CN103266105A

CN103266105A - Method for improving protein soluble expression through rational translation pause sequence redesigning

Info

Publication number: CN103266105A
Application number: CN2013101644548A
Authority: CN
Inventors: 张弓; 陈伟; 熊盛; 金静洁
Original assignee: Jinan University
Current assignee: Guangzhou Qidian Biotechnology Co Ltd; Shenzhen Chi Biotech Co ltd
Priority date: 2013-05-07
Filing date: 2013-05-07
Publication date: 2013-08-28
Anticipated expiration: 2033-05-07
Also published as: CN103266105B

Abstract

The present invention discloses a method for improving protein soluble expression through rational translation pause sequence redesigning. The method comprises the following steps: according to a protein structure, determining an existing position of a translation pause site; carrying out mutation of a slow translation codon outside a translation pause range into a high frequency codon having the same amino acids; and carrying out same sense mutation in the translation pause range according to selection of 2-6 codons, and producing the translation pause site. According to the method, on the premise of no change of the protein amino acid sequence, a nucleotide sequence for encoding protein is redesigned so as to enhance soluble expression efficiency. In addition, the method has characteristics of wide applicability and great prospect potential.

Description

Reset the method that meter improves the protein solubility expression by the translation pause sequence rational faculty

Technical field

The present invention relates to a kind of protein expression optimization method, particularly a kind ofly reset the method that meter improves the protein solubility expression by the translation pause sequence rational faculty.

Background technology

In protein engineering, people induce to make its expression, gene clone (as bacterium or eukaryotic cell lines) in host expression system to produce needed protein.Yet heterologous gene is cloned into and usually can not be expressed well in the host cell, and output is very low or enter inclusion body and do not have normal function, and its reason in most of the cases is that Protein Folding goes wrong.

Solve the problem of protein heterogenous expression false folding, one of traditional thinking is renaturing inclusion bodies, namely use strong denaturant with the solubilization of inclusion bodies sex change, control condition is removed denaturing agent again, is folded into the albumen of solubility again in the hope of making protein under suitable solution condition.This method is comparatively effective to the protein that environment in some bacteriums is not suitable for folding, prokaryotic expression (Huang Penghuang etc. as human fibroblastic growth factor, recombinant human fibroblast growth factor 8b construction of prokaryotic expression vector and purifying research. Chinese biological engineering magazine, 2013.).Yet this method often yield poorly (≤0.1mg/mL), long, complex steps of time, and there is numerous protein not to be suitable for this method (Eiberle, M.K.and A.Jungbauer, Technical refolding of proteins:Do we have freedom to operate? Biotechnol J, 2010.5 (6): p.547-59).Needs are formed disulfide linkage and folding protein, the BL21Origami/Origami2 series expression strain that Novagen company releases, by knocking out the enzyme of trxB and two main reduction approach of gor, reduce the interior reductibility atmosphere of cell and be beneficial to directly in cell, generate disulfide linkage, but this method applicable surface is not wide equally.

Second kind of conventional thought is that molecular chaperones is folding assisted.Molecular chaperones can help after the translation of some protein folding, so coexpression molecular chaperones (as GroEL/ES, DnaK/J, IbpA/B etc.) may help the expression of some foreign protein.This method is at the production of some specific recombinant proteins (especially the vaccine) (Guzzo that achieves success, J., Biotechnical applications of small heat shock proteins from bacteria.Int J Biochem Cell Biol, 2012.44 (10): p.1698-705.), but the applicable surface of this method is wideless equally, fold (Kerner because there are some researches show most protein not rely on molecular chaperones, M.J., et al., Proteome-wide analysis of chaperonin-dependent protein folding in Escherichia coli.Cell, 2005.122 (2): p.209-20).

Another kind of viewpoint thinks that various tRNA content difference can cause translation efficiency low up to more than 10 times in the bacterium.Therefore, Novagen company has developed the BL21Rosetta/Rosetta2 expression strain, and Stratagene company has developed BL21-CodonPlus series expression strain, has all added in the some kinds of intestinal bacteria low-abundance tRNA to accelerate translation.But we studies show that, too much tRNA integral body has been destroyed translation and has been suspended, a large amount of protein can not correctly fold in the cell, the growth of these cells is slower, to abominable growing environment (as high-density growth) fitness relatively poor (Fedyunin, I., et al., tRNA concentration fine tunes protein solubility.FEBS Lett, 2012.586 (19): p.3336-40.), to exogenous protein expression negative effect may be arranged.

