CN103255151A - Coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and application of coded sequence - Google Patents

Abstract

The invention discloses a coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and an application of the coded sequence. The coded sequence is shown in SEQ ID NO.1 and used for the CVN mutant. The CVN mutant with high expression quantity and high activity is prepared by the following steps of: cloning a coded nucleotide sequence onto an expression vector to obtain a recombinant vector; and converting the recombinant vector into a host cell for expression and purification. The soluble expression of CVN in escherichia coli is remarkably promoted by the coded sequence, and the soluble expression quantity of the CVN mutant in the escherichia coli is remarkably higher than that of wild CVN. In addition, the extracorporal anti-influenza virus activity of the CVN mutant obtained by using the coded sequence is better than that of the wild CVN, which proves that not only can the expression quantity of the CVN be increased, but also the soluble expression of the CVN can be remarkably promoted, and the CVN with better biological activity can be obtained after the coded nucleotide sequence of the protein is rationally designed and optimized by using a translation suspension theory.

Description

Expression amount is high and encoding sequence and the application thereof of the CVN mutant that activity is strong

Technical field

The invention belongs to biomedicine field, be specifically related to encoding sequence and the application thereof of the strong CVN mutant of a kind of expression amount height and activity.

Background technology

Blue algae antiviral protein N(cyanovirin-N, CVN) be a kind of antiviral protein that Boyd etc. found in 1997 in blue-green algae, energy is special, be combined in conjunction with the mannooligo saccharide on virus surface capsid protein gp120 in high affinity ground, the receptors bind that stops virus and host cell surface, and the propagation of prevention virus between cells infected and normal cell, these characteristics make it can not be subjected to the interference of virus variation, are difficult for causing resistance.(0.1～36.8nM) can effectively suppress HIV infection immunity cell to CVN albumen lower concentration, and (45～400nM) do not have direct toxic side effect to normal cell to high density.

Except HIV, the influenza virus of CVN, simplexvirus and parainfluenza virus etc. have antagonistic action, are a kind ofly to act on wide spectrum, efficiently, very the antiviral drug candidate of using value is arranged, and receive much concern.But the mass preparation of CVN is to limit the bottleneck technology of its application always.Report CVN is with the inclusion body formal representation in intestinal bacteria at present, be subjected to multiple effects limit (Mori such as expression amount is low, product heterogeneity, mistake modification, T., Gustafson, K.R., Recombinant Production of Cyanovirin-N, a Potent Human Immunodeficiency Virus-Inactivating Protein Derived from a Cultured Cyanobacterium.Protein Expression and Purification, 1998,151-158); Also the someone attempts expressing CVN in transgenic plant, but does not set up enforceable purifying process (Sexton, A., Drake, P.M., Mahmood, Transgenic plant production of Cyanovirin-N, an HIV microbicide.2006, Vol.20pp.356-358).

Tradition biochemical theoretical " An Fensen principle " is thought, Protein Folding information is by its aminoacid sequence unique decision (Taniuchi H. under certain environment, D.R.Davies, and C.B.Anfinsen, A comparison of the x-ray diffraction patterns of crystals of reconstituted nuclease-T and of native staphylococcal nuclease.J Biol Chem, 1972.247 (10): p.3362-4).But the inventor's research points out that this traditional theory is wrong.Though different DNA can translate into same amino acid, proteinogenous speed (translation speed) is also non-constant, can be slower at some section, this phenomenon is called translation and suspends (translational pausing or translational attenuation) translation time-out site and protein folding height correlation, if it is incorrect that translation suspends the site, this is slow local fast, perhaps this is fast local slow, all will cause the protein false folding to be assembled, can't obtain the soluble proteins of function.That is to say that protein conformation is not only determined by amino acid whose sequence, also determined by nucleotide sequence.（Zhang?G.,M.Hubalewska,and?Z.Ignatova,Transient?ribosomal?attenuation?coordinates?protein?synthesis?and?co-translational?folding.Nat?Struct?Mol?Biol,2009.16(3):p.274-80.；Zhang?G.and?Z.Ignatova,Folding?at?the?birth?of?the?nascent?chain:coordinating?translation?with?co-translational?folding.Curr?Opin?Struct?Biol,2011.21(1):p.25-31.）。This theory is applicable to most protein (Zhang in the protein groups, G.and Z.Ignatova, Generic algorithm to predict the speed of translational elongation:implications for protein biogenesis.PLoS One, 2009.4 (4): p.e5036.; Fedyunin, I., et al., tRNA concentration fine tunes protein solubility.FEBS Lett, 2012.586 (19): p.3336-40.).

