CN102094024A - Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application - Google Patents
Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application Download PDFInfo
- Publication number
- CN102094024A CN102094024A CN2010105893921A CN201010589392A CN102094024A CN 102094024 A CN102094024 A CN 102094024A CN 2010105893921 A CN2010105893921 A CN 2010105893921A CN 201010589392 A CN201010589392 A CN 201010589392A CN 102094024 A CN102094024 A CN 102094024A
- Authority
- CN
- China
- Prior art keywords
- cecropin
- cabbage moth
- small cabbage
- gene
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a plutella xylostella cecropin gene, an encoded protein, a corresponding expression system and application. The plutella xylostella cecropin gene is double stranded linear deoxyribonucleic acid (DNA) with the length of 480bp, and a nucleotide sequence of the plutella xylostella cecropin gene is shown in SEQ ID NO:1. The protein encoded by the gene has 65 amino acids, and an amino acid sequence of the protein is shown in SEQ ID NO:2. Plutella xylostella cecropin is expressed in Escherichia coli through a gene recombination technology, and the plutella xylostella cecropin with an antibacterial function is obtained. The plutella xylostella cecropin with the antibacterial function has broad application value in medicines, food preservation or adding of feed preservatives.
Description
Technical field
The present invention relates to gene engineering technology field, be specifically related to a kind of small cabbage moth cecropin gene, encoded protein, corresponding expression system and application.
Background technology
Antibacterial peptide is that a class is difficult for causing the chemical sproof novel anti-infection polypeptide of microorganism.First kind of antibacterial peptide of Fa Xianing is cecropin in the world, induced by usefulness cloaca through rod bacterium such as Sweden scientist Boman and intestinal bacteria in 1980 to cherish the peptide material that guppy sky silkworm chrysalis produces anti-microbial activity, names to be cecropin (cecropins).Cecropin is first kind of found insect antimicrobial peptide, extensively be present in the insect, now from lepidopterous moth class, butterfly and dipterous fly class separation and purification go out more than 20 kind of cecropin analogue.Showed multiple bacterium peptide at the landlocked supervention of other biological body again subsequently, as Magainin (magainins), melittin (melittins), alexin (defensins) etc.Known in the world at present antibacterial peptide has kind more than 1200.Owing to it is found that this class active polypeptide has the broad-spectrum high efficacy fungicidal activity to bacterium at first, thereby called after antibacterial peptide.Along with carrying out in a deep going way of research work, find that some antibacterial peptide all has very strong lethal effect to part fungi, protozoon, virus and cancer cells etc.
Thereby the microbiotic antibacterial mechanisms is the receptors bind of microbiotic and pathogenic agent privileged site to be destroyed the normal configuration of pathogenic agent or some biosynthesizing is obstructed, to reach antibacterial or germ-resistant effect.When the target site of its effect changed, microbiotic will lose its anti-microbial effect, and it is chemical sproof basic that this is that microorganism is easy to microbiotic is produced.Think that at present the antibacterial mechanisms of cecropin antibacterial peptide is: antibacterial peptide acts on the cytolemma of bacterium in the mode of physics, makes membrane perforation, tenuigenin is excessive and bacterium is killed.Because cecropin class antibacterial peptide all has hydrophobic and hydrophilic amphiphilic character, negative charge on positively charged molecule and the cell membrane phospholipid molecule forms electrostatic adhesion and is combined on the immobilized artificial membrane of cell, insert in the lipid film of bacterial cell membrane the hydrophobic side of cecropin antibacterial peptide molecule subsequently, and then draw whole molecule and enter plasma membrane, upset protein and the original arrangement order of lipid on the plasma membrane, polymerization forms and strides the film ionic channel by the intermolecular mutual displacement of cecropin antibacterial peptide again, the tenuigenin outflow, ion is lost in a large number in the cell, and bacterium can not be kept osmotic pressure in the required born of the same parents of normal activities and death.
The more traditional microbiotic of the antimicrobial spectrum of antibacterial peptide is wide, and traditional microbiotic is only effective to bacterium usually, and invalid to pathogenic agent such as fungi, viruses.The effect of the existing anti-Gram-negative bacteria of antibacterial peptide, gram-positive microorganism has antimycotic, antivirus action again.Antibacterial peptide not only self has good antibacterial activity, different cecropin antibacterial peptides and traditional microbiotic coupling, also can improve curative effect of medication separately, even widen traditional antibiotic antimicrobial spectrum, this also is in recent years to a new discovery in the research of cecropin antibacterial peptide.
