CN103255151B - Coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and application of coded sequence - Google Patents
Coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and application of coded sequence Download PDFInfo
- Publication number
- CN103255151B CN103255151B CN201310164451.4A CN201310164451A CN103255151B CN 103255151 B CN103255151 B CN 103255151B CN 201310164451 A CN201310164451 A CN 201310164451A CN 103255151 B CN103255151 B CN 103255151B
- Authority
- CN
- China
- Prior art keywords
- cvn
- mutant
- expression
- nta
- pet
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and an application of the coded sequence. The coded sequence is shown in SEQ ID NO.1 and used for the CVN mutant. The CVN mutant with high expression quantity and high activity is prepared by the following steps of: cloning a coded nucleotide sequence onto an expression vector to obtain a recombinant vector; and converting the recombinant vector into a host cell for expression and purification. The soluble expression of CVN in escherichia coli is remarkably promoted by the coded sequence, and the soluble expression quantity of the CVN mutant in the escherichia coli is remarkably higher than that of wild CVN. In addition, the extracorporal anti-influenza virus activity of the CVN mutant obtained by using the coded sequence is better than that of the wild CVN, which proves that not only can the expression quantity of the CVN be increased, but also the soluble expression of the CVN can be remarkably promoted, and the CVN with better biological activity can be obtained after the coded nucleotide sequence of the protein is rationally designed and optimized by using a translation suspension theory.
Description
Technical field
The invention belongs to biomedicine field, be specifically related to encoding sequence and the application thereof of a kind of expression amount height and active strong CVN mutant.
Background technology
Cyanovirin-N (cyanovirin-N, CVN) be a kind of antiviral protein that Boyd etc. finds for 1997 in blue-green algae, energy is special, be combined in conjunction with the mannooligo saccharide on virus surface capsid protein gp120 in high affinity ground, the receptors bind that stops virus and host cell surface, and the propagation of prevention virus between cells infected and normal cell, this feature makes it can not be subject to the interference of virus variation, is difficult for causing resistance.CVN albumen lower concentration (0.1～36.8nM) can effectively suppress HIV infection immunity cell, high density (45～400nM) to normal cell without direct toxic side effect.
Except HIV, CVN infected by influenza, simplexvirus and parainfluenza virus etc. have antagonistic action, are a kind of antiviral drug candidates that acts on wide spectrum, has efficiently, very much using value, receive much concern.But the extensive preparation of CVN is the Pinch technology that limits its application always.Report CVN expresses with inclusion body form at present, be subject to the many factors restriction (Mori such as expression amount is low, product heterogeneity, mistake modification, T., Gustafson, K.R., Recombinant Production of Cyanovirin-N, a Potent Human Immunodeficiency Virus-Inactivating Protein Derived from a Cultured Cyanobacterium.Protein Expression and Purification, 1998,151-158); Also someone attempts expressing CVN in transgenic plant, but do not set up enforceable purifying process (Sexton, A., Drake, P.M., Mahmood, Transgenic plant production of Cyanovirin-N, an HIV microbicide.2006, Vol.20pp.356-358).
Tradition biochemical theoretical " An Fensen principle " is thought, the folding information of protein is by its aminoacid sequence unique decision (Taniuchi H. under certain environment, D.R.Davies, and C.B.Anfinsen, A comparison of the x-ray diffraction patterns of crystals of reconstituted nuclease-T and of native staphylococcal nuclease.J Biol Chem, 1972.247 (10): p.3362-4).But the inventor's research points out, this traditional theory is wrong.Although different DNA can translate into same amino acid, proteinogenous speed (translation speed) is also non-constant, can be slower on some section, this phenomenon is called translation and suspends (translational pausing or translational attenuation) translation time-out site and protein folding height correlation, if it is incorrect that translation suspends site, this slow place is fast, or this fast place is slow, all will cause protein Misfolding to be assembled, cannot obtain the soluble proteins of function.That is to say, protein conformation is not only determined by amino acid whose sequence, also by nucleotide sequence, is determined.（Zhang?G.,M.Hubalewska,and?Z.Ignatova,Transient?ribosomal?attenuation?coordinates?protein?synthesis?and?co-translational?folding.Nat?Struct?Mol?Biol,2009.16(3):p.274-80.；Zhang?G.and?Z.Ignatova,Folding?at?the?birth?of?the?nascent?chain:coordinating?translation?with?co-translational?folding.Curr?Opin?Struct?Biol,2011.21(1):p.25-31.）。This theory is applicable to most protein (Zhang in protein groups, G.and Z.Ignatova, Generic algorithm to predict the speed of translational elongation:implications for protein biogenesis.PLoS One, 2009.4 (4): p.e5036.; Fedyunin, I., et al., tRNA concentration fine tunes protein solubility.FEBS Lett, 2012.586 (19): p.3336-40.).
Summary of the invention
Primary and foremost purpose of the present invention is that the shortcoming that overcomes prior art, with not enough, provides the encoding sequence of a kind of expression amount height and active strong CVN mutant.