Summary of the invention

The shortcoming that primary and foremost purpose of the present invention is to overcome prior art provides the encoding sequence of the strong CVN mutant of a kind of expression amount height and activity with not enough.

Another object of the present invention is to provide the CVN that obtains by above-mentioned encoding sequence mutant.

A further object of the present invention is to provide the application of the strong CVN mutant of described expression amount height and activity.

Purpose of the present invention is achieved through the following technical solutions: the encoding sequence of the CVN mutant that a kind of expression amount height and activity are strong, as follows:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATAGACGGTACACTAAAATACGAA。

High and the active strong CVN mutant of a kind of expression amount is prepared by above-mentioned encoding sequence;

High and the active strong CVN mutant of described expression amount prepares: above-mentioned encoding sequence is cloned on the expression vector, obtains recombinant vectors by the following method; Recombinant vectors is transformed in the host cell expresses, purifying obtains the high and active strong CVN mutant of expression amount;

Described expression vector is preferably pET-28b;

Described host cell is preferably intestinal bacteria (Escherichia coli) BL21(DE3);

Described expression amount is high and the application of the encoding sequence of the CVN mutant that activity is strong in preparation CVN mutant, comprises following steps:

(1) the following primer of design:

F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’；

R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’；

F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；

R1-mutant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’；

(2) pcr amplification for the first time: being template with the pET-3c-SUMO-CVN plasmid, is that primer carries out pcr amplification with F-sumo/R-CVN, uses NdeI and SalI double digestion behind the PCR product purification that obtains; With the carrier pET-28b of the PCR product behind the double digestion with process NdeI and SalI double digestion, connect; Connect product transformed into escherichia coli (Escherichia coli) DH5 α competent cell, screening obtains recombinant vectors pET-28b-CVN;

(3) pcr amplification for the second time: be the pcr amplification template with pET-28b-CVN,

F1-mutant/R1-mutant is that primer carries out pcr amplification, the PCR product purification that obtains is cut through the DpnI enzyme, the enzyme of cycle pure Kit test kit purifying is cut the direct transformed into escherichia coli DH5 of product α competent cell, and screening obtains recombinant vectors pET-28b-CVN-M1;

(4) abduction delivering: change recombinant vectors pET-28b-CVN-M1 over to e. coli bl21 (DE3), obtain expression strain; Then use the LB substratum that contains kantlex that this expression strain is cultivated under 37 ℃, the condition of 180～200rpm, at OD ₆₀₀=0.8 o'clock, add IPTG, the final concentration of IPTG is 1mM, behind 37 ℃ of abduction delivering 4h, collects thalline;

(5) purifying: with bacterial sediment by volume the 1:10 ratio after being suspended in the NTA-10 damping fluid again thalline is carried out fragmentation, centrifugal, collect supernatant; In the sample Ni-NTA affinity column, at first use the NTA-10 damping fluid to wash back baseline on the supernatant, wash foreign protein with the NTA-40 damping fluid again, use the NTA-200 buffer solution elution at last, obtain target protein CVN mutant; Wherein, the NTA-10 damping fluid consist of 20mmol/LTris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles, the NTA-40 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles, the NTA-200 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles;

PCR condition optimization described in the step (2) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min;

PCR condition optimization described in the step (3) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min;

The final concentration of kantlex in the LB substratum described in the step (4) is preferably 50mg/L;

Centrifugal condition optimization described in the step (5) is 4 ℃, 25000g, 30min;

High and the active strong CVN mutant of described expression amount prevents and/or treats application in the antiviral in preparation;

Described virus refers to influenza virus or virus of AIDS.

Novelty of the present invention is according to the relation between protein domain and the translation time-out, utilize translation to suspend theoretical nucleotide sequence to CVN and carry out reasonably optimizing and design, in the structural domain of CVN, introduce translation and suspend the site, made up the mutant of CVN, promote the solubility expression of CVN in intestinal bacteria, finally be purified into recombined blue algae antiviral protein; And experimental results show that by resisiting influenza virus prepared recombinant protein has good antiviral activity.

