CN103421783A - Identification and application for functional region of paddy rice constitutive promoter - Google Patents

Abstract

The invention provides identification and application for a functional region of a paddy rice constitutive promoter and belongs to the technical field of plant genetic engineering. Eight different-length promoters (ZS1, ZS2, ZS3, ZS4, NYZ1, NYZ2, NYZ3 and NYZ4) in the same constitutive expression are obtained through the clone of two paddy rice varieties, and the nucleotide sequences are respectively shown in the SEQ ID1-8. The promoters are expressed in all tissues of a transformation plant, and the expression strength is the strongest in seed in the pustulation period. The invention discloses the eight promoters and a preparation method corresponding expression vectors of the promoters which are introduced in the paddy rice host through the transgenic method of agrobacterium-mediated transformation. The invention also discloses the development of the functional region, the functional site and the functional molecular marker of the promoter, and the functional molecular marker can be used for forecasting the seed protein content in different paddy rice varieties.

Description

Evaluation and the application of a paddy rice constitutive promoter functional area

Technical field

The present invention relates to plant genetic engineering field.Being specifically related to a paddy rice constitutive promoter identifies and applies.

Background technology

Growing of higher organism is that different genes is expressed in order and synergistic process on different time and space, and the expression of gene in this process height of expressive site, expression time, expression amount (open, close) is all to be subject to pleasantly surprised regulation and control.The regulation and control of genetic expression can divide the control methods on horizontal four levels after transcriptional level, post-transcriptional level, translation skill and translation, and wherein the regulation and control of transcriptional level are most economical, flexible, are again the most important and complicated regulation and control.Therefore the cis factor relevant to transcriptional level is called promotor (thereby referring to that the RNA polymerase specific recognition is also with it in conjunction with initial section of DNA sequence of transcribing downstream gene), and it has controlled the height of time, tissue and the expression amount of genetic expression.And promotor is one of most important cis element of regulate gene expression on transcriptional level, the interaction between it and RNA polymerase and other cofactors of albumen as trans element is the essence of promoter regulation pattern.Plant promoter, can be divided into constitutive promoter, tissue-specific promoter, inducible promoter according to the difference of the expression of the gene of its driving.Also have in addition bidirectional promoter and the more special promotor of this two class of alternative promoter.But this classification is relative, in specific situation, some promotor often also has both the characteristic of other type promotor.The controlling element that promotor is important as regulate gene expression on transcriptional level, be the target of many transcription factors and RNA polymerase effect, structure, functional area, binding mode and the function thereof etc. of therefore furtheing investigate promotor are significant for answering basic theories problem in biology.

In plant genetic engineering, needs according to exogenous gene expression, if need foreign gene can be lastingly in plant, stable, express efficiently, while making the product of exogenous gene expression give full play to the function of its function or research gene, generally all use constitutive promoter.Constitutive promoter drives foreign gene, and plant, each organizes all expression, but expose gradually some problems in concrete application, as the expression of foreign gene has the characteristic of lasting constant expression, can consume nutritive substance and energy in plant materials excessively, thereby the absorption to the nutritive substance of plant brings immense pressure, also can produce many heterologous proteins and metabolic substd simultaneously, but these products may be unwanted to recipient plant, what have may be poisonous, and then the normal growth that can have influence on plant is grown, to cause death (Ehsani et al. when serious, 2003, Miyao and Fukayama, 2003, .And use a plurality of foreign genes of same promoters driven will cause the phenomenons (Kumpatla et al., 1998) such as gene silencing or co-suppression simultaneously.The constitutive promoter of widespread use in plant genetic engineering at present is mainly from the 35S promoter of cauliflower mosaic virus (CaMV), rouge alkali synthetase gene NOS promotor, paddy rice Actl promotor and the corn ubiquitin protein Ubiquitin promotor of agrobacterium tumefaciens Ti-plasmids.The constitutive promoter be most widely used in plant genetic engineering is complete 35S promoter, and it all is widely used in the high plant researches such as transgenic paddy rice, Arabidopis thaliana, potato, wheat.In plant genetic engineering,, may there be potential biological insecurity in application clone's promoter sequence out from virus, therefore, extremely important from the active strong Endogenous Type constitutive promoter of plant cloning.

Eukaryotic rna polymerase has three kinds, and therefore the promotor of correspondence has three classes with it, and I type promotor is mainly used to transcribe 5srDNA, needs locate RNA polymerase by the combination of general transcription factor (TFIIA, TFIIB and TFIIC).II type promotor is mainly used in transcribing of tRNA gene, but need to locate RNA polymerase by the combination of TFIIB and TFIIC.III type promotor is mainly used in transcribing of scRNA gene, needs the participation (Wei Jing, 2011) of TFIIB and other cofactor.Wherein II type promotor is topmost promotor, and its basic structure as shown in Figure 1.

Basic promotor is the site of RNA polymerase combination, so it determines initial (Juven-Gershon et al., 2006) of genetic transcription.Basic promotor comprises two conservative structures, the one, and the initiation site of transcribing (initiator. is abbreviated as Inr), be Pre-mRNA cap site.The sequence of the initiation site both sides of transcribing is relatively conservative, is typically expressed as PyPyANPuPy, and wherein Py represents pyrimidine, and Pu represents purine, and N represents any base, and A is initiation site (+1) (Juven-Gershon et al., 2008).Another common conserved structure is to be positioned at the conservative region (TATAbox) that the common sequence of the 7bp left and right centered by transcription initiation site upstream-25～-30 is TATAAAA (sequence of non-template chain), the A of the 5th, 7 of this conservative region is usually replaced by T, therefore the base frequency of conserved sequence is T95A87T93A85A63A83A50 (poplar discrimination life etc., 2003).And the nucleotide sequence between TATA box and Inr has important impact to the speed of transcribing, although it can not change the initiation site of transcribing, but the distance between these two conserved sequences is extremely important to accurate transcription initiation, if extend or shorten the distance between two elements may cause the forfeiture (Zhu et al., 1995) of transcriptional activity.