Insect antimicrobial peptide is the micromolecule polypeptide that a class has immunological effect, and it has characteristics such as thermally-stabilised, has a broad antifungal spectrum, non-immunogenicity, mechanism of action uniqueness, is that insect can be resisted the important factor that the occurring in nature harmful microorganism infects.In recent years, along with the dark people of the relevant antibacterial peptide mechanism of action and functional study, its research at field of medicaments more and more causes people's attention.
Summary of the invention
The objective of the invention is to according to the deficiencies in the prior art, a kind of small cabbage moth cecropin gene is provided.
Another purpose of the present invention is to provide the albumen of above-mentioned small cabbage moth cecropin genes encoding.
Another purpose of the present invention is to provide the cloning process of above-mentioned small cabbage moth cecropin gene.
Another purpose of the present invention is to provide the preparation method of above-mentioned small cabbage moth cecropin.
A further object of the invention is to provide the application of above-mentioned small cabbage moth cecropin.
Above-mentioned purpose of the present invention is achieved by the following technical programs:
Using gene engineering means of the present invention have been cloned the intravital cecropin gene of diamondback moth larvae, and in prokaryotic system, obtained efficiently expressing, the small cabbage moth antibacterial peptide cecropin of reorganization not only has stronger restraining effect to Gram-negative bacteria, gram-positive microorganism, and multiple pathogenic fungi also had stronger restraining effect, be expected to develop into novel peptide antibiotics.
Small cabbage moth cecropin of the present invention (Cecropin) antibacterial peptide, it has the sequence shown in following SEQ ID NO 1 and the SEQ ID NO 2:
(1) information of SEQ ID NO 1:
(a) sequence signature
* length: 480 bp
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: DNA
(c) suppose: not
(d) antisense: not
(e) initial source: diamondback moth larvae (
Plutella xylostellaL.)
(f) sequence description: SEQ ID NO:1
(2) information of SEQ ID NO:2
(a) sequence signature
* length: 65
* type: amino acid
* chain: strand
* topoisomerase: linearity
(b) molecule type: peptide
(c) sequence description: SEQ ID NO:2
The cloning process of small cabbage moth cecropin cDNA of the present invention is as follows:
(1) injects in the small cabbage moth 4 instar larvae bodies for the 0.8-1.0 intestinal bacteria with the OD value and induce, utilize the diamondback moth larvae of inducing 24 hours to extract total RNA, then with the synthetic cDNA of total RNA reverse transcription;
(2) expressed sequence tag sequence (EST) design 3 ' terminal rapid amplifying according to cecropin reacts the special primer of (RACE):
Forward primer: SEQ ID NO:3
Reverse primer: the acid of oligomerization dT [Oligod(T)
18]
(3) by the chain polymerization enzyme reaction dna fragmentation that increases;
(4) with the amplified production purifying, get purified product and be cloned into the pMD18-T carrier, transform DH5 α cell, dull and stereotyped incubated overnight, the extracting plasmid is cut and is checked order and identify the dna fragmentation that obtains a 420bp size through enzyme.
The cloning process concrete operations of above-mentioned small cabbage moth cecropin cDNA are as follows:
From diamondback moth larvae, adopt RNA kit to extract total RNA.
Utilize total RNA of 5 ~ 10 micrograms or mRNA reverse transcription to synthesize cDNA then.CDNA first chain is synthetic: the total RNA of 5 ~ 10 micrograms, the damping fluid of 10 microlitres, 4 microlitre oligomerization dT acid, 10 microlitres, 10 micromole's deoxynucleoside acid mixtures, 3.2 microlitre RNA enzyme inhibitors, 2 microlitre M-MLV reversed transcriptive enzymes, the distilled water of the no RNA enzyme of 12.8 microlitres, 70 ℃ were reacted 5 minutes, 60 minutes termination reactions of 42 ℃ of reactions.