The present invention has following advantage and effect with respect to prior art:

(1) nucleotide sequence of coding CVN mutant provided by the invention has improved the expression level of CVN in intestinal bacteria; Particularly promote the solubility expression of CVN in intestinal bacteria, CVN mutant amount of solubility expression in intestinal bacteria is significantly higher than CVN.

(2) the external anti-influenza virus activity of CVN mutant provided by the invention is better than CVN.Illustrate by translation and suspend theory to protein core nucleotide sequence design and rational and optimization that not only can improve the expression amount of CVN, what is more important significantly promotes the CVN solubility expression, obtains the better CVN albumen of biological activity.

Description of drawings

Fig. 1 is that the CVN-M1 translation suspends graphic representation; The 1st, blue line, the 2nd, red line.

Fig. 2 is the solubility expression analysis chart of CVN and mutant thereof; Wherein, figure (a) namely is CVN target protein band shown in the arrow for SDS-PAGE figure; Figure (b) is Western blot figure, only detects CVN; Swimming lane M is albumen Marker, and unit is KDa; Swimming lane 1 is the CVN-BL21 of abduction delivering not; Swimming lane 2 is CVN-BL21 of abduction delivering; Swimming lane 3 is CVN-M1-BL21 of abduction delivering.

Fig. 3 is the SDS-PAGE figure behind CVN and the mutant protein purifying thereof, and swimming lane M is albumen Marker, and unit is KDa, namely is CVN target protein band shown in the arrow.

Fig. 4 is the active figure as a result of the anti-human influenza virus A/HK/8/68 of CVN and mutant thereof (H3N2), and ordinate zou is for suppressing the per-cent of virus, and the more high explanation of histogram is more good to viral inhibition.

Embodiment

The present invention is described in further detail below in conjunction with embodiment and accompanying drawing, but embodiments of the present invention are not limited thereto.

The main raw that the embodiment of the invention relates to is as follows: host bacterium e. coli bl21 (DE3) (Merck), plasmid pET-28b(Merck), this laboratory of pET3c-SUMO-CVN(makes up, be that ZL200810198926.0, name are called " preparation method of recombined blue algae antiviral protein and application " open detailed preparation process in the patent No., the simplest method is directly to synthesize the SUMO-CVN fusion sequence by order-checking company at present, is connected into the pET3c carrier and can obtains pET3c-SUMO-CVN); Pfu mix enzyme, restriction enzyme Nde I, SalI, DpnI, dye albumen Marker available from Fermentas company in advance, primer is synthetic by the big Gene Tech. Company Limited of China; Ni Sepharose ^TM6Fast Flow is available from GE company, and tetramethyl-azo azoles salt (MTT) is available from U.S. SIGMA company.Other reagent is analytical reagent.NTA-10 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles), NTA-40 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles), NTA-200 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles).

Codon optimized and the expression vector establishment of embodiment 1CVN

It is theoretical to utilize translation to suspend, and the nucleotide sequence of coding CVN albumen is optimized, and the appropriate design translation suspends the site, utilizes the sudden change round pcr that the nucleotide sequence of CVN is carried out same sense mutation.

The coding nucleotide sequence of CVN albumen is as follows:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTGGACGACCACATCGCTAACATAGACGGTACACTAAAATACGAA。

(1) by translating the nucleotide sequence that suspends Design Theory coding CVN mutant, under the situation that does not change the CVN aminoacid sequence, with the codon (ATC faster of translation speed in last 20 codons of CVN, ACC, CTG) replace to the slower codon (ATA of translation speed, ACA, CTA), (the RiboTempo computed in software is determined to make translation time-out site, http://bioinformatics.jnu.edu.cn/software/ribotempo), the translation that mutant obtains through the RiboTempo computed in software suspends curve respectively as shown in Figure 1, translation suspends the curve red line and has formed translation time-out site (red line is lower than blue line) in predetermined zone (last 20 codons), meets the requirements.The nucleotide sequence of the coding CVN mutant that design obtains is as follows:

Mutant 1(CVN-M1) coding nucleotide sequence:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATAGACGGTACACTAAAATACGAA。

Be directed to mutant 1(CVN-M1) coding nucleotide sequence, the sudden change PCR primer of design is as follows:

F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；

R1- _mut _ant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’。

(2) expression plasmid of structure pET-28b-CVN

Be the pcr amplification template with the pET-3c-SUMO-CVN plasmid, F-sumo/R-CVN is that primer carries out pcr amplification, and amplification system is: each 2 μ L of primer (10 μ mol/L), pfu mix25 μ L, template 1 μ L, sterilization ultrapure water 20 μ L; Amplification condition is: 94 ℃ of pre-sex change 3min of reaction mixture; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min.