In 100～200bp of core promoter scope, the zone of a transcriptional control is arranged usually, some sequential elements in this zone show cell type specificity usually, and its function is mainly to improve the specificity and efficiency of transcribing.And have 3 short sequential elements can cause transcriptional level obviously to descend, and these 3 elements are respectively TATA box (30), CCAAT box (75) and GCIsland (90), latter two element is larger for the impact of transcriptional level.All confirmed the existence of CCAATbox and GCIsland in a lot of promotors.In eukaryotic gene, CCAAT box ubiquity, its conserved sequence is GG (T/C) CAATCT, and be positioned at transcription initiation site upstream approximately-80～-the 100bp place, the frequency (Bezhani et al., 2001) that regulatory transcription is initial.Except some upstream elements that generally all contain, also contain special upstream element in some promotor in promotor.These promotors may belong to same gene family, or belong to the regulating and controlling sequence of tissue specific expression gene.G box for example, its conserved sequence is CACGTG, can regulate the transcripting start point frequency.This element extensively exists in Plant Genome, participate in the response as methyl jasmonic acid first vinegar, ethene, dormin of photoresponse, anoxybiosis and some hormones, and in gene specific expressed, play a role (Terzaghi and Cashmore, 1995).

Along with the development of computer and network technologies, information biology has obtained development fast, and the prediction that is established as promotor and the research in mass data storehouse provide convenience.Software through promoter prediction commonly used has GENEFIND and GENESCAN etc. now.Promoter in eukaryote database (http://www.Epd.isb.ch) will put together with the promoter sequence of delivering, for conserved domain and the functional domain of finding promotor are provided convenience, but, because of the promoter in eukaryote more complicated, the promoter prediction result can only be as a reference and can not be blood sure.And, along with the developing rapidly of biotechnology, the genome sequencing work of a lot of species has completed, this is a qualitative leap for biological research.Gene order design Auele Specific Primer according to having delivered, utilize the pcr clone promotor, and this method is simple and quick, and does not need very advanced equipment and instrument, and the investigator adopted this method cloning promoter more in recent years.Study the promotor cis-acting elements by the method for deletion analysis, it is the method for using in recent years often research promoter function zone, the party's ratio juris is from 5 ' end, 3 ' end or middle partial sequence of deleting the promotor different lengths, the promoter fragment of a series of different lengthss of obtaining clone is connected to expression vector, the promotor downstream connects a reporter gene, then is transformed into acceptor material.The difference that finally detects the expression of the promotor of different fragments in acceptor material is analyzed the functional area of promotor (Shiyou et al., 2007).

Method research and improvement farm crop by biotechnology and plant genetic engineering have important application prospect (woods is supported the army, 2002) in agricultural development.Paddy rice is one of important in the world food crop, and the yield and quality that utilizes biotechnology to improve paddy rice is one of important channel solved food problem, and the height of rice quality is direct and lives people are closely related.In order to improve the quality and yield of paddy rice, utilize plant gene engineering technology improvement rice varieties, the rice varieties that obtains good quality and high output is very important.For foreign gene is expressed by the pattern in ideal in plant, select the expression of suitable promoters driven foreign gene just to become very important.Therefore to the clone of paddy rice constitutive promoter, the evaluation of functional area, the evaluation of expression pattern and the further investigation of function thereof, not only contribute to illustrate the basic theory such as growth, growth, pathways metabolism of plant, and can be for instructing the cultivation of transgenosis new variety, thereby create huge economic benefit and social benefit, and then better be human being's production and service for life.

The present invention utilizes relevant Protocols in Molecular Biology and method, be separated to the promoter region of a constitutive gene upstream different lengths from the genome of paddy rice " precious Shan 97 " and " Nan Yang accounts for " kind, the promotor of different lengths is merged to reporter gene GUS, then by agrobacterium-mediated transformation be transformed into paddy rice japonica rice variety " in spend 11 " (ZH11) in, finally by different tissues is carried out, GUS dyes and the quantitative assay of GUS activity, and then identifies promoter expression pattern and functional area and functional site.And detect different rice varieties in 197 parts of Chinese Mini core collection resources for six pairs of special primers of functional site design of promotor, the functional site of finding this constitutive promoter has material impact for grain protein content in the long-grained nonglutinous rice subspecies, and this will provide for the quality breeding of paddy rice new resource.

Summary of the invention

The objective of the invention is to identify the functional area of a constitutive promoter from two rice varieties, utilize the ability of this functional area improvement rice quality.In order to facilitate research and utilization, the applicant has created ZS1, ZS2, ZS3, ZS4, NYZ1, NYZ2, NYZ3, the NYZ4 promotor of totally 8 different lengthss.Then these promotors being merged to reporter gene GRD beta-glucuronidase genes (hereinafter to be referred as gus gene) imports in paddy rice " in spend 11 " (crop investigations institute of Chinese Academy of Agricultural Sciences business management kind), carry out the mensuration of GUS histochemical stain and GUS activity and analyze its expression pattern, and then identify its functional area and site, and design function is marked in 197 parts of Chinese Mini core collection varieties of resources and detects, for utilize this promotor in the future, lay a good foundation.