Newer viewpoint is thought, the codon difference of preference in the various biologies, and in host cell, the rare codon that foreign gene uses has caused the translation efficiency reduction.Disclosed the preference (Sharp of this codon based on the research of codon adaptation index and tRNA adaptation index, P.M.and W.H.Li, The codon Adaptation Index--a measure of directional synonymous codon usage bias, and its potential applications.Nucleic Acids Res, 1987.15 (3): p.1281-95).So people use the method for " codon optimized " (codon optimization), the rare codon in the target gene is replaced with in the host cell should amino acid whose high frequency codon, attempt to solve the low problem of translation efficiency.This method effect of protein expression amount that improves in some cases, domestic this type of work report is more relatively, as Staphylococcus aureus enterotoxin (Huang, P., H.Y.Sun, and S.Q.Chen, the codon optimized raising expression level of golden staphylococcal enterotoxin O in intestinal bacteria of recombinating. the journal of Zhejiang university medicine, 2011.40 (3): p.297-303.), influenza A virus nucleoprotein (Huang, B.Y., et al., the solubility of influenza A virus nucleoprotein in intestinal bacteria efficiently expresses and purifying. viral journal, 2011.27 (1): the optimization expression that waits p.50-7.).But it is found that in recent years, in many cases, effect is also not obvious even also have a side effect, the genetic expression effect of optimizing is not as good as directly cloning (Menzella, H.G., Comparison of two codon optimization strategies to enhance recombinant protein production in Escherichia coli.Microb Cell Fact, 2011.10:p.15.).Up to now the protein that many using values are very high still can not efficiently express in the engineering expression system.

For example, blue algae antiviral protein N(Cyanovirin-N is called for short CVN) be a kind of protein blue-green algae, that have anti-multiple virus activity, about 11kDa of size of coming from.Began in 1997 to be found and to be combined with the capsid glycoprotein gp120 of HIV, HIV virus can not be combined with CD4, thereby bring into play activity (the Boyd M.R. of its anti-HIV, et al., Discovery of cyanovirin-N, a novel human immunodeficiency virus-inactivating protein that binds viral surface envelope glycoprotein gp120:potential applications to microbicide development.Antimicrob Agents Chemother, 1997.41 (7): p.1521-30.).Subsequently, it is found that CVN not only can anti-HIV, also can resist (Dey B. such as multiple virus such as nerpes vinrus hominis, Measles virus, Ebola virus, influenza virus, et al., Multiple antiviral activities of cyanovirin-N:blocking of human immunodeficiency virus type1gp120interaction with CD4and coreceptor andinhibition of diverse enveloped viruses.J Virol, 2000.74 (10): p.4562-9.; Barrientos L.G., et al., Cyanovirin-N binds to the viral surface glycoprotein, GP1,2and inhibits infectivity of Ebola virus.Antiviral Res, 2003.58 (1): p.47-56.; Wu Chong is superfine, the activity of the inside and outside resisiting influenza virus of the blue algae antiviral protein N derivative that PEG modifies. and the Chinese science and technology paper is online, and 2012.), application potential is very big.But this protein is very difficult to allos and efficiently expresses (Xiong S., J.Fan, and K.Kitazato, The antiviral protein cyanovirin-N:the current state of its production and applications.Appl Microbiol Biotechnol, 2010.86 (3): p.805-12.).In the expression in escherichia coli amount extremely low or form inclusion body and do not have function (Lv Rui etc., the purifying of blue algae antiviral protein N Prokaryotic Expression and recombinant protein and renaturation. journal, 2007.11:p.4. are given birth in medical research; Colleluori D.M., et al., Expression, purification, and characterization of recombinant cyanovirin-N for vaginal anti-HIV microbicide development.Protein Expr Purif, 2005.39 (2): p.229-36.), though to a certain degree renaturation is lost greatly, is yielded poorly.The encoding transport signals peptide is added in CVN sequence of N end, CVN can be transported to periplasmic space to evade inclusion body, be solubility expression but yield poorly, can only obtain 10mg(Mori T. in the 1 rising density nutrient solution, et al., Recombinant production of cyanovirin-N, a potent human immunodeficiency virus-inactivating protein derived from a cultured cyanobacterium.Protein Expr Purif, 1998.12 (2): p.151-8.).Add hydrotropy label such as SUMO etc. and can strengthen its solubility expression amount, but it is not often thorough during excision hydrotropy label, reduce drug effect greatly, increase medicinal risk (Yang Hui etc., clone, fermentation and the purifying of blue algae antiviral protein-N derivative. biotechnology circular, 2012.2012 (5): p.5.).In plant leaf, can accomplish solubility expression, but complex operation, poor growth, and also extremely low (Sexton A. of output, et al., Transgenic plant production of Cyanovirin-N, an HIV microbicide.FASEB J, 2006.20 (2): p.356-8.).Also therefore, CVN slowly can't scale operation, also just can't carry out clinical application.

Tradition biochemical theoretical " An Fensen principle " is thought, Protein Folding information is by its aminoacid sequence unique decision (Taniuchi H. under certain environment, D.R.Davies, and C.B.Anfinsen, A comparison of the x-ray diffraction patterns of crystals of reconstituted nuclease-T and of native staphylococcal nuclease.J Biol Chem, 1972.247 (10): p.3362-4).But the inventor's research points out that this traditional theory is wrong.Though different DNA can translate into same amino acid, proteinogenous speed (translation speed) is but also non-constant, can be slower at some section, this phenomenon is called translation and suspends (translational pausing or translational attenuation) translation time-out site and protein folding height correlation, if it is incorrect that translation suspends the site, this is slow local fast, perhaps this is fast local slow, all will cause the protein false folding to be assembled, can't obtain the soluble proteins of function.That is to say that protein conformation is not only determined by amino acid whose sequence, also determined by nucleotide sequence.（Zhang?G.,M.Hubalewska,and?Z.Ignatova,Transient?ribosomal?attenuation?coordinates?protein?synthesis?and?co-translational?folding.Nat?Struct?Mol?Biol,2009.16(3):p.274-80.；Zhang?G.and?Z.Ignatova,Folding?at?the?birth?of?the?nascent?chain:coordinating?translation?with?co-translational?folding.Curr?Opin?Struct?Biol,2011.21(1):p.25-31.）。This theory is applicable to most protein (Zhang in the protein groups, G.and Z.Ignatova, Generic algorithm to predict the speed of translational elongation:implications for protein biogenesis.PLoS One, 2009.4 (4): p.e5036.; Fedyunin, I., et al., tRNA concentration fine tunes protein solubility.FEBS Lett, 2012.586 (19): p.3336-40.).