F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’

R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’。

Use DNA purification kit (OMEGA) to reclaim the PCR product that obtains, the PCR product and the plasmid pET-28b that obtain behind the purifying use NdeI and SalI double digestion (10 * Fastdigest buffer respectively, 37 ℃ of water-bath 30min), enzyme is cut product and is carried out mass volume ratio 1% agarose gel electrophoresis, reclaim enzyme and cut product, with T4DNA ligase enzyme (by specification proposed standard system preparation reaction system), 16 ℃ of connections are spent the night, these two enzymes are cut product couple together, be built into recombinant plasmid pET-28b-CVN.Recombinant plasmid transformed bacillus coli DH 5 alpha competent cell (Merck), coat the LB flat board that contains 50 μ g/mL kantlex, 37 ℃ of overnight incubation, the positive colony that screening is obtained send the order-checking of the big Gene science limited-liability company of China, obtains meeting the CVN clone pET-28b-CVN of desired design.

(3) structure of the recombinant vectors of expression CVN mutant

The acquisition of goal gene: be the pcr amplification template with pET-28b-CVN, F1-mutant/R1-mutant is that primer carries out pcr amplification, and amplification system is: each 2 μ L of primer, pfu mix25 μ L, template 1 μ L, sterilization ultrapure water 19 μ L; Amplification condition is: 94 ℃ of pre-sex change 3min of reaction mixture; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min.

Use DNA purification kit (OMEGA) to reclaim the PCR product that obtains, the PCR product that obtains behind the purifying is cut through the DpnI enzyme, the enzyme of cycle pure Kit test kit (OMEGA) purifying is cut the direct transformed into escherichia coli DH5 of product α competent cell (Merck), coating contains the LB flat board of 50 μ g/mL kantlex, the positive colony that screening is obtained send the order-checking of the big Gene science limited-liability company of China, obtain meeting the clone who contains coding CVN mutant 1 nucleotide sequence of desired design, be pET-28b-CVN-M1.

Embodiment 2

(1) preparation of expression strain:

1. the preparation of e. coli bl21 (DE3) competent cell: preparation process sees " molecular cloning experiment guide " third edition for details; [U.S.] J. Sha nurse Brooker work, Huang Peitang translates.

2. expression vector pET-28b-CVN and pET-28b-CVN-M1 are converted into e. coli bl21 (DE3) competent cell respectively: conversion process sees " molecular cloning experiment guide " third edition for details; [U.S.] J. Sha nurse Brooker work, Huang Peitang translates.

(2) CVN and mutation induction thereof are expressed and soluble analysis

1. the expression strain CVN-BL21 that step (1) is obtained and CVN-M1-BL21 are inoculated into 20mL respectively and contain in the LB substratum of 50 μ g/mL kantlex content, and 37 ℃, 180rpm are cultivated, and work as OD ₆₀₀=0.8 o'clock, add IPTG, final concentration is 1mM, behind 37 ℃ of abduction delivering 4h, measures OD respectively ₆₀₀, guarantee the volume * OD when CVN and mutant thereof are received bacterium ₆₀₀Value be identical, the centrifugal 10min of 5000g, 4 ℃ collect thalline.Thalline 20mmol/L Tris-HCl(pH8.0,0.15mol/L NaCl) damping fluid is resuspended, high pressure (1000bar) homogeneous smudge cells, 18000g, 4 ℃ of centrifugal 30min, last cleer and peaceful precipitation does not keep sample and treats that follow-up SDS-PAGE electrophoresis (5% concentrates glue, 12% separation gel) and Western blot analyze.

BCA test kit (green the skies Bioisystech Co., Ltd) is measured total protein content in CVN and the centrifugal supernatant of mutant bacterial cell disruption thereof, guarantees that the albumen applied sample amount is identical, and western blot(experimental procedure is seen " fine works molecular biology experiment guide " the 5th edition; (U.S.) Ao Sibai chief editor, Jin Youxin translates) analyze the content of CVN albumen in the supernatant.The result shows (Fig. 2), and the amount of CVN mutant solubility expression is significantly higher than CVN.