The present invention relates to separate and apply the functional area of a constitutive promoter in two rice varieties, and expression pattern and the application facet of this functional area are set forth.Wherein, described ZS1, ZS2, ZS3, ZS4 fragment all derive from Zhenshan 97B, and as sequence table SEQ ID NO:1, SEQ ID NO:2, shown in SEQ ID NO:3 and SEQ ID NO:4.Described NYZ1, NYZ2, NYZ3, NYZ4 fragment all derive from Nan Yang and account for, and as sequence table, as sequence table SEQ ID NO:5, SEQ ID NO:6, shown in SEQ ID NO:7 and SEQ ID NO:8.

The paddy rice that the present invention obtains (Oryza sativa) ZS1 delivers China on December 11st, 2012. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, its deposit number is CCTCC NO:P201213.

The present invention realizes (technological line is shown in Fig. 2) like this

According to the constitutive expression qpc1 gene that the applicant is cloned into before, from Zhenshan 97B, (be the long-grained nonglutinous rice maintenance line respectively, derive from Jiangxi Province academy of sciences), Nan Yang accounts in the genome of (deriving from Shanghai City Agricultural biological Gene Center) kind and utilizes the methods such as PCR method, genetic transformation to separate and identify functional area and the functional site of the promotor with composing type.The sequence of described promotor ZS1, ZS2, ZS3, ZS4, be respectively the fragment by promotor Zhenshan 97B (ZS) brachymemma, they lay respectively at transcription initiation site (+1) upstream-371bp ,-692bp ,-1220bp ,-sequence of 1808bp.These 4 fragments all have the function that independently promoter gene is expressed, and in each tissue in transformed plant, expression are all arranged, and wherein in the grouting seed in period, express the strongest.The sequence of described promotor NYZ1, NYZ2, NYZ3, NYZ4, respectively to be accounted for the fragment of (NYZ) brachymemma by the promotor Nan Yang, they lay respectively at transcription initiation site (+1) upstream-377bp ,-698bp ,-1226bp ,-sequence of 1814bp.These 4 fragments all have the function that independently promoter gene is expressed, and in each tissue in transformed plant, expression are all arranged, but its expression amount is different.

Concrete steps of the present invention are:

According to the qpc1 gene that the applicant is cloned into before, adopt the method for fragment deletion, design four pairs of special primers (in Table 1), from the genome of paddy rice Zhenshan 97B, amplification obtains its promotor, and they are connected and are built into fusion gene with reporter gene GUS encoding sequence respectively, then (this carrier is by State Key Laboratory of Crop Genetic Improvent doctor Ye Rongjian, to be built on the basis of the double base overexpression vector pCAMBIA1301S that is so kind as to give in Australian CAMBIA laboratory to be loaded into double base Ti carrier DX2181, the information such as the collection of illustrative plates of this carrier and multiple clone site are shown in Fig. 3, details are shown in embodiment 2) on, thereby be assembled into ZS1-GUS, ZS2-GUS, ZS3-GUS, the ZS4-GUS carrier, by agriculture bacillus mediated genetic transformation method, these four carriers are proceeded in paddy rice acceptor " in spend 11 " again, transform empty carrier DX2181 as negative control simultaneously, transform cauliflower mosaic virus 35 S promoter GUS (CaMV35S-GUS) as positive control.By histochemical stain and GUS quantitative analysis, investigate these four promotors and change in the expression of different development stage after the acquisition transgenosis.Detected result shows: these four promotors all have expression in each tissues such as root, stem, leaf, flower, young fringe, clever shell, endosperm, embryo, kind skin, thereby verify that this promotor is constitutive promoter.

Equally, fragment ZS1, ZS2, ZS3, the ZS4 that the applicant will derive from 4 promotors, 5 ' the end disappearance that Nan Yang accounts for is connected respectively to the expression vector of GUS, build NYZ1-GUS, NYZ2-GUS, NYZ3-GUS, NYZ4-GUS the result of totally four carrier rice transformations " in spend 11 " show: 4 fragments that derive from this promotor all have the function that independently promoter gene is expressed, and in each tissue of different development stage, expression are all arranged.

Owing to finding that before accounting for middle qpc1 gene in the precious Shan 97 of near isogenic line and near isogenic line Nan Yang does not exist and cause amino acid whose variation in its coding region, just exists 20 mutational sites at promoter region.So the performance of these 8 promotors of analysis-by-synthesis in transgenosis " in spend 11 ", can determine that the zone there are differences between ZS1 and NYZ1 is the functional area (seeing Fig. 4) of qpc1 gene promoter.In this functional area, Zhenshan 97B and Nan Yang account between these two kinds and only have a SNP site and an insertion/deletion mutational site there are differences, and are functional site (Fig. 5).Design a pair of special primer and detect the rice varieties of 197 parts of Chinese Mini core collection resources for this insertion/deletion mutational site, then measure its protein content, then the rice variety of added up, association analysis finding in this insertion/deletion mutational site to exist the 6bp disappearance is than the protein content of the rice variety that has the 6bp insertion (P<0.01) (Fig. 6, the table 2) that significantly raise.

The invention has the advantages that:

1, the present invention has identified promotor ZS1, ZS2, ZS3, ZS4 and NYZ1, NYZ2, NYZ3, the NYZ4 of constitutive expression, and the nucleus of controlling its expression amount and expression pattern, for genetically engineered and molecular breeding provide the promotor resource of new constitutive expression.

2, the functional site the present invention is directed in the promotor nucleus identified has been developed a pair of functional mark, can be directly used in the detection of the protein content of rice variety.

3, the present invention can be for evaluation and the clone of paddy rice constitutive promoter.