Another object of the present invention is to provide the CVN obtaining by above-mentioned encoding sequence mutant.
A further object of the present invention is that the expression amount that provides described is high and the application of the CVN mutant that activity is strong.
Object of the present invention is achieved through the following technical solutions: the encoding sequence of a kind of expression amount height and active strong CVN mutant, as follows:
CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATAGACGGTACACTAAAATACGAA。
The CVN mutant that expression amount is high and activity is strong, is prepared by above-mentioned encoding sequence;
High and the active strong CVN mutant of described expression amount, prepares: above-mentioned encoding sequence is cloned on expression vector, obtains recombinant vectors by the following method; Recombinant vectors is transformed in host cell and is expressed, and purifying, obtains the CVN mutant that expression amount is high and activity is strong;
Described expression vector is preferably pET-28b;
Described host cell is preferably intestinal bacteria (Escherichia coli) BL21(DE3);
Described expression amount is high and the application of the encoding sequence of the CVN mutant that activity is strong in preparation CVN mutant, comprises following steps:
(1) design following primer:
F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’；
R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’；
F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；
R1-mutant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’；
(2) pcr amplification for the first time: take pET-3c-SUMO-CVN plasmid as template, take F-sumo/R-CVN as primer carries out pcr amplification, use NdeI and SalI double digestion after the PCR product purification obtaining; Carrier pET-28b by the PCR product after double digestion with process NdeI and SalI double digestion, connects; Connect product and transform intestinal bacteria (Escherichia coli) DH5 α competent cell, screening, obtains recombinant vectors pET-28b-CVN;
(3) pcr amplification for the second time: take pET-28b-CVN as pcr amplification template,
F1-mutant/R1-mutant is that primer carries out pcr amplification, the PCR product purification obtaining is cut through DpnI enzyme, the enzyme of cycle pure Kit test kit purifying is cut product and is directly transformed bacillus coli DH 5 alpha competent cell, and screening, obtains recombinant vectors pET-28b-CVN-M1;
(4) abduction delivering: recombinant vectors pET-28b-CVN-M1 is proceeded to e. coli bl21 (DE3), obtain expression strain; Then use the LB substratum that contains kantlex to cultivate under 37 ℃, the condition of 180～200rpm this expression strain, at OD
600=0.8 o'clock, add IPTG, the final concentration of IPTG is 1mM, after 37 ℃ of abduction delivering 4h, collects thalline;
(5) purifying: by bacterial sediment by volume 1:10 ratio Eddy diffusion after NTA-10 damping fluid, thalline is carried out to fragmentation, centrifugal, collect supernatant; In supernatant loading Ni-NTA affinity column, first use NTA-10 damping fluid to wash back baseline, then wash foreign protein with NTA-40 damping fluid, finally use NTA-200 buffer solution elution, obtain target protein CVN mutant; Wherein, NTA-10 damping fluid consist of 20mmol/LTris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles, NTA-40 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles, NTA-200 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles;
PCR condition optimization described in step (2) is 94 ℃ of denaturation 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min;
PCR condition optimization described in step (3) is 94 ℃ of denaturation 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min;
The final concentration of kantlex described in step (4) in LB substratum is preferably 50mg/L;
Centrifugal condition optimization described in step (5) is 4 ℃, 25000g, 30min;
High and the active strong CVN mutant of described expression amount prevents and/or treats the application in antiviral in preparation;
Described virus refers to influenza virus or virus of AIDS.
Novelty of the present invention is according to the relation between protein domain and translation time-out, utilize translation to suspend theory the nucleotide sequence of CVN is carried out to reasonably optimizing and design, in the structural domain of CVN, introduce translation and suspend site, built the mutant of CVN, promote the solubility expression of CVN in intestinal bacteria, be finally purified into recombined blue algae antiviral protein; And experimental results show that by resisiting influenza virus prepared recombinant protein has good antiviral activity.
The present invention has following advantage and effect with respect to prior art:
(1) nucleotide sequence of coding CVN mutant provided by the invention has improved the expression level of CVN in intestinal bacteria; Particularly promote the solubility expression of CVN in intestinal bacteria, CVN mutant amount of solubility expression in intestinal bacteria is significantly higher than CVN.
(2) the external anti-influenza virus activity of CVN mutant provided by the invention is better than CVN.Illustrate by translation and suspend theory to protein core nucleotide sequence design and rational and optimization, not only can improve the expression amount of CVN, what is more important significantly promotes CVN solubility expression, obtains the better CVN albumen of biological activity.
Accompanying drawing explanation
Fig. 1 is that CVN-M1 translation suspends graphic representation; The 1st, blue line, the 2nd, red line.