(3) CVN and mutant shake flask fermentation and purifying

Expression strain CVN-BL21, the CVN-M1-BL21 that step (1) is obtained is inoculated into 1L respectively, kantlex content is in the LB substratum of 50 μ g/mL, carries out shake flask fermentation and induces by aforesaid expression condition.4 ℃, the centrifugal collection thalline of 6000 * g, 10min, then with bacterial sediment by volume the 1:10 ratio be suspended in the NTA-10 damping fluid again, high pressure (1000bar) homogeneous smudge cells.4 ℃, the centrifugal collection supernatant of 25000 * g, 30min.

Sample to column volume is in the Ni-NTA affinity column of 20mL on the supernatant, flow velocity 0.6mL/min, and the NTA-10 damping fluid is washed back baseline, and flow velocity is 1mL/min, and the NTA-40 damping fluid is washed foreign protein, NTA-200 buffer solution elution target protein; CVN albumen behind the purifying concentrates the purity of the CVN albumen of SDS-PAGE electrophoresis purification Identification through the ultrafiltration pipe that Sephadex G-25 molecular sieve takes off imidazoles and 3KDa.

According to the relation between CVN protein domain and the translation time-out, introduce the CVN mutant that translation suspends in the CVN structural domain, under 37 ℃ of conditions, can detect CVN mutant protein (Fig. 2 b) from bacterial cell disruption with Western blot the centrifugal supernatant after the abduction delivering.Because the amount of solubility expression is extremely low, the amount of purified acquisition CVN albumen is extremely low, to such an extent as to can not detect with coomassie brilliant blue staining without the native sequences CVN that optimizes; Though there is not aminoacid sequence to change, can be purified into a large amount of CVN albumen (Fig. 3) and optimize CVN mutant later (being designated among Fig. 3 CVN-M1).This explanation suspends the translation speed that the site reduces CVN by rationally introduce translation in the CVN structural domain, promotes that the solubility expression of CVN is practicable.

Embodiment 3

CVN resisiting influenza virus A/HK/8/68 (H3N2) activity research

Dog renal epithelial cell mdck cell (U.S. ATCC) is after the pancreatin solution digestion of mass volume ratio 0.25%, with 2.5 * 10 ⁵Cells/well adds (MEM substratum in the 96 porocyte culture plates, the calf serum that contains volume percent 10%), treat to abandon growth media after cell grows up to individual layer, with keeping liquid (MEM substratum, do not contain calf serum) (preserve in the laboratory with medicine CVN albumen respectively, can be CN101638435 by publication number, name is called " a kind of blue-green algal virus protein N mutant; its modified derivative and application " disclosed step and is prepared) and the CVN mutant protein that obtains of embodiment 2 purifying be diluted to 6 series concentration (100,50,25,12.5,6.25,3.125 μ M), each extent of dilution is established 3 multiple holes, establish the normal cell control group simultaneously, positive drug (ribavirin) control group, 37 ℃, 5%CO ₂Cultivate 48h in the incubator, every day observation of cell variation, mtt assay is surveyed each porocyte OD value, calculating median toxic concentration TC50.

In the non-toxic concn scope (TC50〉50 μ M) drug dilution is become different concns, each the 50 μ L of thing diluent that get it filled, human influenza strain A/HK/8/68 (H3N2) (ATCC company, Influenza A virus (H3N2), ATCC

VR-1679 ^TM)) viral dilution liquid (100TCID50) 50 μ L directly be added on the individual layer mdck cell after mixing, the positive drug group is established, virus control group, negative control group in 3 multiple holes of each concentration.Place 37 ℃, 5%CO ₂, behind the cultivation 48h, adding 10 μ L concentration is the MTT solution of 5mg/mL, continues to cultivate 4h, and careful the suction abandoned supernatant liquor, and every hole adds 100 μ L DMSO lucifuge shaking tables placement 15min, and microplate reader (Bio-Rad550) reads the OD value, measures wavelength 490nm, reference wavelength 630nm.

Calculate the inhibiting rate %=(OD medicine group-OD virus control group under each drug level)/(OD cell control group-OD virus control group).