The accompanying drawing explanation

What sequence table SEQ ID NO:1-SEQ ID NO:4 showed is to derive from the allelic promoter sequence of NYZ1, NYZ2, NYZ3, NYZ4 that Nan Yang accounts for.

What sequence table SEQ ID NO:5-SEQ ID NO:8 showed is the allelic promoter sequence of ZS1, ZS2, ZS3, ZS4 that derives from Zhenshan 97B.

Fig. 1: by RNA polymerase || the promoter structure schematic diagram of the gene of transcribing.Digitized representation is positioned at the position of nucleotide base relative on promotor, and+1 position, representative+1bp place, be transcription initiation site.

Fig. 2: Technology Roadmap of the present invention.

Fig. 3: the collection of illustrative plates that is double base overexpression vector pCAMBIA1301S and binary expression vector DX2181.Picture in picture 3a is double base overexpression vector pCAMBIA1301S structural representation.Fig. 3 b is binary expression vector DX2181 structural representation.

Fig. 4: 8 deletion fragments drive the GUS active level of the transformed plant of gus gene to detect.In figure: the young fringe that the Y representative is bloomed a few days ago; The seed that the G representative is bloomed latter 7 days;-371 promotors corresponding to ZS1 and NYZ1;-692 promotors corresponding to ZS2 and NYZ2;-1220 promotors corresponding to ZS3 and NYZ3;-1808 promotors corresponding to ZS4 and NYZ4.

Fig. 5: promotor brachymemma schematic diagram.ZS1, ZS2, ZS3, ZS4 are the promotor truncated segments that derives from Zhenshan 97B, and NYZ1, NYZ2, NYZ3, NYZ4 derive from the promotor truncated segment that Nan Yang accounts for.

Fig. 6: the detection of functional label primer PB13 in 197 parts of Chinese Mini core collection resources and the association analysis of its seed protein content.The A group represents that there is the disappearance of 6bp in the promoter region of Zhenshan 97B equipotential at functional site, and the B group represents that there is the insertion of 6bp in the promoter region that Nan Yang accounts for equipotential, n Representative Cultivars quantity at functional site.Class1 is mainly rice variety, and type 2 is mainly japonica rice variety.

Fig. 7: the promotor brachymemma is the structure of totally 8 conversion carriers.A figure means the plasmid figure with HindIII and 8 promotors of BanmH I double digestion and cloning vector (pGEM-T Vector); B figure means the plasmid figure with HindIII and 8 promotors of BanmH I double digestion and double base conversion carrier (DX2181); M represents Marker.

Fig. 8: the histochemical stain result of promoters driven gus gene in each tissue of transformed plant.In figure: a is blade, and b is the clever shell in flower and the period of blooming, and c is stem, and d is the tip of a root, e is leaf sheath, and f is the stem square section, and g is stipes, and h is gynoecium and ovary, i is the grouting seed in early stage, the seed of j for being in the milk and shelling mid-term, and k is the seed of grouting middle and later periods, l is the seed shelled in the ripening stage.

Fig. 9: ZS1 and NYZ1 drive the histochemical stain result of gus gene in the transformed plant seed.In figure: a-d is that ZS1 drives the histochemical stain result of gus gene in the transformed plant seed.E-h is that NYZ1 drives the histochemical stain result of gus gene in the transformed plant seed.A and e are the grouting seed in mid-term.The seed that b and f are the ripening stage.C and the g seed for being in the milk after shelling mid-term.D and h are the seed after shelling in the ripening stage.

Embodiment

The acquisition of embodiment 1:8 promoter deletion fragment

The corresponding molecular biology routine operation of the present embodiment method is with reference to " molecular cloning experiment guide (second edition) " (J. Pehanorm Brooker etc., 1996).

Zhenshan 97B and Nan Yang account for the extraction of genomic dna:

Accounting for the Sheng phase of tillering in Zhenshan 97B and Nan Yang gets fresh blade for extracting its genomic DNA, the CTAB method (Murray and Thompson.1980) that concrete method is the Murray report, the DNA extracted is positioned over-20 ℃ of Refrigerator stores after dissolving fully standby.

The qpc1 gene order of having delivered with the combination of the upper extraction of information biology website NCBI (http://www.ncbi.nlm.nih.gov/) Os01g65670 genomic information, from Zhenshan 97B-1808bp to the interval 1871bp that counts altogether of+63bp (transcription initiation site is+1) as the interval of its intercepting (account for from Nan Yang-1814bp to+interval the 1871bp of amounting to of 63bp (transcription initiation site is+1) interval as its intercepting), design altogether 5 combination of primers and be 4 to (PF1+PR, PF2+PR, PF3+PRPF4+PR) primer (in Table 1), and add HindIII restriction enzyme site and three protection bases at 5 ' end of PF series primer, 5 ' the end at the PR primer adds BanmH I restriction enzyme site and three protection bases.The pcr amplification condition is: 94 ℃ of 5min, 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 30sec-2min, 30 circulations, 72 ℃ of 7min.The product of amplification corresponds to ZS1, ZS2, ZS3, ZS4, NYZ1, NYZ2, NYZ3, NYZ4 totally 8 DNA fragmentations (seeing Fig. 7).