Chain polymerization enzyme reaction (PCR) reagent and condition are as follows:
At first together with following reagent mix:
10xTaq dna polymerase buffer liquid 5 microlitres (μ l)
Template cDNA 2 μ l
Forward primer (1.25 μ g/ μ l) 2 μ l
Reverse primer (1.25 μ g/ μ l) 2 μ l
Deoxynucleoside acid mixture (dNTP) 4 μ l
Taq archaeal dna polymerase 0.5 μ l
Aqua sterilisa 34.5 μ l
Cumulative volume 50 μ l
Chain polymerization enzyme PCR reaction conditions is: at first 94 ℃ of sex change are 5 minutes, enter following circulation then: 94 ℃ 30 seconds, 45 ℃ 30 seconds, 72 ℃ 50 seconds, carry out 35 circulations altogether, last 72 ℃ were extended 10 minutes.
The increased band of 420bp of result.With the amplified production purifying, get 10 μ l purified products and be cloned into pMD18-T carrier (TaKaRa), transfection DH5 α cell (common carrier host cell), dull and stereotyped incubated overnight.6 hickies of picking extract plasmid, are used for sequencing.Behind the sequence assembly, the result has obtained the dna fragmentation of 480bp, open reading frame (ORF) is 198bp, push away thus the coding 65 amino acid whose one section sequences, the sequence of this sequence with the antibacterial peptide of having delivered compared, the cecropin aminoacid sequence of result and lepidopterous insects has similarity, therefore can determine that this gene is a kind of new antibacterial peptide gene.
The above-mentioned method with small cabbage moth cecropin of sterilizing function of preparation of the present invention may further comprise the steps:
(1) according to the coding of small cabbage moth cecropin mature peptide, design primer PF and PR,
(2) carry out the cDNA of conventional chain polymerization enzyme reaction amplification small cabbage moth cecropin mature peptide;
(3) cDNA of clone small cabbage moth cecropin mature peptide in the carrier that is suitable for expressing;
(4) expression plasmid pET-32a-Px-cec1 efficiently expressing in prokaryotic cell prokaryocyte;
(5) cultivate host cell being suitable for expressing under the segmental condition of this cDNA, and therefrom reclaim required product.
(6) be suitable for purification of recombinant proteins under the condition of purifying.
Design primer PF:SEQ ID NO:4 described in the above-mentioned steps (1); PR:SEQ ID NO:5.
As a kind of preferred version, step (2) is specially:
Mixed solution at 94 ℃ of pre-sex change 5min, is entered following circulation then: 94 ℃, 40 seconds, 50 ℃, 40 seconds, 72 ℃, 50 seconds, carry out 35 circulations altogether, last 72 ℃ were extended 7 minutes, and the rearmounted 4 ℃ of termination reactions that finish increase.
Described mixed solution is composed as follows:
Contain 20 mM Mg
2+10 * PCR damping fluid, 5 μ l
The concentration of dATP, dTTP, dCTP, dGTP
Respectively be the dNTP mixture 4 μ l of 2.5 mM
Concentration is the primer PF 4 μ l of 10 μ M
Concentration is the primer PR 4 μ l of 10 μ M
Concentration is the high-fidelity DNA polymerase 0.5 μ l of 5U/ μ l
Aqua sterilisa 32.5 μ l.
As a kind of preferred version, the carrier described in the step (3) is pET-32a; In a preferred embodiment, step (3) specifically comprises:
(a) acquisition of fungicidal activity peptide.In order not introduce other aminoacid sequence, when design PF and PR primer, introduced in the upstream at fungicidal activity peptide Px-cec1 aminoterminal
NcoThe I restriction enzyme site, introduce in the downstream
XhoI restriction enzyme site, the mature peptide cDNA fragment that obtains like this are connected with carrier and have guaranteed correct direction of insertion.And the fusion rotein of expressing discharges the cecropin with natural N end after the enteropeptidase cutting.
(b) cDNA with the fungicidal activity peptide carries out Nco I and Xho I double digestion, after glue purification reclaims, with external connection of plasmid pET-32a that cuts back to close through same enzyme, construction expression plasmid pET-32a-Px-cec1.
As a kind of preferred version, step (4) specifically comprises
Host bacteria BL21 (DE3) is inoculated in fresh LB enriched medium by 1: 50 volume ratio (contains 100 μ g/ml Amp
+) in, 37 ℃ of thermal agitation amplification culture are to OD
600=0.8 o'clock, adding final concentration was 0.4 mM IPTG, added final concentration simultaneously and be 0.2% glucose, reduced the expression of background.25 ℃ of abduction deliverings 9 hours, 4 ℃, 12, the centrifugal 2min of 000g, it is standby to collect thalline.