The active result of CVN and mutant resisiting influenza virus H3N2 thereof (Fig. 4) shows: CVN and mutant thereof have significant inhibitory effect to human influenza strain A/HK/8/68 (H3N2), and the CVN mutant is better than CVN to the restraining effect of human influenza strain A/HK/8/68 (H3N2), the relation that this explanation utilizes protein domain and translation to suspend, rationally introducing translation in protein domain suspends, and utilization translation time-out theory redesigns the CVN nucleotide sequence and optimizes, not only can promote the solubility expression of CVN, and can obtain active better CVN albumen.

In sum, the CVN mutant that the present invention makes up express successfully in e. coli bl21 (DE3), and the amount of solubility expression is significantly higher than CVN; Overcome CVN and easily formed shortcomings such as inclusion body, purification difficult.The active result of the anti-human influenza strain of CVN and mutant thereof A/HK/8/68 (H3N2) shows: the activity of CVN mutant is better than CVN.

Above-described embodiment is preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.

Claims (8)

1. the encoding sequence of the high and active strong CVN mutant of an expression amount is characterized in that: shown in SEQ ID NO.1.

2. the high and active strong CVN mutant of expression amount is characterized in that: prepared by the described encoding sequence of claim 1.

3. the high and active strong CVN mutant of expression amount according to claim 2 is characterized in that preparing by the following method: the described encoding sequence of claim 1 is cloned on the expression vector, obtains recombinant vectors; Recombinant vectors is transformed in the host cell expresses, purifying obtains the high and active strong CVN mutant of expression amount.

4. the high and active strong CVN mutant of expression amount according to claim 3, it is characterized in that: described expression vector is pET-28b; Described host cell is intestinal bacteria (Escherichia coli) BL21(DE3).

5. the application of encoding sequence in preparation CVN mutant of the CVN mutant that the described expression amount height of claim 1 and activity are strong is characterized in that comprising following steps:

(1) the following primer of design:

F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’；

R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’；

F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；

R1-mutant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’；

(2) pcr amplification for the first time: being template with the pET-3c-SUMO-CVN plasmid, is that primer carries out pcr amplification with F-sumo/R-CVN, uses NdeI and SalI double digestion behind the PCR product purification that obtains; With the carrier pET-28b of the PCR product behind the double digestion with process NdeI and SalI double digestion, connect; Connect product transformed into escherichia coli (Escherichia coli) DH5 α competent cell, screening obtains recombinant vectors pET-28b-CVN;

(3) pcr amplification for the second time: be the pcr amplification template with pET-28b-CVN, F1-mutant/R1-mutant is that primer carries out pcr amplification, the PCR product purification that obtains is cut through the DpnI enzyme, the enzyme of cycle pure Kit test kit purifying is cut the direct transformed into escherichia coli DH5 of product α competent cell, screening obtains recombinant vectors pET-28b-CVN-M1;

(4) abduction delivering: change recombinant vectors pET-28b-CVN-M1 over to e. coli bl21 (DE3), obtain expression strain; Then use the LB substratum that contains kantlex that this expression strain is cultivated under 37 ℃, the condition of 180～200rpm, when OD600=0.8, add IPTG, the final concentration of IPTG is 1mM, behind 37 ℃ of abduction delivering 4h, collects thalline;

(5) purifying: with bacterial sediment by volume the 1:10 ratio after being suspended in the NTA-10 damping fluid again thalline is carried out fragmentation, centrifugal, collect supernatant; In the sample Ni-NTA affinity column, at first use the NTA-10 damping fluid to wash back baseline on the supernatant, wash foreign protein with the NTA-40 damping fluid again, use the NTA-200 buffer solution elution at last, obtain target protein CVN mutant; Wherein, the NTA-10 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles, the NTA-40 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles, the NTA-200 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles.

6. the application of the encoding sequence of the CVN mutant that expression amount height according to claim 5 and activity are strong in preparation CVN mutant, it is characterized in that: the PCR condition described in the step (2) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min;

PCR condition described in the step (3) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min;

The final concentration of the kantlex described in the step (4) is 50mg/L;

Centrifugal condition described in the step (5) is 4 ℃, 25000g, 30min.

7. the high and active strong CVN mutant of the described expression amount of claim 2 prevents and/or treats application in the antiviral in preparation.

8. the high and active strong CVN mutant of expression amount according to claim 7 prevents and/or treats application in the antiviral in preparation, and it is characterized in that: described virus is influenza virus or virus of AIDS.

Images