The primer sequence of table 1 the present invention design

Getting these 8 PCR fragments detects by 0.8% agarose electrophoresis.Remaining PCR product is for being the TA clone.The T-Vctor system that the test kit used is U.S. Promega company, detailed operation is referring to specification sheets.Connect product places more than 12h in the low temperature water-bath of 16 ℃, then electricity transforms (1800 volts, electric shock 2-3 second) enter bacillus coli DH 5 alpha, 37 ℃ of recovery 40min, the flat board that painting contains penbritin (Amp), isopropyl-β-D-thiogalactoside(IPTG) (IPTG), the chloro-3-indoles β of the bromo-4-of 5--D-galactoside (X-gal), 37 ℃ of overnight incubation, select day shift and carry out enlarged culturing with the LB substratum that contains Amp.Extract the plasmid of the bacterium that shakes, with HindIII and BanmHI double digestion, carry out screening positive clone.Then positive colony is checked order with ABI3730, selected correct sequence, obtained 8 promoter deletion fragments.

The structure of embodiment 2:8 promoter deletion fragment conversion carrier

Corresponding molecular biology routine operation is with reference to Chinese translation: " molecular cloning experiment guide (second edition) " J Pehanorm Brooker etc., Science Press, 1996.

(1) enzyme is cut carrier DX2181.The DX2181 carrier is that the double base overexpression vector pCAMBIA1301S be so kind as to give in Australian CAMBIA laboratory (is shown on Fig. 3 basis a) and is built by State Key Laboratory of Crop Genetic Improvent doctor Ye Rongjian, the information such as the collection of illustrative plates of this carrier and multiple clone site are shown in Fig. 3 b, sentence contrary direction in multiple clone site and build respectively a gus gene and EGFP gene.With HindIII and BanmHI double digestion DX2181, enzyme is cut product and is cut product with UNIQ-10 strain formula DNA glue recovery test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's production) recovery enzyme, the integrity that its enzyme of electrophoresis detection is cut, then be positioned over-20 ℃ of Refrigerator stores.

(2) enzyme is cut ZS1, ZS2, ZS3, ZS4, NYZ1, NYZ2, NYZ3, the NYZ4 TA cloned plasmids of totally 8 deletion fragments.The TA cloned plasmids that is 8 correct deletion fragments with HindIII and the order-checking of BanmHI double digestion process, enzyme is cut product and is separated by 0.8% agarose electrophoresis, then target stripe reclaims test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's production) recovery enzyme with UNIQ-10 strain formula DNA glue and cuts product, the integrity that its enzyme of electrophoresis detection is cut, then be positioned over-20 ℃ of Refrigerator stores.

(3) it is upper that 8 deletion fragments that enzyme cut back to close are building up to carrier DX2181, and electricity is transformed into bacillus coli DH 5 alpha (this bacterial strain is business-like intestinal bacteria).Enzyme cut detect with order-checking after by ZS1, ZS2, ZS3, ZS4, NYZ1, NYZ2, NYZ3, NYZ4 totally 8 deletion fragments respectively with carrier DX2181 on, be ZS1-GUS, ZS2-GUS, ZS3-6US, ZS4-GUS, NYZ1-GUS, NYZ2-GUS, NYZ3-GUS, NYZ4-GUS totally 8 conversion carriers, they are imported to Agrobacterium EHA105 bacterial strain (this bacterial strain is business-like Agrobacterium strain), can be for the engineering strain transformed after formation.

Embodiment 3: agriculture bacillus mediated genetic transformation

Method shown in " agriculture bacillus mediated genetic transformation handbook " that agriculture bacillus mediated genetic transforming method is mainly delivered with reference to State Key Laboratory of Crop Genetic Improvent (woods is supported the army etc., 2002).The acceptor transformed is the embryo callus that the mature seed of rice varieties " in spend 11 " is induced.Through preculture, dip-dye, cultivate altogether, screening obtains having the callus of hygromycin resistance, then through break up, takes root, practice seedling, transplanting obtains transfer-gen plant.The method of the key step of genetic transformation of the present invention, substratum and preparation thereof is with reference to Hua Zhong Agriculture University's granted patent, patent No. ZL201010188458.6, and the method for publication number: CN101880671A report is carried out.

Embodiment 4:PCR method detects the transgenic positive plant

Transformation seedlings is transplanted to land for growing field crops, waits for and within about two weeks, treats that it turns green, and then divides individual plant to get the 2-4cm young leaflet tablet, extracts its genomic dna as template, use PCR method detection positive plant.The Partial Fragment that amplified fragments is reporter gene GUS, the sequence of primer is in Table 1.The PCR product detects through 0.8% agarose gel electrophoresis.Can obtain by this method transgenic positive and negative plant.

The extracting method of a small amount of leaves genomic DNA:

Get long through the young leaflet tablet 2-4cm of PCR method test positive individual plant in right amount, adding 800 μ l1.5 * CTAB grinds, proceed to (1.5 * CTAB formula: 15g CTAB powder+75ml Tris-HCl (1M in the 1.5ml centrifuge tube, PH8.0)+30ml EDTA (0.5M, PH8.0)+NaCl61.4g, be settled to 1000ml with the deionized water of sterilizing); Be placed in immediately 65 ℃ of water-bath 30min, every the 10min jog once; Add 600 μ l chloroform/primary isoamyl alcohol (volume ratio 24: 1) to turn upside down for several times or shaking table shakes (about 20min), till being deep green to lower floor's liquid phase; The centrifugal 10min of 12000rpm under room temperature; Get 500 μ l supernatants in a new 1.5ml centrifuge tube, add 95% ethanol 1ml of precooling, mix postposition-20 ℃, 30min to 2 day; In the centrifugal 10min of 12000rpm, remove supernatant under room temperature, with 300ml75% ethanol, embathe precipitation, be inverted on thieving paper, one night of natural air drying; Add 200-600 μ l ddH ₂O dissolves, standby.