As a kind of preferred version, step (5) specifically comprises the thalline that will collect, through ultrasonic cell disruptor, power with 300W, the broken bacterial cell of ultrasonic 4-5 circulation under the ice bath (repeating 90 times is a circulation for ultrasonic 4s, 4s intermittently), 4 ℃, 12, get supernatant liquor behind the centrifugal 30min of 000g.Through Ni
2+Metal affinity chromatography HisTrap HP purified fusion protein, the fusion rotein of purifying is cut through enteropeptidase (EK) enzyme, enzyme is cut product and is carried out purifying with HisTrap HP (5 ml) earlier, collect effluent liquid, effluent liquid carries out the HisTrap HP second time (5 ml) column purification again, collect effluent liquid, be that the super rate device (Amicon) of 10.0 kDa carries out purifying to recombinant protein further with molecular weight cut-off, remove the above large protein of 10.0 kDa, be that the super rate device (Amicon) of 2.0 kDa carries out purifying to recombinant protein further, remove the following small protein of 2.0 kDa, remove filtered solution with molecular weight cut-off, lyophilize is handled, and-80 ℃ of preservations are standby.
Gordian technique of the present invention is to clone the reorganization cecropin that obtains the full-length gene of small cabbage moth cecropin and obtain fungicidal activity.
Embodiment
The present invention is described in further detail below in conjunction with embodiment and accompanying drawing, but embodiments of the present invention are not limited thereto.
The cloning process of embodiment 1 small cabbage moth antibacterial peptide Cecropin1 gene
Have the laboratory rearing small cabbage moth (
Plutella xylostella) larva, the usefulness intestinal bacteria (
Escherichia coli), streptococcus aureus (
Staphylococcus auceus) and aureobasidium pullulans (
Aureobasidium pullulans) as supplying the examination bacterial classification.
1. total RNA extracts: with the OD value is intestinal bacteria stimulation small cabbage moth 4 instar larvaes of 0.8-1.0, carries out inducing of antibacterial peptide.The small cabbage moth 0.5-1 that learnt from else's experience after inducing in 24 hours restrains, and grinds in the liquid nitrogen, extracts total RNA with guanidine isothiocyanate method
2. cDNA first chain is synthetic: carry out according to the RACE of CLONTECH company test kit specification sheets, the total RNA of 10 micrograms adds 42 ℃ of reactions of reaction solution 20 microlitres 90 minutes.72 ℃ of 10 minutes termination reactions.Reaction solution is formed: 50 mmole Repone K, 3 mmole magnesium chlorides, 10 mmole Tris-HCL pH8.3,1 mmole DTT, 5 micromole d NTP, 25 RNA of unit enzyme inhibitorss, 8 AMV of unit reversed transcriptive enzymes
3. PCR reaction: chain polymerization enzyme reaction (PCR) reagent and condition:
At first together with following reagent mix
10xTaq dna polymerase buffer liquid 5 microlitres (μ l)
Template cDNA 2 μ l
Forward primer (1.25 μ g/ μ l) 2 μ l
Reverse primer (1.25 μ g/ μ l) 2 μ l
Deoxynucleoside acid mixture (dNTP) 4 μ l
Taq archaeal dna polymerase 0.5 μ l
Aqua sterilisa 34.5 μ l
Cumulative volume 50 μ l
Forward primer is shown in SEQ ID NO:3, and reverse primer is oligomerization dT acid Oligo d(T)
18
The PCR reaction conditions is: at first 94 ℃ of sex change are 5 minutes, enter following circulation then: 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 50 seconds, carry out 35 circulations altogether, last 72 ℃ were extended 10 minutes.
4. reaction product purifying: utilize OMEGA BIO-TEK company product (Gel Extraction Kit) operation steps to be undertaken by product description.
5. antibacterial peptide gene is cloned: get purified product 5 microlitres, connect and pMD18-T carrier (TaKaRa).Be transformed into e.colistraindh5, in the dull and stereotyped grow overnight that also has penbritin (100 mg/ml) and isopropylthiogalactoside (IPTG0.1 mole/milliliter), 6 hickies of picking, in LB liquid nutrient medium (5 milliliters contain 100 mg/ml penbritins) incubated overnight.
6. plasmid purification: collect incubated overnight bacterium liquid 1-2 milliliter, centrifugal (10000 change 1 minute) collecting cell.With minim DNA purification kit (OMEGA BIO-TEK) plasmid purification, the purification step by specification carries out.
Sequence order-checking and homology retrieval: get 500 microlitre bacterium liquid, send the big gene of China to check order.Compare with the gained sequence assembly and with the gene pool sequence.
Embodiment 2 preparations have the method for the small cabbage moth cecropin of sterilizing function
1. the primer that the small cabbage moth cecropin mature peptide that increases is encoded:
PF:5 '-5'-GCG
CCATGGAGCCGTTTAAAAAATTG
GA -3 ',
Ccatgg The restriction enzyme site that expression is introduced is the Nco I,
PR:5 '-ggA
CtcgagTCATTTGCCAGTAGGTCTGGCTA
-3 ',
Ctcgag The restriction enzyme site that expression is introduced is
XhoI.
2. the pcr amplification of small cabbage moth cecropin mature peptide coding:
CDNA with small cabbage moth 4 instar larvaes is a template, and reaction conditions is as follows:
Described mixed solution is composed as follows:
Contain 20 mM Mg
2+10 * PCR damping fluid, 5 μ l
The concentration of dATP, dTTP, dCTP, dGTP
Respectively be the dNTP mixture 4 μ l of 2.5 mM
Concentration is the primer PR 4 μ l of 10 μ M
Concentration is the primer PF 4 μ l of 10 μ M
Concentration is the high-fidelity DNA polymerase 0.5 μ l of 5U/ μ l
Aqua sterilisa 32.5 μ l.
Mixed solution at 94 ℃ of pre-sex change 5min, is entered following circulation then: 94 ℃, 40 seconds, 55 ℃, 40 seconds, 72 ℃, 50 seconds, carry out 35 circulations altogether, last 72 ℃ were extended 7 minutes, and the rearmounted 4 ℃ of termination reactions that finish increase.
3. the expression of small cabbage moth cecropin mature peptide in prokaryotic cell prokaryocyte:
The cDNA of the small cabbage moth cecropin that pcr amplification is obtained carries out Nco I and Xho I double digestion, after glue purification reclaims, with external connection of plasmid pET-32a that cuts back to close through same enzyme, construction expression plasmid pET-32a-Px-cec1; Order-checking is identified that correct recombinant plasmid pET-32a-Px-cec1 transforms expressive host bacterium BL21, makes up engineering strain.Picking engineering strain list colony inoculation (contains 100 μ g/ml Amp in LB liquid enriched medium
+) in, 37 ℃ of thermal agitations were cultivated 16 hours, as kind of a daughter bacteria.Getting kind of daughter bacteria is inoculated in fresh LB enriched medium by 1: 50 volume ratio and (contains 100 μ g/ml Amp
+) in, 37 ℃ of thermal agitation amplification culture are to OD
600=0.8 o'clock, adding final concentration was 0.4 mM IPTG, added final concentration simultaneously and be 0.2% glucose, reduced the expression of background.25 ℃ of abduction deliverings 9 hours, 4 ℃, 12, the centrifugal 2min of 000g, it is standby to collect thalline.And reservation 1ml bacterium liquid is used for the SDS-PAGE analysis.Behind TE damping fluid (pH 8.0) the washing thalline with precooling, use solution I (300 mM KCl (pH8.0), the 50 mM KH of precooling again
2PO
4, 5 mM imidazoles) and resuspended thalline.Adopt the power of JY92-II type ultrasonic cell disruptor (Ningbo Xin Zhike device Research Institute) with 300W, ultrasonic 4-5 circulation (ultrasonic 4s under the ice bath, 4s intermittently, repeating 90 times is a circulation) broken bacterial cell, 4 ℃, 12, get the expression that supernatant liquor carries out SDS-PAGE analyzing and testing recombinant protein behind the centrifugal 30min of 000g.