Summary of the invention

The shortcoming that primary and foremost purpose of the present invention is to overcome existing protein solubility expression technology provides a kind of and resets the method that meter improves the protein solubility expression by the translation pause sequence rational faculty with not enough.This method is reseted the method for meter for adopting the sequence rational faculty, and whole its translation of people's wage adjustment suspends under the prerequisite that does not change its aminoacid sequence, and then improves the solubility expression of protein.

Another object of the present invention is to provide the coding nucleotide sequence of the strong CVN mutant of a kind of expression amount height and activity.The coding nucleotide sequence of this CVN mutant is for to obtain by aforesaid method.

A further object of the present invention is to obtain the CVN mutant that obtains by this coding nucleotide sequence.

Purpose of the present invention is achieved through the following technical solutions: a kind of reseting by the translation pause sequence rational faculty counted the method for improving the protein solubility expression, comprises following steps:

(1) according to protein structure, determines that translation suspends the position that the site should exist

1. to Multidomain protein, translation suspends the site design and exists: in A, 40 the codon scopes in structural domain separated place to downstream, separated place; And translation of design suspends the site in the B, last 20 the codon scopes of protein coding sequence;

2. to single structure territory protein, only need a translation time-out of design site in last 20 the codon scopes of protein coding sequence;

(2) will translate outer slow translation cipher of suspending range and sport the identical high frequency codon of amino acid

Press the corresponding relation of table 1, outer slow translation cipher of translation suspending range is sported the identical high frequency codon of amino acid, suspend to eliminate unwanted translation; Following codon all is as the criterion with the coding region dna sequence dna:

Table 1

Amino acid	Slow translation cipher	The corresponding codon of translation fast
			Leucine (Leu)	TTA、CTA	CTG
Isoleucine (Ile)	ATA	ATT

Serine (Ser)	TCA、TCC	TCT
			Proline(Pro) (Pro)	CCA、CCC	CCG
Threonine (Thr)	ACA	ACG
			Histidine (His)	CAT	CAC
Arginine (Arg)	CGA、AGG	CGT

(3) in the translation suspending range, select 2～6 codons to carry out same sense mutation in accordance with the following methods, produce translation and suspend the site

1. seek following amino acid, encode with the codon of slow translation listed in the table 2; It is interior if two identical amino acid are arranged that same translation suspends the section scope, should adopt codons different in the following table to encode during coding as far as possible;

Table 2

Amino acid	The codon of slow translation
		Leucine (Leu)	CTA、TTA
Isoleucine (Ile)	ATA
		Serine (Ser)	TCA、TCC
Proline(Pro) (Pro)	CCA、CCC
		Threonine (Thr)	ACA
Histidine (His)	CAT
		Arginine (Arg)	CGA、AGG

Do not allow two codons of slowly translating adjacent, the spacing between adjacent two codons of slowly translating can not surpass 9 codons;

2. the sequence that finishes of the counterweight design calculating of translating time-out need translation occur and suspend in the translation suspending range of setting, translation do not occur with foreign section and suspend and suspend translation in the translation of setting;

3. if calculation result does not meet the demands, then return step 1., the amino acid coding is made amendment, meet the requirements until this step calculating, obtain to improve the nucleotide sequence of solubility expression of protein;

Described single structure territory protein is preferably CVN albumen;

Step (3) 2. is preferably to be counted in the sequence importing RiboTempo software that finishes (http://bioinformatics.jnu.edu.cn/software/ribotempo) reseting, and calculates translation and suspends curve; Red line occurs below blue line the translation suspending range planted agent who sets, and the red line lower-most point should not surpass Axis Text down;

A kind of expression amount is high and the coding nucleotide sequence of the CVN mutant that activity is strong, obtains by aforesaid method, is CVN-M1 or CVN-M2:

The sequence of CVN-M1 is as follows:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATAGACGGTACACTAAAATACGAA；

The sequence of CVN-M2 is as follows:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATCGACGGTACCCTGAAATACGAA；

Described expression amount is high and the application of the coding nucleotide sequence of the CVN mutant that activity is strong in preparation CVN mutant;

High and the active strong CVN mutant of a kind of expression amount prepares: above-mentioned coding nucleotide sequence is cloned on the expression vector, obtains recombinant vectors by the following method; Recombinant vectors is transformed in the host cell expresses, purifying obtains the high and active strong CVN mutant of expression amount;

Described expression vector is preferably pET series expression vector, more preferably pET-28b;

Described host cell is preferably the express recombinant protein e. coli host bacteria, more preferably e. coli bl21 (DE3).

