2017-09-28 | 2018-01-16 | 复旦大学附属中山医院 | Circulating tumor cell multiple markers combined detection kit and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108179190B (en) | Plasma exosome circRNA marker of non-small cell lung cancer and detection primer and kit thereof | |
| Ye et al. | Circulating tumor cells as a potential biomarker for postoperative clinical outcome in HBV-related hepatocellular carcinoma | |
| CN109576370B (en) | Biomarker and detection kit for bladder cancer diagnosis and recurrence monitoring | |
| CN110484624A (en) | A kind of gastric cancer biomarker and its detection method and application based on peripheral blood | |
| CN109777877A (en) | Detection kit for auxiliary diagnosis of cerebral aneurysm based on PTBP1 methylation and application thereof | |
| CN109187977A (en) | It is a kind of detect HER2 antigen different loci immunofluorescent reagent box and application | |
| CN109055555A (en) | A kind of lung cancer transfer diagnosis marker and its kit and application in early days | |
| CN104293919B (en) | A kind of SNP mark relevant to Non-smoking females lung cancer auxiliary diagnosis and application thereof | |
| CN109988845B (en) | A kind of application of new stomach cancer marker circ-EIF4G3 | |
| CN109825587B (en) | Glioma prognostic marker CPVL and application thereof | |
| CN105925719A (en) | Gene related to liver cancer differentiation and application of gene | |
| CN112501294B (en) | Colorectal cancer biomarker and application thereof | |
| CN100360684C (en) | Fluorescent quantitative RT-PCR detecting kit of 2-f(o)etoprotein (AFP)mRNA | |
| CN109355406A (en) | A kind of kit of the detection mycobacterium tuberculosis based on blood free nucleic acid | |
| KR102211972B1 (en) | Method for early diagnosis of breast cancer and monitoring after treatment using liquid biopsy multi-cancer gene biomarkers | |
| CN106434904A (en) | CD133, EpCAM and CK19 combined assay kit for monitoring recurrence or metastasis of hepatocellular carcinoma in real time | |
| CN109735612A (en) | The biomolecule marker and its kit of Kawasaki disease coronary aneurysm complication | |
| CN105671179A (en) | Application of serum microRNA in liver cancer diagnosis and diagnosis kit | |
| CN106636440B (en) | Blood plasma microRNAs is used to prepare the purposes of the diagnostic reagent of patients with lung adenocarcinoma in sieving and diagnosis male population | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN109666741A (en) | A kind of application of new gastric cancer marker gene circPTPDC1 | |
| CN106636450B (en) | It is a kind of for diagnosing the non-invasive marker object and kit of Lung Squamous Carcinoma Patients in non-smoking or slight smoking population | |
| WO2019095541A1 (en) | Composition and method for diagnosing and predicting breast cancer bone metastases | |
| CN110205377A (en) | The assessment in advance of Kawasaki disease risk | |
| CN103773761B (en) | Detect serum/plasma Microrna mark and the application thereof of cancer of the stomach |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination |