CN102260325B - Antibacterial peptide NX-16, and preparation method and application thereof - Google Patents
Antibacterial peptide NX-16, and preparation method and application thereof Download PDFInfo
- Publication number
- CN102260325B CN102260325B CN 201110168592 CN201110168592A CN102260325B CN 102260325 B CN102260325 B CN 102260325B CN 201110168592 CN201110168592 CN 201110168592 CN 201110168592 A CN201110168592 A CN 201110168592A CN 102260325 B CN102260325 B CN 102260325B
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- expression
- preparation
- gene
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to an antibacterial peptide NX-16, and a preparation method and application thereof. The preparation method comprises the steps as follows: the amino acid sequence of the antibacterial peptide NX-16 is designed; the prokaryotic expression tandem gene of the antibacterial peptide NX-16 is designed according to the preference of Escherichia coli codon; a target gene is synthesized by a splicing by overlap extension PCR (polymerase chain reaction) method; an expression vector is built by an enzyme-linked method, the expression vector is transformed in Escherichia coli for expression, and the expression product is subjected to enzymolysis, thus obtaining the antibacterial peptide NX-16. In the preparation method provided by the invention, the gene of the antibacterial peptide is modified and is then subjected to efficient tandem expression in Escherichia coli (the expression product is a polymerized peptide of multiple molecules of the antibacterial peptide, does not have antibacterial activity and does not have killing or inhibiting effects on Escherichia coli), and then the antibacterial peptide molecule with antibacterial activity is obtained by an enzymolysis method; the obtained antibacterial peptide has broad application prospects in the pharmaceutical industry and animal husbandry; and the preparation method provided by the invention has the advantages of high expression efficiency, simple separation and purification, easy operation and good stability.
Description
Technical field
The present invention relates to a kind of antibacterial peptide, be specifically related to a kind of antibacterial peptide NX-16 and preparation method thereof and application.
Background technology
Antibacterial peptide is a kind ofly to have a bioactive micromolecule polypeptide through what induce generation in the organism, usually contains 15-45 amino-acid residue.This class active polypeptide majority has the characteristics such as strong basicity, thermostability and broad-spectrum antimicrobial.First antibacterial peptide is found from the sky silkworm chrysalis in 1980 by people such as Sweden scientist G. Boman in the world.Then, people in succession find from bacterium, fungi, batrachians, insect, higher plant, Mammals and even the mankind and separate the polypeptide that obtains to have anti-microbial activity.At first, it is found that this class active polypeptide has the broad-spectrum high efficacy fungicidal activity to bacterium.Along with carrying out in a deep going way of people's research work, find that some antibacterium peptide all has strong lethal effect to part fungi, protozoon, virus, tumour cell or cancer cells etc., some antibacterial peptide also has immunoloregulation function.
Antibiotic abuse has not only caused the public health problems such as drug residue, and because of the appearance of Resistant strain, so that the control of bacteriosis becomes the human difficult problem of puzzlement again.National relevant laws regulation simultaneously, Multiple Classes of Antibiotics is disabled or limit the use of.Because the efficient anti-microbial activity of the wide spectrum of antibacterial peptide and unique antibacterial mechanisms thereof and in the novel antibacterial drug research, manifested clear superiority.Particularly to deepening constantly that the antibacterial peptide gene expression and regulation mechanism is familiar with, in conjunction with the modern genetic engineering technology, can design more effective antibacterial peptide in medicine industry and livestock industry.Therefore, antibacterial peptide can be used as antibiotic favorable substitutes and is widely used clinically and will be trend of the times.
At present, many antibacterial peptides are being developed to medicine, but the natural output of antibacterial peptide is very low, and the synthetic peptide price is quite expensive again, and these become a bottleneck of the antibiotic peptide medicament of exploitation.The gene engineering expression technology can efficiently express biological activity protein, and simple to operate, cost is low.Therefore, producing antibacterial peptide by genetic engineering technique has broad application prospects.By genetic engineering antibiotic peptides reasonably being transformed and being suddenlyd change, further increase its antibacterial and fungicidal activity, the relation of studying its mechanism of action and structure and function has important directive significance to the production practice of livestock industry and microbiotic alternative medicine.
At present, many investigators focus mostly on the antibacterial peptide gene expression method in eukaryotic expression system.Once had and report that the employing escherichia expression system goes out antibacterial peptide with the formal representation of fusion rotein, but the result not very good.Simultaneously, have the investigator to propose such problem, namely the antibacterial peptide that goes out of escherichia coli expression has certain killing action to intestinal bacteria itself, can have influence on the expression of antibacterial peptide.
Summary of the invention
The technical problem to be solved in the present invention has provided a kind of antibacterial peptide NX-16 with anti-microbial activity, made up the recombinant expression vector that contains goal gene, and the antibacterial peptide gene that adopts the prokaryotic expression restructuring disclosed, obtain again the preparation method of antibacterial peptide NX-16 by enzymolysis process, the method expression efficiency is high, separation and purification is simple, and is easy to operate, good stability.
For solving the problems of the technologies described above, the technical solution used in the present invention is:
A kind of antibacterial peptide NX-16, it is the polypeptide with aminoacid sequence shown in the SEQ ID NO:1 in the sequence table, or by the aminoacid sequence shown in the SEQ ID NO:1 change mutually through modification, L-type amino acid and the D-type amino acid of cyclisation, N-terminal and/or C-terminal, at least a processing in the sequence terminal deletion and the polypeptide of the function equivalent that obtains.
A kind of polynucleotide, its nucleotide sequence:
(a) polynucleotide of the polypeptide shown in the coding SEQ ID NO:1; Or be
(b) polynucleotide complementary with polynucleotide (a).
A kind of carrier that contains above-mentioned Nucleotide.
A kind of genetically engineered host cell that contains above-mentioned carrier.
The preparation method of described antibacterial peptide NX-16 comprises the steps:
(1) aminoacid sequence shown in the SEQ ID NO:1 in the sequence table is repeated series connection by 3, and according to the preferences of e. coli codon, design the tandem gene of this series connection aminoacid sequence, add again respectively nucleic acid restriction endonuclease recognition site and protectiveness base at two ends, form goal gene to be expressed;
(2) for the above-mentioned purpose gene, utilize the primer of four complementations of SOEingPCR primer design method design, contain overlapping base fragment in four primers, use the synthetic goal gene of overlap amplification splicing PCR method;
(3) goal gene is connected with prokaryotic expression carrier pET30a+) connect behind the double digestion, transform e. coli bl21, and identify;
(4) carry out abduction delivering with IPTG, thalline is analyzed expression product through ultrasonication with SDS-PAGE;
(5) expression product is used the kallikrein enzymolysis after dialysis, renaturation, obtains antibacterial peptide NX-16.
Described goal gene sequence is shown in SEQ ID NO:2.
The sequence of the primer of described four complementations is shown in SEQ ID NO:3～6.
A kind of can with the antibody of described antibacterial peptide NX-16 specific binding.
A kind of pharmaceutical composition contains antibacterial peptide NX-16 claimed in claim 1 and the medically acceptable carrier of safe and effective amount.
The application of described antibacterial peptide NX-16 in the preparation sterilant.
The present invention has actively useful effect:
Using gene engineering technique of the present invention at the prokaryotic host cell expression in escherichia coli recombinant antibacterial peptide gene, expression product behind enzymolysis, obtain the design antibacterial peptide, NX-16 has higher anti-microbial activity through this antibacterial peptide of verification experimental verification.Expression efficiency of the present invention is high, and separation and purification is simple, and is easy to operate, good stability.Therefore, the present invention has important value to development of new Effective Anti infection medicine, has broad application prospects at pharmaceutical industry and livestock industry.
The present invention is by behind the modified antimicrobial peptide gene, (expression product is the pdef polypeptide of a plurality of molecules of antibacterial peptide to carry out efficient tandem expression in intestinal bacteria, do not have bacteriostatic activity, intestinal bacteria itself are not had yet kill or restraining effect), then obtain to have the antibacterial peptide molecule of anti-microbial activity by enzymolysis process.
Description of drawings
Fig. 1 is the expression vector establishment synoptic diagram;
Fig. 2 is expression vector double digestion qualification result figure;
Fig. 3 is that the thalline PCR of recombinant vectors identifies;
Fig. 4 is the SDS-PAGE figure as a result of abduction delivering;
The Analysis of Antimicrobial Activity of Fig. 5 purified product is figure as a result.
Embodiment
Embodiment 1: the amino acid of antibacterial peptide and gene design
(1) manually designs antibacterial peptide NX-16, its aminoacid sequence is ILPWHYPFFPWRRPFR, and PFR is kallikrein (Kallikrein) restriction enzyme site, the synthetic full sequence, have anti-microbial activity through agarose plate diffusion process proof synthetic peptide, see embodiment 6.
(2) novel antimicrobial peptide sequence of design in (1) is repeated series connection by 3, according to the preferences of e. coli codon, the tandem gene of design series connection aminoacid sequence, add again at two ends respectively nucleic acid restriction endonuclease (
XhoI and
NcoI) recognition site and protectiveness base form goal gene to be expressed.
The series connection goal gene sequence of design is: 5 '-G
GAATTCA
CCATGGATCCATTTCGTAT TCTGCCGTGGCATTACCCGTTCTTCCCGTGGAGAAGACCATTTCGTATTCTGCCGT GGCATTACCCGTTCTTCCCGTGGAGAAGACCATTTCGTATTCTGCCGTGGCATTAC CCGTTCTTCCCGTGGAGAAGACCATTTCGT
CTCGAGCGG-3 ', the total 178bp of total sequence, the front and back underscore represents respectively
EcoRI,
NcoI and
XhoThe restriction enzyme site of I, wherein
NcoI is restriction enzyme site for subsequent use, represents atg start codon in the square frame.
Embodiment 2: the amplification of design of primers and goal gene
(1) method of utilizing SOEingPCR to design primer is designed to goal gene described in the embodiment 1 overlapping fragments of four complementations, wherein contain 12 overlapping base fragments, overlapping fragments is respectively: G1 contains 57 bases, G2 and contains 56 bases, G3 and contain 55 bases, G4 and contain 54 bases.Wherein G1 and G2 contain 12 overlapping bases, and G2 and G3 contain 17 overlapping bases, and G3 and G4 contain 15 overlapping bases.Article four, the base sequence of overlapping fragments is respectively:
G1：G
GAATTC A
CCATGGATCCATTTCGTATTCTGCCGTGGCATTACCCGTTCTTCCCGTG
G2：GGAAGAACGGGTAATGCCACGGCAGAATACGAAATGGTCTTCTCCACGGGAAGAAC
G3：GCATTACCCGTTCTTCCCGTGGAGAAGACCATTTCGTATTCTGCCGTGGCATTAC
G4：CCG
CTCGAG ACGAAATGGTCTTCTCCACGGGAAGAACGGGATATGCCACGGCAG
(2) two overlapping fragmentses each other template each other primer carry out TD-PCR amplification.
Synthesize new gene fragment NG1 with overlapping fragments G1 and G2 reaction: reaction system (50 μ l) is 10 * PCR buffer, 5 μ l, dNTPs 1 μ l,
Pfu(2.5U/ μ l) 1 μ l, G1 1 μ l, G2 1 μ l, deionized water 42 μ l; Response procedures is 95 ℃ of denaturation 1min, 95 ℃ of 30sec then, and 70 ℃ of 30sec, 72 ℃ of 40sec carry out 5 circulations altogether, 95 ℃ of 30sec then, 54 ℃ of 30sec, 72 ℃ of 40sec carry out 25 circulations altogether, and 72 ℃ are extended 10min, 4 ℃ of insulations.
Synthesize new gene fragment NG2 with overlapping fragments G3 and G4 reaction: reaction system (50 μ l) is 10 * PCR buffer, 5 μ l, dNTPs 1 μ l,
Pfu(2.5U/ μ l) 1 μ l, G1 1 μ l, G2 1 μ l, deionized water 42 μ l; Response procedures is 95 ℃ of denaturation 1min, 95 ℃ of 30sec then, and 70 ℃ of 30sec, 72 ℃ of 40sec carry out 5 circulations altogether, 95 ℃ of 30sec then, 55 ℃ of 30sec, 72 ℃ of 40sec carry out 25 circulations altogether, and 72 ℃ are extended 10min, 4 ℃ of insulations.
Synthesize the goal gene fragment with NG1 and NG2 reaction: reaction system (50 μ l) is 10 * PCR buffer, 5 μ l, dNTPs 1 μ l,
Pfu(2.5U/ μ l) 1 μ l, G1 2 μ l, G2 2 μ l, deionized water 40 μ l; Response procedures is 95 ℃ of denaturation 1min, 95 ℃ of 40sec then, and 70 ℃ of 30sec, 72 ℃ of 50sec carry out 5 circulations altogether, 95 ℃ of 40sec then, 55 ℃ of 30sec, 72 ℃ of 60sec carry out 25 circulations altogether, and 72 ℃ are extended 10min, 4 ℃ of insulations.
(3) the PCR product is identified with 2% agargel electrophoresis, and cuts glue and reclaim.
Embodiment 3: the Construction and identification of expression vector
The building mode of expression vector is referring to Fig. 1.
(1) extracts plasmid pET30a (+) with conventional plasmid extraction kit, then carry out double digestion.Enzyme is cut system (50 μ l): plasmid 30 μ l, and 10 * Buffer, 10 μ l,
Xho I 3 μ l,
Nco I 1 μ l, deionized water 6 μ l analyze with 1% agarose gel electrophoresis after 37 ℃ of enzymes are cut 2h.
(2) double digestion of goal gene.Enzyme is cut system (50 μ l): gained goal gene 30 μ l among the embodiment 2, and 10 * Buffer, 10 μ l,
Xho I 3 μ l,
NcoI 1 μ l, deionized water 6 μ l.After cutting 45min, 37 ℃ of enzymes analyze with 1% agarose gel electrophoresis.
(3) goal gene and carrier is connected.Reaction system (10 μ l): reclaim dna segment 4ml, enzyme is cut the carrier 1ml of rear recovery, T4 dna ligase (350U/ μ l) 0.5ml, and ligase enzyme damping fluid 1ml, deionized water 3.5 ml, 16 ℃ connect 2h in thermostat water bath.
(4) according to ordinary method above-mentioned connection product is transformed into e. coli bl21, the bacterium after transforming is coated the LB flat board, cultivate 12～16h in 37 ℃.The mono-clonal that picking is suspicious, LB liquid culture 12～16h extracts plasmid with conventional plasmid extraction kit, then carries out double digestion and identifies that (the results are shown in Figure 2) and thalline PCR identify (the results are shown in Figure 3).Double digestion system (10 ml): recombinant plasmid 10 μ l, 10 * Buffer, 4 μ l,
Xho I 1 μ l,
Nco I 1 μ l, deionized water 4 μ l, 37 ℃ of enzymes that spend the night are cut, 1% agarose gel electrophoresis analysis.Thalline PCR: reaction system (50ml) is 10 * buffer, 5 μ l, dNTPs 1 μ l,
Pfu(2.5U/ μ l) 1 μ l, bacterium liquid 1 μ l, primer 11 μ l, primer 21 μ l, deionized water 41 μ l; Response procedures is 95 ℃ of denaturation 1min, 95 ℃ of 40sec then, and 67 ℃ of 30sec, 72 ℃ of 50sec, totally 35 circulations, then 72 ℃ are extended 10min, 4 ℃ of insulations; Primer is that its sequence is primer 1:5-TCCGAATTCACCATGGCT-3, primer 2: 5-GTGGTGGTGGTGCTCGAG-3 according to the design of the gene order of recombinant vectors.
(5) after being identified all positive clone's enlarged culturing, double digestion and PCR send biotech firm to carry out sequencing analysis bacterium liquid.After sequential analysis, when in full accord with the sequence of design, carry out next step test operation.
Embodiment 4: abduction delivering and SDS-PAGE thereof analyze
(1) getting among the embodiment 3 through being accredited as positive bacterial strain is 0.5 in the LB liquid culture to OD600, then the IPTG that adds different concns spends the night in 37 ℃ of 120rpm and to induce, and does simultaneously a contrast that does not add IPTG, 4000rpm is centrifugal, and 15min discards supernatant liquor, the results thalline.
(2) according to a conventional method bacterium liquid is carried out SDS-PAGE and analyze, the results are shown in Figure 4.
Embodiment 5: dialysis renaturation and enzymolysis
(1) the gained thalline promotes solubilization of inclusion bodies with urea among the embodiment 4 after ultrasonication, and solution is dialysed concentrated with dialysis tubing, and dialyzate adds in the triethanolamine solution.