High and the active strong CVN mutant of described expression amount more preferably prepares by the method that comprises following steps:

(1) the following primer of design:

F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’；

R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’；

F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；

R1-mutant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’；

F2-mutant：5’-GTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATCGACGGTAC-3’；

R2-mutant：5’-GTACCGTCGATGTTAGCTATATGGTCGTCTAGGTTGATTTTGGTAGAAAC-3’；

(2) pcr amplification for the first time: being template with the pET-3c-SUMO-CVN plasmid, is that primer carries out pcr amplification with F-sumo/R-CVN, uses NdeI and SalI double digestion behind the PCR product purification that obtains; With the carrier pET-28b of the PCR product behind the double digestion with process NdeI and SalI double digestion, connect; Connect product transformed into escherichia coli DH5 α competent cell, screening obtains recombinant vectors pET-28b-CVN;

(3) pcr amplification for the second time: be the pcr amplification template with pET-28b-CVN, F1-mutant/R1-mutant is that primer carries out pcr amplification, the PCR product purification that obtains is cut through the DpnI enzyme, the enzyme of cycle pure Kit test kit purifying is cut the direct transformed into escherichia coli DH5 of product α competent cell, screening obtains recombinant vectors pET-28b-CVN-M1;

(4) pcr amplification for the third time: be the pcr amplification template with pET-28b-CVN-M1, F2-mutant/R2-mutant is that primer carries out pcr amplification, the PCR product purification that obtains is cut through the DpnI enzyme, the enzyme of cycle pure Kit test kit purifying is cut the direct transformed into escherichia coli DH5 of product α competent cell, screening obtains recombinant vectors pET-28b-CVN-M2;

(5) abduction delivering: change recombinant vectors pET-28b-CVN-M1 or pET-28b-CVN-M2 over to e. coli bl21 (DE3), obtain expression strain; Then use the LB substratum that contains kantlex that this expression strain is cultivated under 37 ℃, the condition of 180～200rpm, at OD ₆₀₀=0.8 o'clock, add IPTG, the final concentration of IPTG is 1mM, behind 37 ℃ of abduction delivering 4h, collects thalline;

(6) purifying: with bacterial sediment by volume the 1:10 ratio after being suspended in the NTA-10 damping fluid again thalline is carried out fragmentation, centrifugal, collect supernatant; In the sample Ni-NTA affinity column, at first use the NTA-10 damping fluid to wash back baseline on the supernatant, wash foreign protein with the NTA-40 damping fluid again, use the NTA-200 buffer solution elution at last, obtain target protein CVN mutant; Wherein, the NTA-10 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles, the NTA-40 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles, the NTA-200 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles;

PCR condition optimization described in the step (2) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min;

PCR condition optimization described in step (3) and (4) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min;

The final concentration of kantlex in the LB substratum described in the step (5) is preferably 50mg/L;

Centrifugal condition optimization described in the step (6) is 4 ℃, 25000g, 30min.

The present invention has following advantage and effect with respect to prior art:

(1) method provided by the invention is under the prerequisite that does not change protein amino acid sequence, redesigns the nucleotide sequence of coded protein, strengthens the efficient of its solubility expression.

(2) various traditional methods (renaturing inclusion bodies, codon optimized, molecular chaperones is folding assisted, the reductibility atmosphere, strengthen tRNA etc.) applicable surface is narrow, and method provided by the invention is applicable to that all do not rely on the folding protein of molecular chaperones, this type protein accounts for the overwhelming majority of all proteins, so this method is widely applicable.

(3) renaturing inclusion bodies method complex steps needs to add denaturing agent, and control condition is removed denaturing agent again, and required condition needs to determine that through a large amount of test examination mistakes waste time and energy, productive rate is low; And method provided by the invention directly to express be exactly soluble proteins, be convenient to very much purifying, improve productive rate, the design and rational result that can be optimized and express need not a large amount of examination mistakes according to the method described above.

(4) codon optimized and strengthen the tRNA method and all eliminated the necessary translation of protein folding and suspend, therefore very easily cause the protein folding mistake and enter inclusion body, can not get activated protein; Method provided by the invention guarantees that then translation suspends, and is beneficial to the correct folding of protein and obtains solubility, the protein of function is arranged.

(5) method provided by the invention can with the folding assisted method of molecular chaperones and the coupling of reductibility atmosphere method, do not conflict, thereby enlarge the scope of application of present method.

(6) the hydrotropy labeling acts needs excision hydrotropy label behind the expression and purification, but the excision of hydrotropy label is often not thorough, causes that productive rate is low, purity is low, causes the drug effect difference even side effect is arranged; Method provided by the invention does not then need the hydrotropy label fully, does not change the aminoacid sequence of crude protein, does not have this problem.

(7) to obtaining the pharmaceutical grade protein of clinical certification, method provided by the invention is optimized its solubility expression efficient but is not changed its aminoacid sequence fully, thereby need not to do again pharmacology and toxicity clinical trial.