4. the purifying of reorganization small cabbage moth antibacterial peptide cecropin
With the supernatant liquor of broken thalline centrifugal back collection, through Ni
2+Metal affinity chromatography HisTrap HP purified fusion protein, the fusion rotein of purifying is cut through enteropeptidase (EK) enzyme, enzyme is cut product and is carried out purifying with HisTrap HP (5 ml) earlier, collect effluent liquid, effluent liquid carries out the HisTrap HP second time (5 ml) column purification again, collect effluent liquid, be that the super rate device (Amicon) of 10.0 kDa carries out purifying to recombinant protein further with molecular weight cut-off, remove the above large protein of 10.0 kDa, be that the super rate device (Amicon) of 2.0 kDa carries out purifying to recombinant protein further, remove the following small protein of 2.0 kDa, remove filtered solution with molecular weight cut-off, lyophilize is handled, and-80 ℃ of preservations are standby.
The foregoing description is a preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
SEQUENCE?LISTING
＜110〉Agricultural University Of South China
＜120〉a kind of small cabbage moth cecropin gene, encoded protein, corresponding expression system and application
<130>
<160> 5
<170> PatentIn?version?3.2
<210> 1
<211> 480
<212> DNA
＜213〉artificial sequence
<400> 1
ttaatcgagg?aacaaaagat?tccaatttca?aaatgaaact?gtcaaatatt?ttctttttcg 60
tcttcatggc?gtttttcgca?gtggccagtg?tgtcggccgc?gccaaggtgg?aagccgttta 120
aaaaattgga?aaaagttgga?cgaaacatcc?gtgacggcat?catcaaggca?ggtccagcgg 180
tagctgtcat?cggacaagcc?acttctatag?ccagacctac?tggcaaatga?tagaaataat 240
aagatatatt?atctagtaac?ttgcatttat?aatagctcta?ttttccaagc?cacgccacac 300
ttatgattta?acccttttac?cggcatcggc?agtgacttaa?atattaatac?tatattttta 360
gcaaaaatat?tgaagttttt?ggtccgttaa?cgggttaaat?aatgtacaca?ttcaaaagaa 420
aatactcatt?catttataca?gtcattatgt?gagaaggcca?taattagtaa?acaaatagaa 480
<210> 2
<211> 65
<212> PRT
＜213〉artificial sequence
<400> 2
Met?Lys?Leu?Ser?Asn?Ile?Phe?Phe?Phe?Val?Phe?Met?Ala?Phe?Phe?Ala
1 5 10 15
Val?Ala?Ser?Val?Ser?Ala?Ala?Pro?Arg?Trp?Lys?Pro?Phe?Lys?Lys?Leu
20 25 30
Glu?Lys?Val?Gly?Arg?Asn?Ile?Arg?Asp?Gly?Ile?Ile?Lys?Ala?Gly?Pro
35 40 45
Ala?Val?Ala?Val?Ile?Gly?Gln?Ala?Thr?Ser?Ile?Ala?Arg?Pro?Thr?Gly
50 55 60
Lys
65
<210> 3
<211> 27
<212> DNA
＜213〉artificial sequence
<400> 3
gctaccgtca?ggacatcttc?aacgacc 27
<210> 4
<211> 28
<212> DNA
＜213〉artificial sequence
<400> 4
gcgccatgga?gccgtttaaa?aaattgga 28
<210> 5
<211> 32
<212> DNA
＜213〉artificial sequence
<400> 5
ggactcgagt?catttgccag?taggtctggc?ta 32
Claims (10)
1. a small cabbage moth cecropin gene is characterized in that this gene is the double-stranded linear DNA of 480bp, and its nucleotide sequence is shown in SEQ ID NO:1.
2. the albumen of the described small cabbage moth cecropin of claim 1 genes encoding is characterized in that this albumen has 65 amino acid, and its aminoacid sequence is shown in SEQ ID NO:2.
3. the cloning process of the described small cabbage moth cecropin of claim 1 gene is characterized in that comprising the steps:
(1) injects in the small cabbage moth 4 instar larvae bodies for the 0.8-1.0 intestinal bacteria with the OD value and induce, utilize the diamondback moth larvae of inducing 24 hours to extract total RNA, then with the synthetic cDNA of total RNA reverse transcription;
(2) according to the special primer that expressed sequence tag sequence (EST) design 3 ' terminal rapid amplifying reacts of cecropin, the forward primer sequence is shown in SEQ ID NO:3, and reverse primer is oligomerization dT acid Oligo d(T)
18
(3) by the chain polymerization enzyme reaction dna fragmentation that increases;
(4) with the amplified production purifying, get purified product and be cloned into the pMD18-T carrier, transform DH5 α cell, dull and stereotyped incubated overnight, the extracting plasmid is cut and is checked order through enzyme and identifies and obtain small cabbage moth cecropin gene.