(2) add the kallikrein 200 μ l of 100mg/mL in mixed solution, in 37 ℃ of lower respectively water-baths 1.0,2.0 and 3.0h, the solution after cutting with enzyme is done the detection of anti-microbial activity.
Embodiment 6: it is active that the agarose plate diffusion process detects enzymolysis product
(1) gets respectively the Gram negative intestinal bacteria O111 of an amount of tested microorganism and Gram-positive streptococcus aureus NCTC4163, be suspended in lower floor's agarose substratum (the 10 mL trypticase soybean broths about 50 ℃, the ultrapure agar of 10 g, 1 L distilled water, pH 7.4) on.
(2) with the punch tool punching, about 2 mm in aperture add 5 μ L specimen (solution after embodiment 5 gained enzymes are cut) in every hole; Positive control adopts general microbiotic: PXB is for gram-negative bacteria, and nisin is for gram positive organism; Negative control adopts 0.01% acetic acid.
(3) flat board is inverted 3 h in 37 ℃ of incubators, test fluid is diffused in the agarose.
(4) add again one deck nutrient agar.
(5) flat board places 37 ℃ of cultivations, spends the night.
(6) diameter of register hole periphery inhibition zone the results are shown in Table 1 and Fig. 5.This shows that enzymolysis product has anti-microbial activity, and the enzymolysis product activity of enzymolysis 2h is best.
The bacteriostatic activity of table 1 enzymolysis product is unit as a result: mm
| 1 | 2 | 3 | 4 | 5 | 6 | 2F1 | Positive control | Negative control | |
| |
4 | 3 | 9.5 | 11.8 | 9.3 | 0 | 10 | 19 | 0 |
| Streptococcus aureus | 0 | 0 | 2 | 8.2 | 5 | 0 | 7.2 | 12 | 0 |
The positive contrast of mark "+" among Fig. 5, "-" negative contrast.
Left figure is to colibacillary bacteriostatic test, the 1st hole (culture dish lid mark " 1 " is located) is the centrifugal supernatant of bacterium liquid after expressing, (culture dish lid mark " 2 " is located in the 2nd hole, together lower) be the purifying expression product of not enzymolysis, the 3rd hole is the product of expression product enzymolysis 1h, the 4th hole is the product of expression product enzymolysis 2h, the 5th hole is the product of expression product enzymolysis 3h, the 2F1 hole is that (patent publication No.: CN101607992), the 6th hole is the contrast of antibacterial peptide diluent to the antibacterial peptide that separates from bovine blood.
Right figure is the bacteriostatic test to streptococcus aureus, (culture dish lid mark " 1 " is located in the 1st hole, together lower) for expressing the centrifugal supernatant of rear bacterium liquid, the 2nd hole is the purifying expression product of not enzymolysis, the 3rd hole is the product of expression product enzymolysis 1h, and the 4th hole is the product of expression product enzymolysis 2h, and the 5th hole is the product of expression product enzymolysis 3h, the 2F1 hole is that (patent publication No.: CN101607992A), the 6th hole is the contrast of antibacterial peptide diluent to the antibacterial peptide that separates from bovine blood.
Sequence table
SEQUENCE LISTING
＜110〉Henan Science and Technology College
＜120〉antibacterial peptide NX-16 and preparation method thereof and application
<130> /
<160> 6
<170> PatentIn version 3.2
<210> 1
<211> 16
<212> PRT
＜213〉synthetic
<400> 1
Ile Leu Pro Trp His Tyr Pro Phe Phe Pro Trp Arg Arg Pro Phe Arg
1 5 10 15
<210> 2
<211> 178
<212> DNA
＜213〉artificial design
<400> 2
ggaattcacc atggatccat ttcgtattct gccgtggcat tacccgttct tcccgtggag 60
aagaccattt cgtattctgc cgtggcatta cccgttcttc ccgtggagaa gaccatttcg 120
tattctgccg tggcattacc cgttcttccc gtggagaaga ccatttcgtc tcgagcgg 178
<210> 3
<211> 57
<212> DNA
＜213〉artificial design
<400> 3
ggaattcacc atggatccat ttcgtattct gccgtggcat tacccgttct tcccgtg 57
<210> 4
<211> 56
<212> DNA
＜213〉artificial design
<400> 4
ggaagaacgg gtaatgccac ggcagaatac gaaatggtct tctccacggg aagaac 56
<210> 5
<211> 55
<212> DNA
＜213〉artificial design
<400> 5
gcattacccg ttcttcccgt ggagaagacc atttcgtatt ctgccgtggc attac 55
<210> 6
<211> 54
<212> DNA
＜213〉artificial design
<400> 6
ccgctcgaga cgaaatggtc ttctccacgg gaagaacggg atatgccacg gcag 54
Claims (9)
1. an antibacterial peptide NX-16 is characterized in that, it is the polypeptide of the aminoacid sequence shown in the SEQ ID NO:1 in the sequence table.
2. polynucleotide is characterized in that, its nucleotides sequence is classified as:
(a) polynucleotide of the polypeptide shown in the coding SEQ ID NO:1; Or be
(b) polynucleotide complementary with polynucleotide (a).
3. a carrier is characterized in that, contains polynucleotide claimed in claim 2.
4. a genetically engineered host cell is characterized in that, contains carrier claimed in claim 3.
5. the preparation method of the described antibacterial peptide NX-16 of claim 1 comprises the steps:
(1) aminoacid sequence shown in the SEQ ID NO:1 in the sequence table is repeated series connection by 3, and according to the preferences of e. coli codon, design the tandem gene of this series connection aminoacid sequence, add again respectively nucleic acid restriction endonuclease recognition site and protectiveness base at two ends, form goal gene to be expressed;
(2) for the above-mentioned purpose gene, utilize the primer of four complementations of SOEingPCR primer design method design, contain overlapping base fragment in four primers, use the synthetic goal gene of overlap amplification splicing PCR method;
(3) goal gene is connected with prokaryotic expression carrier pET30a+) connect behind the double digestion, transform e. coli bl21, and identify;
(4) carry out abduction delivering with IPTG, thalline is analyzed expression product through ultrasonication with SDS-PAGE;
(5) expression product is used the kallikrein enzymolysis after dialysis, renaturation, obtains antibacterial peptide NX-16.
6. the preparation method of described antibacterial peptide NX-16 according to claim 5 is characterized in that described goal gene sequence is shown in SEQ ID NO:2.
7. the preparation method of described antibacterial peptide NX-16 according to claim 5 is characterized in that the sequence of the primer of described four complementations is shown in SEQ ID NO:3～6.
8. the antibody of an energy and the described antibacterial peptide NX-16 of claim 1 specific binding.
9. one kind is used for antibacterial pharmaceutical composition, it is characterized in that it contains antibacterial peptide NX-16 claimed in claim 1 and the medically acceptable carrier of safe and effective amount.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110168592 CN102260325B (en) | 2011-06-22 | 2011-06-22 | Antibacterial peptide NX-16, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110168592 CN102260325B (en) | 2011-06-22 | 2011-06-22 | Antibacterial peptide NX-16, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102260325A CN102260325A (en) | 2011-11-30 |
| CN102260325B true CN102260325B (en) | 2013-05-29 |
Family
ID=45007184
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110168592 Expired - Fee Related CN102260325B (en) | 2011-06-22 | 2011-06-22 | Antibacterial peptide NX-16, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102260325B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103194442B (en) * | 2013-03-29 | 2016-02-17 | 重庆市畜牧科学院 | Novel polypeptide, hydrolysis antibacterial peptide and preparation method thereof |
| CN105175508B (en) * | 2015-10-19 | 2020-04-21 | 河南科技学院 | Antibacterial peptide HJH-1 and application thereof |
| CN108314718B (en) * | 2018-04-19 | 2021-12-17 | 贵州医科大学 | Housefly antibacterial peptide MAF-1A peptide polymer, encoding gene thereof, expression and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1367180A (en) * | 2001-01-22 | 2002-09-04 | 中国科学院上海生物化学研究所 | Novel natural antibacterial peptide, its code sequence and application |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005078116A1 (en) * | 2004-01-16 | 2005-08-25 | Qiuyun Liu | A method of isolating antibacterial peptides and the isolated peptides thereof |
| KR100790807B1 (en) * | 2006-12-08 | 2008-01-04 | 대한민국 | An anti-bacterial peptide base pairs and an anti-bacterial peptide isolated from dung beetle Copris tripartitus larvae |
| CN101307100B (en) * | 2007-05-16 | 2012-07-04 | 上海医药工业研究院 | Polypeptide fragments of antibiotic peptide, nucleotide sequence thereof and applications |