Description of drawings

Fig. 1 is that translation suspends graphic representation; Wherein, figure (a) is the coding nucleotide sequence of CVN-M1, and figure (b) is the coding nucleotide sequence of CVN-M2, the 1st, and blue line, the 2nd, red line.

Fig. 2 is the solubility expression analysis chart of CVN and mutant thereof; Wherein, figure (a) namely is CVN target protein band shown in the arrow for SDS-PAGE figure; Figure (b) is Western blot figure; Swimming lane 1 is albumen Marker, and unit is KDa; Swimming lane 2 is CVN-BL21 of abduction delivering not; Swimming lane 3 is CVN-BL21 of abduction delivering; Swimming lane 4 is CVN-M1-BL21 of abduction delivering; Swimming lane 5 is CVN-M2-BL21 of abduction delivering.

Fig. 3 is the SDS-PAGE figure behind CVN and the mutant protein purifying thereof, namely is CVN target protein band shown in the arrow.

Fig. 4 is the active figure as a result of CVN and mutant resisiting influenza virus A/HK/8/68 (H3N2) thereof.

Embodiment

The present invention is described in further detail below in conjunction with embodiment and accompanying drawing, but embodiments of the present invention are not limited thereto.

The main raw that the embodiment of the invention relates to is as follows: host bacterium e. coli bl21 (DE3) (Merck), plasmid pET-28b(Merck), this laboratory of pET3c-SUMO-CVN(makes up, be that ZL200810198926.0, name are called " preparation method of recombined blue algae antiviral protein and application " open detailed preparation process in the patent No., the simplest method is directly to synthesize the SUMO-CVN fusion sequence by order-checking company at present, is connected into the pET3c carrier and can obtains pET3c-SUMO-CVN); Pfu mix enzyme, restriction enzyme Nde I, SalI, DpnI, dye albumen Marker available from Fermentas company in advance, primer is synthetic by the big Gene Tech. Company Limited of China; Ni Sepharose ^TM6Fast Flow is available from GE company, and tetramethyl-azo azoles salt (MTT) is available from U.S. SIGMA company.Other reagent is analytical reagent.NTA-10 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles), NTA-40 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles), NTA-200 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles).

Codon optimized and the expression vector establishment of embodiment 1 CVN

It is theoretical to utilize translation to suspend, and the nucleotide sequence of coding CVN albumen is optimized, and the appropriate design translation suspends the site, utilizes the sudden change round pcr that the nucleotide sequence of CVN is carried out same sense mutation.

The coding nucleotide sequence of CVN albumen is as follows:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTGGACGACCACATCGCTAACATAGACGGTACACTAAAATACGAA。

(1) by translating the nucleotide sequence that suspends Design Theory coding CVN mutant:

1) according to protein structure, determines that translation suspends the position that the site should exist

According to the crystalline structure of CVN, determine that it is single structure territory albumen, so translation of design suspends the site in last 20 the codon scopes of Ying Zaiqi.

2) will translate outer slow translation cipher of suspending range and sport the identical high frequency codon of amino acid

Press the corresponding relation of table 3, outer slow translation cipher of translation suspending range is sported the identical high frequency codon of amino acid, suspend to eliminate unwanted translation; Following codon all is as the criterion with the coding region dna sequence dna:

Table 3

Amino acid	Slow translation cipher	The corresponding codon of translation fast
			Leucine (Leu)	TTA、CTA	CTG
Isoleucine (Ile)	ATA	ATT
			Serine (Ser)	TCA、TCC	TCT
Proline(Pro) (Pro)	CCA、CCC	CCG
			Threonine (Thr)	ACA	ACG
Histidine (His)	CAT	CAC
			Arginine (Arg)	CGA、AGG	CGT

3) in the translation suspending range, select 2～6 codons to carry out same sense mutation in accordance with the following methods, produce translation and suspend the site

1. seek following amino acid, encode with the codon of slow translation listed in the table 4; It is interior if two identical amino acid are arranged that same translation suspends the section scope, should adopt codons different in the following table to encode during coding as far as possible;

Table 4

2. will reset and count in the sequence importing RiboTempo software that finishes, and calculate translation and suspend curve; Red line occurs below blue line the translation suspending range planted agent who sets, and the red line lower-most point should not surpass Axis Text down;

3. if calculation result does not meet the demands, then return step 1., the amino acid coding is made amendment, meet the requirements until this step calculating, obtain to improve the nucleotide sequence of solubility expression of protein.

The nucleotide sequence of the coding CVN mutant that design obtains is as follows:

Mutant 1(CVN-M1) coding nucleotide sequence:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATAGACGGTACACTAAAATACGAA。

Mutant 2(CVN-M2) coding nucleotide sequence:

CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATCGACGGTACCCTGAAATACGAA。

The translation that these two kinds of mutant obtain through the RiboTempo computed in software suspends curve respectively as (a) among Fig. 1 with (b), two translations suspend the curve red line and have all formed translation time-out site (red line is lower than blue line) in predetermined zone (last 20 codons), meet the requirements.