4. the proteic preparation method of the described small cabbage moth cecropin of claim 2 genes encoding is characterized in that comprising the steps:
(1) according to the aminoacid sequence of small cabbage moth cecropin, design primer, primer sequence is shown in SEQ ID NO:4 ~ 5;
(2) cDNA of pcr amplification small cabbage moth cecropin;
(3) cDNA of clone small cabbage moth cecropin in carrier;
(4) expression plasmid is expressed in host cell;
(5) cultivate host cell, reclaim the small cabbage moth cecropin.
5. according to the proteic preparation method of the described small cabbage moth cecropin of claim 4 genes encoding, it is characterized in that host cell described in the step (4) is e. coli bl21 (DE3).
6. according to the proteic preparation method of the described small cabbage moth cecropin of claim 4 genes encoding, it is characterized in that recovery method is described in the step (5): host bacteria is inoculated in fresh LB enriched medium by 1: 50 volume ratio (contains 100 μ g/ml Amp
+) in, 37 ℃ of thermal agitation amplification culture are to OD
600=0.8 o'clock, adding final concentration was 0.4 mM IPTG, added the quality final concentration simultaneously and be 0.2% glucose, reduce the expression of background, at 25 ℃ of abduction delivering 9h, 4 ℃, 12, the centrifugal 2min of 000g, collect thalline, with under the thalline ice bath through the ultrasonic cell disruptor smudge cells, the centrifuging and taking supernatant is cut, is filtered through chromatography purification, enzyme, handle through lyophilize, obtain the small cabbage moth gloverin.
7. according to the proteic preparation method of the described small cabbage moth cecropin of claim 6 genes encoding, it is characterized in that described ultrasonication cell is the power with 300W, ultrasonic 4 ~ 5 circulations, each circulation is ultrasonic 4s, intermittently 4s repeats 90 times.
8. according to the proteic preparation method of the described small cabbage moth cecropin of claim 6 genes encoding, it is characterized in that described centrifugal be 4 ℃, 12, the centrifugal 30min of 000g.
9. according to the proteic preparation method of the described small cabbage moth cecropin of claim 6 genes encoding, it is characterized in that described chromatography purification, enzyme cut, filter and comprise the steps: through Ni
2+Metal affinity chromatography HisTrap HP purified fusion protein, the fusion rotein of purifying is cut through the enteropeptidase enzyme, enzyme is cut product and is carried out purifying with 5 ml HisTrap HP earlier, collect effluent liquid, effluent liquid carries out the ml HisTrap HP column purification second time 5 again, collect effluent liquid, be that the super rate device of 10.0 kDa carries out purifying to recombinant protein further with molecular weight cut-off, remove the above large protein of 10.0 kDa, be that the super rate device of 2.0 kDa carries out purifying to recombinant protein further with molecular weight cut-off, remove the following small protein of 2.0 kDa, remove filtered solution.