| DE102007036128A1 (en) * | 2007-07-23 | 2009-02-12 | Universität Leipzig | Antibiotic peptides |
| US8431528B2 (en) * | 2008-05-16 | 2013-04-30 | University Of Maryland, Baltimore | Antibacterial Lactobacillus GG peptides and methods of use |
| CN101550183B (en) * | 2009-03-20 | 2011-11-16 | 中国科学院海洋研究所 | Antibacterial peptide and construction and application thereof |
| CN101955525B (en) * | 2010-07-13 | 2012-11-07 | 中国农业科学院兰州畜牧与兽药研究所 | Artificial antimicrobial peptide, gene and preparation method thereof |
-
2011
- 2011-06-22 CN CN 201110168592 patent/CN102260325B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1367180A (en) * | 2001-01-22 | 2002-09-04 | 中国科学院上海生物化学研究所 | Novel natural antibacterial peptide, its code sequence and application |
Non-Patent Citations (3)
| Title |
|---|
| GenBank: ABU27636.1;Holtzman D, et al.;《NCBI reference sequence》;20070814;第1页 * |
| Holtzman D, et al..GenBank: ABU27636.1.《NCBI reference sequence》.2007,第1页. |
| 胡圣尧.第十四章 抗原抗体的检测.《免疫学与生物技术》.人民卫生出版社,2003,第93页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102260325A (en) | 2011-11-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| NZ602351A (en) | Axmi-115, axmi-113, axmi-005, axmi-163 and axmi-184 : vip3a insecticidal proteins from bacillus thuringiensis and methods for their use | |
| CN106967659A (en) | A kind of structure and fermentation process of the antibiotic-free resistance recombined bacillus subtilis for expressing glutamate decarboxylase | |
| CN105062992B (en) | A kind of endolysin and the polynucleotides for encoding this endolysin | |
| CN108822202B (en) | Grass carp interleukin 21 recombinant protein and preparation method thereof | |
| CN103789317A (en) | Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application | |
| CN102260325B (en) | Antibacterial peptide NX-16, and preparation method and application thereof | |
| CN101550183B (en) | Antibacterial peptide and construction and application thereof | |
| CN110408624A (en) | A kind of Ruditapes philippinarum c-type agglutinant protein and the preparation method and application thereof | |
| CN107266585B (en) | A kind of MLH fusion antibacterial peptide and its preparation method and application | |
| CN111334488B (en) | Laminarin enzyme OUC-L1, and coding gene and application thereof | |
| CN102586262B (en) | Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene | |
| CN107266539A (en) | A kind of bacillus licheniformis W10 antibacterial proteins and application | |
| CN103724412A (en) | Fenneropenaeus chinensiss anti-lipopolysaccharide factor as well as preparation and application thereof | |
| CN102094024A (en) | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application | |
| CN102703400A (en) | Hot start DNA (Deoxyribose Nucleic Acid) polymerase and application thereof | |
| CN105693866A (en) | Fusion antibacterial peptide and application thereof | |
| CN1177055C (en) | Antibacterial peptide gene of fly and its cloning process | |
| CN102120760B (en) | Antibacterial peptide derived from phage and application thereof | |
| CN104987367A (en) | Preparation method of artificial antibacterial peptide PR39-R1T and application thereof | |
| CN101942473A (en) | Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme | |
| CN102140444B (en) | Low temperature alkaline phosphatase and preparation method thereof | |
| Yu et al. | Draft genome sequence, disease-resistance genes, and phenotype of a Paenibacillus terrae strain (NK3-4) with the potential to control plant diseases | |
| CN110698554B (en) | Migratory locust FKBP52 protein and coding gene and application thereof | |
| CN114752610A (en) | Application of diaphorina citri ubiquitin-conjugating enzyme E2J2 gene in prevention and control of citrus greening disease | |
| CN103484487B (en) | A kind of small cabbage moth N,O-Diacetylmuramidase II and preparation method thereof and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130529 Termination date: 20140622 |
|
| EXPY | Termination of patent right or utility model |