Be directed to mutant 1(CVN-M1) coding nucleotide sequence, the sudden change PCR primer of design is as follows:

F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；

R1-mutant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’。

Be directed to mutant 2(CVN-M2) coding nucleotide sequence, the sudden change PCR primer of design is as follows:

F2-mutant：5’-GTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATCGACGGTAC-3’；

R2-mutant：5’-GTACCGTCGATGTTAGCTATATGGTCGTCTAGGTTGATTTTGGTAGAAAC-3’。

(2) expression plasmid of structure pET-28b-CVN

Be the pcr amplification template with the pET-3c-SUMO-CVN plasmid, F-sumo/R-CVN is that primer carries out pcr amplification, and amplification system is: each 2 μ L of primer (10 μ mol/L), pfu mix25 μ L, template 1 μ L, sterilization ultrapure water 20 μ L; Amplification condition is: 94 ℃ of pre-sex change 3min of reaction mixture; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min.

F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’

R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’。

Use DNA purification kit (OMEGA) to reclaim the PCR product that obtains, the PCR product and the plasmid pET-28b that obtain behind the purifying use NdeI and SalI double digestion (10 * Fastdigest buffer respectively, 37 ℃ of water-bath 30min), enzyme is cut product and is carried out mass volume ratio 1% agarose gel electrophoresis, reclaim enzyme and cut product, with T4DNA ligase enzyme (by specification proposed standard system preparation reaction system), 16 ℃ of connections are spent the night, these two enzymes are cut product couple together, be built into recombinant plasmid pET-28b-CVN.Recombinant plasmid transformed bacillus coli DH 5 alpha competent cell (Merck), coat the LB flat board that contains 50 μ g/mL kantlex, 37 ℃ of overnight incubation, the positive colony that screening is obtained send the order-checking of the big Gene science limited-liability company of China, obtains meeting the CVN clone pET-28b-CVN of desired design.

(3) structure of the recombinant vectors of expression CVN mutant

1. the acquisition of goal gene: be the pcr amplification template with pET-28b-CVN, F1-mutant/R1-mutant is that primer carries out pcr amplification, and amplification system is: each 2 μ L of primer, pfu mix25 μ L, template 1 μ L, sterilization ultrapure water 19 μ L; Amplification condition is: 94 ℃ of pre-sex change 3min of reaction mixture; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min.

Use DNA purification kit (OMEGA) to reclaim the PCR product that obtains, the PCR product that obtains behind the purifying is cut through the DpnI enzyme, the enzyme of cycle pure Kit test kit (OMEGA) purifying is cut the direct transformed into escherichia coli DH5 of product α competent cell (Merck), coating contains the LB flat board of 50 μ g/mL kantlex, the positive colony that screening is obtained send the order-checking of the big Gene science limited-liability company of China, obtains meeting the clone who contains coding CVN mutant 1 nucleotide sequence of desired design with pET-28b-CVN-M1.

2. be the pcr amplification template with pET-28b-CVN-M1, F2-mutant/R2-mutant is that primer carries out pcr amplification, and amplification system and amplification condition are the same.The final plasmid pET-28b-CVN-M2 that makes up.

Embodiment 2

(1) preparation of expression strain:

1. the preparation of e. coli bl21 (DE3) competent cell: preparation process sees " molecular cloning experiment guide " third edition for details; [U.S.] J. Sha nurse Brooker work, Huang Peitang translates.

2. expression vector pET-28b-CVN, pET-28b-CVN-M1 and pET-28b-CVN-M2 are converted into e. coli bl21 (DE3) competent cell respectively: conversion process sees " molecular cloning experiment guide " third edition for details; [U.S.] J. Sha nurse Brooker work, Huang Peitang translates.

(2) CVN and mutation induction thereof are expressed and soluble analysis

1. expression strain CVN-BL21, the CVN-M1-BL21 that step (1) is obtained and CVN-M2-BL21 are inoculated into 20mL respectively and contain in the LB substratum of 50 μ g/mL kantlex content, and 37 ℃, 180rpm are cultivated, and work as OD ₆₀₀=0.8 o'clock, add IPTG, final concentration is 1mM, behind 37 ℃ of abduction delivering 4h, measures OD respectively ₆₀₀, guarantee the volume * OD when CVN and mutant thereof are received bacterium ₆₀₀Value be identical, the centrifugal 10min of 5000g, 4 ℃ collect thalline.Thalline 20mmol/L Tris-HCl(pH8.0,0.15mol/L NaCl) damping fluid is resuspended, high pressure (1000bar) homogeneous smudge cells, 18000g, 4 ℃ of centrifugal 30min, last cleer and peaceful precipitation does not keep sample and treats that follow-up SDS-PAGE electrophoresis (5% concentrates glue, 12% separation gel) and Western blot analyze.

BCA test kit (green the skies Bioisystech Co., Ltd) is measured total protein content in CVN and the centrifugal supernatant of mutant bacterial cell disruption thereof, guarantees that the albumen applied sample amount is identical, and western blot(experimental procedure is seen " fine works molecular biology experiment guide " the 5th edition; (U.S.) Ao Sibai chief editor, Jin Youxin translates) analyze the content of CVN albumen in the supernatant.The result as shown in Figure 2, the amount of CVN mutant 1 and 2 solubility expressions is significantly higher than CVN, particularly the CVN mutant 2, and is particularly remarkable.

(3) CVN and mutant shake flask fermentation and purifying

Expression strain CVN-BL21, CVN-M1-BL21 and the CVN-M2-BL21 that step (1) is obtained is inoculated into 1L respectively, kantlex content is in the LB substratum of 50 μ g/mL, carries out shake flask fermentation and induces by aforesaid expression condition.4 ℃, the centrifugal collection thalline of 6000 * g, 10min, then with bacterial sediment by volume the 1:10 ratio be suspended in the NTA-10 damping fluid again, high-pressure homogeneous (1000bar) smudge cells.4 ℃, the centrifugal collection supernatant of 25000 * g, 30min.

Sample to column volume is in the Ni-NTA affinity column of 20mL on the supernatant, flow velocity 0.6mL/min, and the NTA-10 damping fluid is washed back baseline, and flow velocity is 1mL/min, and the NTA-40 damping fluid is washed foreign protein, NTA-200 buffer solution elution target protein; CVN albumen behind the purifying concentrates the purity of the CVN albumen of SDS-PAGE electrophoresis purification Identification through the ultrafiltration pipe that Sephadex G-25 molecular sieve takes off imidazoles and 3KDa.

According to the relation between CVN protein domain and the translation time-out, introduce the CVN mutant that translation suspends in the CVN structural domain, under 37 ℃ of conditions, can detect CVN mutant protein (Fig. 2 b) from bacterial cell disruption with Western blot the centrifugal supernatant after the abduction delivering.Because the amount of solubility expression is extremely low, the amount of purified acquisition CVN albumen is extremely low, to such an extent as to can not detect with coomassie brilliant blue staining without the native sequences CVN that optimizes; Though do not have aminoacid sequence to change and optimize CVN mutant later, can be purified into a large amount of CVN albumen (Fig. 3).This explanation suspends the translation speed that the site reduces CVN by rationally introduce translation in the CVN structural domain, promotes that the solubility expression of CVN is practicable.

Embodiment 3

CVN resisiting influenza virus A/HK/8/68 (H3N2) activity research

Dog renal epithelial cell mdck cell (U.S. ATCC) is after the pancreatin solution digestion of mass volume ratio 0.25%, with 2.5 * 10 ⁵Cells/well adds (MEM substratum in the 96 porocyte culture plates, the calf serum that contains volume percent 10%), treat to abandon growth media after cell grows up to individual layer, with keeping liquid (MEM substratum, do not contain calf serum) (preserve in the laboratory with medicine CVN albumen respectively, can be CN101638435 by publication number, name is called " a kind of blue-green algal virus protein N mutant; its modified derivative and application " disclosed step and is prepared) and the CVN mutant protein that obtains of embodiment 2 purifying be diluted to 6 series concentration (100,50,25,12.5,6.25,3.125 μ M), each extent of dilution is established 3 multiple holes, establish the normal cell control group simultaneously, positive drug (ribavirin) control group, 37 ℃, 5%CO ₂Cultivate 48h in the incubator, every day observation of cell variation, mtt assay is surveyed each porocyte OD value, calculating median toxic concentration TC50.

In the non-toxic concn scope (TC50〉50 μ M) drug dilution is become different concns, each the 50 μ L of thing diluent that get it filled, human influenza strain A/HK/8/68 (H3N2) (ATCC company, Influenza A virus (H3N2), ATCC

VR-1679 ^TM) viral dilution liquid (100TCID50) 50 μ L directly be added on the individual layer mdck cell after mixing, the positive drug group is established, virus control group, negative control group in 3 multiple holes of each concentration.Place 37 ℃, 5%CO ₂, behind the cultivation 48h, adding 10 μ L concentration is the MTT solution of 5mg/mL, continues to cultivate 4h, and careful the suction abandoned supernatant liquor, and every hole adds 100 μ L DMSO lucifuge shaking tables placement 15min, and microplate reader (Bio-Rad550) reads the OD value, measures wavelength 490nm, reference wavelength 630nm.

Calculate the inhibiting rate %=(OD medicine group-OD virus control group under each drug level)/(OD cell control group-OD virus control group).

The active result of CVN and mutant resisiting influenza virus H3N2 thereof (Fig. 4) shows: CVN and mutant thereof have significant inhibitory effect to H3N2, and the CVN mutant is better than CVN to the restraining effect of H3N2, the relation that this explanation utilizes protein domain and translation to suspend, rationally introducing translation in protein domain suspends, and utilization translation time-out theory redesigns the CVN nucleotide sequence and optimizes, not only can promote the solubility expression of CVN, and can obtain active better CVN albumen.

In sum, 2 CVN mutant that the present invention makes up express successfully in e. coli bl21 (DE3), and the amount of solubility expression are significantly higher than CVN; Overcome CVN and easily formed shortcomings such as inclusion body, purification difficult.The active result of CVN and mutant resisiting influenza virus H3N2 thereof shows: the activity of CVN mutant is better than CVN.

Above-described embodiment is preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.