Embodiment 5:GUS histochemical staining method analyzes the expression pattern of 8 promoter deletion fragments in each tissue

The PCR that learnt from else's experience respectively detects the tissues such as the root, stem stalk, blade, leaf sheath, clever shell, ovary, endosperm, embryo of the transformed plant (every kind converting material 10 strains more than) of (method of reference example 4) positive ZS1-GUS, ZS2-GUS, ZS3-GUS, ZS4-GUS, NYZ1-GUS, NYZ2-GUS, NYZ3-GUS, NYZ4-GUS, immerse the approximately GUS dye liquor of 200 μ l, under 37 ℃ of conditions, spend the night, then with the alcohol decolouring of 75% concentration, observe the blueness whether GUS is arranged and occur.The formula of GUS staining fluid is with reference to the method (Jefferson etc., 1987) of the reports such as Jefferson.Result shows: ZS1-GUS, ZS2-GUS, ZS3-GUS, ZS4-GUS, NYZ1-GUS, NYZ2-GUS, these 8 promoter fragments of NYZ3-GUS, NYZ4-GUS have expression (Fig. 8) in each tissue of transgenic positive plant.Reconfirm two promotors that promoter fragment is constitutive expression that account for from Zhenshan 97B and Nan Yang.

Embodiment 6:8 promoter deletion fragment children's fringe and filling stage seed GUS active level detect

The PCR that learnt from else's experience detects the transformed plant of (method of reference example 4) positive ZS1-GUS, ZS2-GUS, ZS3-GUS, ZS4-GUS, NYZ1-GUS, NYZ2-GUS, NYZ3-GUS, NYZ4-GUS, and the T of the plant of process GUS histochemical stain positive (method of reference example 5) ₀For seed, unified sowing.Seed (more than every kind of material 10 strains) in the filling stage while getting respectively after its young fringe (more than 10 strains) and chasmogamy 7 days when chasmogamy a few days ago, extract respectively its total protein, then measures the activity (Fig. 4) of its GUS.Concrete method is with reference to method (Bradford, 1976 of the reports such as Bradford and Jefferson; Jefferson etc., 1987).Result shows: in all promoter fragments, the GUS specific activity correspondence that derives from Zhenshan 97B in the same tissue of contemporaneity derives from the GUS activity that Nan Yang accounts for and will significantly raise, and the result of this and histochemical stain is coincide.With the promotor truncated segment in other same source, compare, the expression activity of total length promotor ZS4 is the strongest, and, along with the maturation of seed, the GUS activity is to present downward trend (Fig. 4, Fig. 9).And in deriving from the promotor truncated segment (NYZ1-GUS, NYZ2-GUS, NYZ3-GUS, NYZ4-GUS) that Nan Yang accounts for, the expression activity of total length promotor NYZ4 is the strongest, and, along with the maturation of seed, the GUS activity is to present downward trend (Fig. 4, Fig. 9).

Embodiment 7: the exploitation of the definite and functional label of constitutive promoter functional area, functional site

By the conversion positive plant GUS histochemical staining method to ZS1-GUS, ZS2-GUS, ZS3-GUS, ZS4-GUS, NYZ1GUS, NYZ2-GUS, NYZ3-GUS, NYZ4-GUS, analyze, find that these 8 promoter deletion fragment expression in each tissue all have expression, two promotors that promoter fragment is constitutive expression that account for from Zhenshan 97B and Nan Yang are described.Young fringe and filling stage seed to these 8 promoter deletion fragment transgenic positive plant carry out GUS active level detection discovery: in all promoter fragments, the GUS specific activity correspondence that derives from Zhenshan 97B in the same tissue of contemporaneity derives from the GUS activity that Nan Yang accounts for and will significantly raise, and the result foot of this and histochemical stain coincide.With the promotor truncated segment in other same source, compare, the gus protein expression activity that total length promotor ZS4 drives gus gene to obtain is the strongest, and the maturation along with seed, the GUS activity is to present downward trend (Fig. 4, Fig. 9), and the active trend of GUS is identical with corresponding Zhenshan 97B in the transgenic positive plant that derives from 4 promotor truncated segments (NYZ1-GUS, NYZ2-GUS, NYZ3-GUS, NYZ4-GUS) that Nan Yang accounts for.The transgenic positive plant of ZS1-GUS and NYZ1-GUS GUS in the seed of the young fringe of blooming early stage, the seed of filling stage and maturation has expression, and the GUS activity that the fragment GUS activity that derives from Zhenshan 97B accounts for than corresponding Nan Yang high (Fig. 4, Fig. 9), this illustrates that the zone (from-371bp to transcription initiation site) at ZS1 and NYZ1 place is the functional area of this promotor again.In this functional area, by discovery that two rice varieties are relatively checked order: Zhenshan 97B accounts for and compares with Nan Yang, has the mutational site of a single nucleotide polymorphism (SNP) and the insertion/deletion mutational site (Fig. 5) of a 6bp disappearance.Transform GUS histochemical stain and active the analysis showed that of " in spend 11 " by ZS1-GUS and NYZ1-GUS, the sudden change in these two sites causes the reason place of GUS activity difference just, be the functional site of promotor, and the mutational site that probably this 6bp inserts or lacks badly influences the expression of GUS, the NYZ1-GUS accounted for than corresponding Nan Yang as the fragment ZS1-GUS activity that derives from Zhenshan 97B activity is high (Fig. 4, Fig. 9).

For the functional site of this functional area, designed a special primer pair PB13 (in Table the PB13F in 1 and the primer shown in PB13R), detect that 6bp inserts or the mutational site of disappearance.Wherein this pair of primer is functional molecular marker.Utilize the PCR product of this primer pair amplification to adopt 4% polyacrylamide gel electrophoresis (PAGE) detection.

(1) system and the step of PCR reaction:

1) add masterplate: the every hole of PCR plate adds 2 μ l sample DNA liquid and does masterplate, and every hole adds 10 μ l sterilized waters.

2) join mixture:10 * Buffer2.0 μ l+dH ₂O2.0 μ l+dNTP (2mM) 1.6 μ l+MgCl ₂(25mM) 1.4 μ l+ primer (primer PB13) (50ng. μ l ^-1) 0.8 μ l+r.Taq enzyme (5U/ μ l), 0.2 μ l=8.0 μ l;

3) packing: mixture is sub-packed in to the PCR plate, every hole 8 μ l;

4) every hole adds mineral oil 20 μ l, by the centrifugal 15s of PCR plate 1000rpm;

5) pcr amplification: 94 ℃ of 4min, 94 ℃ of 30sec, 53-55 ℃ of 30sec, 72 ℃ of 0.5-1.5min, 30-34cycles, 72 ℃ of 5min; Add 5 μ l10 * Loading Buffer (211.2g NaOH+263mg tetrabromophenol sulfonphthalein+263mg dimethylbenzene green grass or young crops+25ml ddH ₂The O+500ml methane amide, shake a night).

(2) preparation of 4%PAGE glue and electrophoresis:

1) after big or small plank wash clean with 95% alcohol and filter paper wipe 3-5 smooth all over the system light till;

2) little plank is wiped and is put down only evenly by 1 after adding anti-silication agent (the anti-silication agent of 1ml95% ethanol+Binding 1-2 μ l);

3) large plank add silication agent 1ml by the even 2-3 of 1 wiping all over to light clean evenly till;

4) the equal glue of the falling PAGE 65ml left and right Mixture altogether after air-dry 20 minutes of big or small plank, slowly pour into and prevent bubble formation, and 2-4 hour available;

5) preparation of 4% polyacrylamide gel: 36g urea+22ml dd H ₂O+15ml5 * TBE+11ml mother liquor (380gAcrylamide+20gBis-acrylamide+ddH ₂O to 1L) (rear preservation is filtered in aforementioned mixing afterwards)+with the TEMED that front adds 300-600 μ l10%AP+1/10AP volume.

6) PCR product sex change: the boiling water boiling 10 ' cooling point sample again of rear frozen water 3-4 μ l left and right (clean broken glue is dug in the point sample hole);

7) electrophoresis: 80W (determining power) runs the about 2-4h of glue, depending on PCR product size and polymorphism size;

8) develop (rapid silver staining): after lower plank, put into ddH ₂Wash 1-2min in O; Put into again AgNO ₃(1.5L ddH ₂O+2gAgNO ₃) the 10min left and right; At ddH ₂Cross in 1-2min and put into developing solution (20g.L in O ^-1NaOH+0.4g.L ^-1NaCO ₃+ 4ml.L ^-1Formaldehyde+1L ddH ₂O) extremely obviously band appearance in; To drying in the air after wash clean in clear water, get final product.

Embodiment 8: functional label detects and application in the Mini core collection varieties of resources

Utilize PB13 this to functional label primer (seeing embodiment 7), the rice varieties in 197 parts of Chinese Mini core collection resources is detected, then measure the protein content (in Table 2) of brown rice in their seed, and carry out statistical study.

(1) the PCR reaction system of functional label primer PB13 is shown in embodiment 7, reaction conditions: 94 ℃ of 4min, 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 0.5min, 30-34 circulation, 72 ℃ of 5min.Then the PCR product is carried out to electrophoresis detection with 4%PAGE glue.That detects the results are shown in Table 2.

The mensuration of the protein content of brown rice in (2) 197 parts of Chinese Mini core collection resource seeds (method referring to document (Perbandt etc., 2010, BioEnerg.Res.3:194-203).Concrete steps are as follows:

1) dry (3-4 days) after the ripe results of rice paddy seed, then seed is carried out to the threshing processing.

2) seed utilizes paddy to go out shelling on rough machine and obtains brown rice after 3 months in room temperature preservation.

3) put near infrared quick analytic instrument fixing after brown rice being filled to the static state circle cup of near infrared quick analytic instrument (Foss XDS Rapid Content Analyzer).

4) open main frame after two minutes, double-click the calibration equation file that ISIscan software-selection Products-selection is set up-click Scan, to a numbering of sample input, wait for two minutes and obtain detected result.

5) detect next sample and directly click Scan, get final product to a numbering of sample input.

6) at most once be merely able to detect 600 samples, at this moment the result data recorded will be derived.

7) testing data derives: double-click the calibration equation file that ISIscan software-selection Products-selection is set up-click History-and choose testing data-right-click mouse-selection Select Samples, then open the SelectSample on window right side, click File-Export-and select Export Data, save as the file of .PDF or .XLS or other form.

The unit of the test-results 8) obtained is mg.g ^-1.

That detects the results are shown in Table 2.

The group structure of the rice varieties in (3) 197 parts of Chinese Mini core collection resources is with reference to former bibliographical information (Wang etal., 2011; Wen et al., 2009).Subgroup 1 is mainly rice variety, and subgroup 2 is mainly japonica rice variety.Its genotype (6bp (-) has the disappearance of 6bp for the allelotype of Zhenshan 97B, and the allelotype that 6bp (+) accounts for for Nan Yang has the insertion of 6bp) and phenotype (seed protein content) are carried out to association analysis.Result shows: in rice variety, have protein content in the seed of 6bp (-) kind and will be significantly higher than kind (P=1.8 * 10 with 6bp (+) ^-6); But, in japonica rice variety, have between the protein content of the kind of protein content and 6bp (+) in the seed of 6bp (-) kind and there is no obvious difference (P=0.924) (Fig. 6).Therefore functional label primer pair PB13 (in 1) can be directly used in the prediction of seed protein content in rice variety, thereby finds fast the rice varieties that protein content is higher in rice variety, and then accelerates the process of rice quality breeding.

Table 2 molecule marker PB13 of the present invention is to 197 parts of Chinese micro core seed resources and protein content determination thereof

The explanation of table 2:

A: subgroup 1 and subgroup 2 are according to former bibliographical information: Wang et al. (2011) and Wen et al. (2009).

B: according to primer PB13, evaluation obtains genotype, and wherein " 6bp (-) " and " 6bp (+) " represents respectively

Deletion and insertion at promoter region (arrive-6bp of 12bp).

Reference

1. woods is supported the army etc., the foundation of the agriculture bacillus mediated No. 8 high-efficient transgenic systems in Mudanjiang. Acta Agronomica Sinica, 2002,28:294-300

2.Bezhani?S，Sherameti?I，Pfannschmidt?T.A?repressor?with?similarities?to?prokaryotic?andukaryotic?DNA?helicases?controls?the?assembly?of?the?CAAT?box?binding?complex?at?aphotosynthesis?gene?promoter.J?Biolchem，2001，276：23785

3.Bradford?M.A?rapid?and?sensitive?method?for?the?quantitation?of?microgram?quantities?ofprotein?utilizing?the?principle?ofprotein-dye?binding.Anal?Biochem，1976，72：248-254

4.Ehsani?P，Meunier?A，Nato?F，Jafari?A，Nato?A，Lafaye?P.Expression?of?anti?human?IL-4andIL-6scFvs?in?transgenic?tobacco?plants.Plant?Mol?Biol，2003，52：17-29

5.Jefferson?R，Kavanagh?T，Bevan?M.GUS?fusions：beta-glucuronidase?as?a?sensitive?andversatile?gene?fusion?marker?in?higher?plants.EMBO?J，1987，6：3901

6.Juven-Gershon?T，Hsu?J，Theisen?J，Kadonaga?J.The?RNA?polymerase?II?core?promoter-thegateway?to?transcription.Curr?Cell?Biol，2008，20：253-259

7.Kumpatla?S，Chandrasekharan?M，Iyer?L，Guofu?L，Hall?T.Genome?intruder?scanning?andmodulation?systems?and?transgene?silencing.Trends?Plant?Sci，1998，3：97-104

8.Miyao?M，Fukayama?H.Metabolic?consequences?of?overproduction?of?phosphoenolpyruvatecarboxylase?in?C3plants*1.Arch?Biochem?Biophys，2003，414：197-203

9.Murray?M，Thompson?W.Rapid?isolation?of?high?molecular?weigh?plant?DNA.Nucleic?AcidsRes，1980，8：4321-4325

10.Perbandt?D，Reulein?J，Richter?F，Reinhold?S，Wachendorf?M.Assessment?of?mass?flows?andfuel?quality?during?mechanical?dehydration?of?silages?using?near?infrared?reflectancespectroscopy.BioEnerg?Res，2010，3：194-203

11.Shiyou?L，Gu?H，Yuan?X，Wang?X，Wu?A，Qu?L，LiuJ?The?GUS?reporter-aided?analysis?of?thepromoter?activities?of?a?rice?metallothionein?gene?reveals?different?regulatory?regionsresponsible?for?tissue-specific?and?inducible?expression?in?transgenic?Arabidopsis.TransgenicRes，2007，16：177-191

12.Terzaghi?W，Cashmore?A.Light-regulated?transcription.Annu?Rev?Plant?Biol，1995，46：445-474

13.Wang?C，Chen?S，Yu?S.Functional?markers?developed?from?multiple?loci?in?GS3for?finemarker-assisted?selection?of?grain?length?in?rice.Theor?Appl?Genet，2011，122：905-913

14.Wen?W，Mei?H，Feng?F，Yu?S，Huang?Z，Wu?J，Chen?L，Xu?X，Luo?L.Population?structureand?association?mapping?on?chromosome7using?a?diverse?panel?of?Chinese?germplasm?ofrice(Oryza?sativa?L).Theor?Appl?Genet，2009，119：459-470

15.Zhu?Q，DabiT，Lamb?C.TATA?box?and?initiator?functions?in?the?accurate?transcription?of?aplant?minimal?promoter?in?vitro.Plant?Cell，1995，7：1681

Claims (7)

1. the promotor ZS1 of a paddy rice constitutive expression, its nucleotide sequence is as shown in sequence table SEQ ID NO:1.

2. the promotor ZS2 of a paddy rice constitutive expression, its nucleotide sequence is as shown in sequence table SEQ ID NO:2.

3. the promotor NYZ3 of a paddy rice constitutive expression, its nucleotide sequence is as shown in sequence table SEQ ID NO:7.

4. the promotor NYZ4 of a paddy rice constitutive expression, its nucleotide sequence is as shown in sequence table SEQ ID NO:8.

5. be applicable to the molecule marker PB13 of paddy rice, it is characterized in that the DNA sequence dna of this molecule marker is as follows:

PB13F：ACAGGTCAGGTGCAAAAGCT；

PB13R：AACGCGAACTGGAAACAGAG。

6. the application of the described promotor of claim 1-4 any one in the genetic improvement of paddy rice.

7. the application of molecule marker claimed in claim 5 in the prediction of long-grained nonglutinous rice seed protein content.

Images