10. the application of the described small cabbage moth cecropin of claim 2 in food fresh keeping or feed anticorrosion.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105893921A CN102094024A (en) | 2010-12-15 | 2010-12-15 | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105893921A CN102094024A (en) | 2010-12-15 | 2010-12-15 | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102094024A true CN102094024A (en) | 2011-06-15 |
Family
ID=44127291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105893921A Pending CN102094024A (en) | 2010-12-15 | 2010-12-15 | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102094024A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102793667A (en) * | 2012-07-31 | 2012-11-28 | 中国人民解放军第三0二医院 | Plutella xylostella antimicrobial peptide liposome, as well as preparation method and application thereof |
| CN104098666A (en) * | 2014-07-18 | 2014-10-15 | 安徽新星生物工程有限公司 | Antibacterial peptide as well as applications thereof to preparation of anti-infective drugs, antitumor drugs, immunopotentiators and feed additives |
| CN104327188A (en) * | 2014-11-06 | 2015-02-04 | 南京林业大学 | Fall webworm SUMO-ABP-dHC-Cecropin A fusion protein and application thereof |
| WO2021012300A1 (en) * | 2019-07-19 | 2021-01-28 | 国际重型智能计算有限公司 | Fresh-keeping sterilization method for feeding insects |
-
2010
- 2010-12-15 CN CN2010105893921A patent/CN102094024A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102793667A (en) * | 2012-07-31 | 2012-11-28 | 中国人民解放军第三0二医院 | Plutella xylostella antimicrobial peptide liposome, as well as preparation method and application thereof |
| CN102793667B (en) * | 2012-07-31 | 2014-10-01 | 中国人民解放军第三〇二医院 | Plutella xylostella antimicrobial peptide liposome, as well as preparation method and application thereof |
| CN104098666A (en) * | 2014-07-18 | 2014-10-15 | 安徽新星生物工程有限公司 | Antibacterial peptide as well as applications thereof to preparation of anti-infective drugs, antitumor drugs, immunopotentiators and feed additives |
| CN104098666B (en) * | 2014-07-18 | 2017-03-15 | 安徽新星生物工程有限公司 | A kind of antibacterial peptide and its application in anti-infectives, antitumor drug, immunopotentiating agent and feed additive is prepared |
| CN104327188A (en) * | 2014-11-06 | 2015-02-04 | 南京林业大学 | Fall webworm SUMO-ABP-dHC-Cecropin A fusion protein and application thereof |
| CN104327188B (en) * | 2014-11-06 | 2017-08-04 | 南京林业大学 | A kind of fall webworms SUMO ABP dHC Cecropin A fusion proteins and its application |
| WO2021012300A1 (en) * | 2019-07-19 | 2021-01-28 | 国际重型智能计算有限公司 | Fresh-keeping sterilization method for feeding insects |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104497119A (en) | Natural antibacterial peptide and application thereof | |
| CN104017087A (en) | Pig-source antimicrobial peptide and preparation method thereof | |
| CN102094024A (en) | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application | |
| CN100420750C (en) | Chinese prawn C-type agglutinin gene and its coded C-type agglutinin peptide and uses | |
| CN101418039B (en) | Novel antibacterial peptide and preparation method and use thereof | |
| CN102337288A (en) | Gene engineering preparation method of tilapia hepcidin | |
| CN101886081A (en) | Procambarus clarkia chitin peptide gene and encoded chitin peptide and application thereof | |
| CN102586262B (en) | Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene | |
| CN101942473B (en) | Procambrus clarkii type i lysozyme gene, lysozyme coded by lysozyme gene and application of lysozyme | |
| CN110669114B (en) | Lanthionine precursor peptide amyA6, and preparation method and application thereof | |
| CN102094023A (en) | Plutella xylostella gloverin gene and encoded protein, corresponding expression system and application | |
| CN101525617A (en) | Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression | |
| CN107266539A (en) | A kind of bacillus licheniformis W10 antibacterial proteins and application | |
| CN106479987B (en) | Preparation method and application of soluble housefly MdpropO1 recombinant protein | |
| CN102260325B (en) | Antibacterial peptide NX-16, and preparation method and application thereof | |
| CN104987367A (en) | Preparation method of artificial antibacterial peptide PR39-R1T and application thereof | |
| CN105693866A (en) | Fusion antibacterial peptide and application thereof | |
| CN104910266A (en) | Amolops wuyiensis antibacterial peptide as well as encoding gene and application thereof | |
| CN102276729A (en) | Antibacterial peptide bovine lactoferricin-thanatin (LF-TH) and Escherichia coli recombination preparation method thereof | |
| CN103484467B (en) | Diamondback moth cecropin 3, preparation method and application thereof | |
| CN114752610A (en) | Application of diaphorina citri ubiquitin-conjugating enzyme E2J2 gene in prevention and control of citrus greening disease | |
| CN101565703B (en) | Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof | |
| CN105255932B (en) | A kind of conotoxin variant GMVIIA and its preparation method and application | |
| CN103484487B (en) | A kind of small cabbage moth N,O-Diacetylmuramidase II and preparation method thereof and application | |
| CN114276413A (en) | Preparation method of artificial antibacterial peptide G3 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20110615 |