Claims

1. reset the method that meter improves the protein solubility expression by the translation pause sequence rational faculty for one kind, it is characterized in that: comprise following steps:

By following corresponding relation, outer slow translation cipher of translation suspending range is sported the identical high frequency codon of amino acid, suspend to eliminate unwanted translation; Following codon all is as the criterion with the coding region dna sequence dna:

Slow translation cipher of leucine correspondence is TTA and CTA, and the corresponding corresponding codon of translation fast is CTG; Slow translation cipher of Isoleucine correspondence is ATA, and the corresponding corresponding codon of translation fast is ATT; Slow translation cipher of Serine correspondence is TCA and TCC, and the corresponding corresponding codon of translation fast is TCT; Slow translation cipher of proline(Pro) correspondence is CCA and CCC, and the corresponding corresponding codon of translation fast is CCG; Slow translation cipher of Threonine correspondence is ACA, and the corresponding corresponding codon of translation fast is ACG; Slow translation cipher of Histidine correspondence is CAT, and the corresponding corresponding codon of translation fast is CAC; Slow translation cipher of arginine correspondence is CGA and AGG, and the corresponding corresponding codon of translation fast is CGT;

1. seek following amino acid, use the codon of corresponding slow translation to encode; Same translation suspends in the section scope if two identical amino acid are arranged, and adopts in the following table different codons to encode during coding;

Slow translation cipher of leucine correspondence is CTA and TTA; Slow translation cipher of Isoleucine correspondence is ATA; Slow translation cipher of Serine correspondence is TCA and TCC; Slow translation cipher of proline(Pro) correspondence is CCA and CCC; Slow translation cipher of Threonine correspondence is ACA; Slow translation cipher of Histidine correspondence is CAT; Slow translation cipher of arginine correspondence is CGA and AGG;

2. according to claim 1 reseting by the translation pause sequence rational faculty counted the method for improving the protein solubility expression, and it is characterized in that: described single structure territory protein is CVN albumen.

3. according to claim 1 reseting by the translation pause sequence rational faculty counted the method for improving the protein solubility expression, it is characterized in that: step (3) is 2. counted in the sequence importing RiboTempo software that finishes for reseting, and calculates to translate and suspends curve; Red line occurs below blue line the translation suspending range planted agent who sets, and the red line lower-most point should not surpass Axis Text down.

4. the coding nucleotide sequence of the high and active strong CVN mutant of an expression amount, it is characterized in that obtaining by the described method of claim 1, be CVN-M1 or nucleotide sequence the CVN-M2 as SEQ ID NO.2 shown in of nucleotide sequence shown in SEQ ID NO.1.

5. the application of coding nucleotide sequence in preparation CVN mutant of the CVN mutant that the described expression amount height of claim 4 and activity are strong.

6. the high and active strong CVN mutant of expression amount is characterized in that preparing by the following method: the described coding nucleotide sequence of claim 4 is cloned on the expression vector, obtains recombinant vectors; Recombinant vectors is transformed in the host cell expresses, purifying obtains the high and active strong CVN mutant of expression amount.

7. the high and active strong CVN mutant of expression amount according to claim 6, it is characterized in that: described expression vector is pET series expression vector; Described host cell is the express recombinant protein e. coli host bacteria.

8. the high and active strong CVN mutant of expression amount according to claim 7, it is characterized in that: described expression vector is pET-28b; Described host cell is e. coli bl21 (DE3).

9. the high and active strong CVN mutant of expression amount according to claim 6 is characterized in that preparing by the method that comprises following steps:

(1) the following primer of design:

F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’；

R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’；

F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；

R1-mutant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’；

F2-mutant：5’-GTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATCGACGGTAC-3’；

R2-mutant：5’-GTACCGTCGATGTTAGCTATATGGTCGTCTAGGTTGATTTTGGTAGAAAC-3’；

(5) abduction delivering: change recombinant vectors pET-28b-CVN-M1 or pET-28b-CVN-M2 over to e. coli bl21 (DE3), obtain expression strain; Then use the LB substratum that contains kantlex that this expression strain is cultivated under 37 ℃, the condition of 180～200rpm, when OD600=0.8, add IPTG, the final concentration of IPTG is 1mM, behind 37 ℃ of abduction delivering 4h, collects thalline;

(6) purifying: with bacterial sediment by volume the 1:10 ratio after being suspended in the NTA-10 damping fluid again thalline is carried out fragmentation, centrifugal, collect supernatant; In the sample Ni-NTA affinity column, at first use the NTA-10 damping fluid to wash back baseline on the supernatant, wash foreign protein with the NTA-40 damping fluid again, use the NTA-200 buffer solution elution at last, obtain target protein CVN mutant; Wherein, the NTA-10 damping fluid consist of 20mmol/LTris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles, the NTA-40 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles, the NTA-200 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles.

10. the high and active strong CVN mutant of expression amount according to claim 9 is characterized in that:

PCR condition described in the step (2) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min;

PCR condition described in step (3) and (4) is 94 ℃ of pre-sex change 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min;

The final concentration of the kantlex described in the step (5) is 50mg/L;

Centrifugal condition described in the step (6) is 4 ℃, 25000g, 30min.