Fig. 2 is the solubility expression analysis chart of CVN and mutant thereof; Wherein, figure (a), for SDS-PAGE figure, is CVN target protein band shown in arrow; Figure (b) is Western blot figure, only detects CVN; Swimming lane M is albumen Marker, and unit is KDa; Swimming lane 1 is the CVN-BL21 of abduction delivering not; Swimming lane 2 is CVN-BL21 of abduction delivering; Swimming lane 3 is CVN-M1-BL21 of abduction delivering.
Fig. 3 is the SDS-PAGE figure after CVN and mutant protein purifying thereof, and swimming lane M is albumen Marker, and unit is KDa, is CVN target protein band shown in arrow.
Fig. 4 is the active result figure of the anti-human influenza virus A/HK/8/68 of CVN and mutant thereof (H3N2), and ordinate zou is for suppressing viral per-cent, and the higher explanation of histogram is better to viral inhibition.
Embodiment
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited to this.
The main raw that the embodiment of the present invention relates to is as follows: Host Strains e. coli bl21 (DE3) (Merck), plasmid pET-28b(Merck), this laboratory of pET3c-SUMO-CVN(builds, in the patent No., be that ZL200810198926.0, name are called " preparation method of recombined blue algae antiviral protein and application " open detailed preparation process, the simplest method is directly by order-checking company, to synthesize SUMO-CVN fusion sequence at present, is connected into pET3c carrier and can obtains pET3c-SUMO-CVN); Pfu mix enzyme, restriction enzyme Nde I, SalI, DpnI, dye albumen Marker purchased from Fermentas company in advance, primer is synthesized by Hua Da Gene Tech. Company Limited; Ni Sepharose
tM6Fast Flow is purchased from GE company, and tetramethyl-azo azoles salt (MTT) is purchased from U.S. SIGMA company.Other reagent is analytical reagent.NTA-10 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles), NTA-40 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles), NTA-200 damping fluid (20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles).
Codon optimized and the expression vector establishment of embodiment 1CVN
Utilize translation to suspend theoretical, the nucleotide sequence of coding CVN albumen is optimized, appropriate design translation suspends site, utilizes sudden change round pcr to carry out same sense mutation to the nucleotide sequence of CVN.
The coding nucleotide sequence of CVN albumen is as follows:
CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTGGACGACCACATCGCTAACATAGACGGTACACTAAAATACGAA。
(1) by translation, suspend the nucleotide sequence of Design Theory coding CVN mutant, in the situation that not changing CVN aminoacid sequence, by the codon (ATC faster of translation speed in last 20 codons of CVN, ACC, CTG) replace to the slower codon (ATA of translation speed, ACA, CTA), to manufacture translation time-out site, (RiboTempo computed in software is determined, http://bioinformatics.jnu.edu.cn/software/ribotempo), the translation that mutant obtains through RiboTempo computed in software suspends curve respectively as shown in Figure 1, translation suspends curve red line, and in predetermined region, (last 20 codons) have formed translation time-out site (red line is lower than blue line), meet the requirements.The nucleotide sequence of the coding CVN mutant that design obtains is as follows:
Mutant 1(CVN-M1) coding nucleotide sequence:
CTTGGTAAATTCTCCCAGACCTGCTACAACTCCGCTATCCAGGGTTCTGTTCTGACCTCTACCTGCGAACGTACCAACGGTGGTTACAACACCTCCTCTATCGACCTGAACTCCGTTATCGAAAACGTTGACGGTTCTCTGAAATGGCAGCCGTCTAACTTCATCGAAACCTGCCGTAACACCCAGCTGGCTGGTTCCTCTGAACTGGCTGCTGAATGCAAAACCCGTGCTCAGCAGTTCGTTTCTACCAAAATCAACCTAGACGACCATATAGCTAACATAGACGGTACACTAAAATACGAA。
Be directed to mutant 1(CVN-M1) coding nucleotide sequence, the sudden change PCR primer of design is as follows:
F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；
R1-
mut
ant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’。
(2) build the expression plasmid of pET-28b-CVN
Take pET-3c-SUMO-CVN plasmid as pcr amplification template, and F-sumo/R-CVN is that primer carries out pcr amplification, and amplification system is: each 2 μ L of primer (10 μ mol/L), pfu mix25 μ L, template 1 μ L, sterilizing ultrapure water 20 μ L; Amplification condition is: 94 ℃ of denaturation 3min of reaction mixture; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min.
F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’
R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’。
Use DNA purification kit (OMEGA) to reclaim the PCR product obtaining, the PCR product and the plasmid pET-28b that obtain after purifying use respectively NdeI and SalI double digestion (10 * Fastdigest buffer, 37 ℃ of water-bath 30min), enzyme is cut product and is carried out mass volume ratio 1% agarose gel electrophoresis, reclaim enzyme and cut product, with T4DNA ligase enzyme (by specification proposed standard system preparation reaction system), 16 ℃ of connections are spent the night, these two enzymes are cut to product and couple together, be built into recombinant plasmid pET-28b-CVN.Recombinant plasmid transformed bacillus coli DH 5 alpha competent cell (Merck), coat the LB that contains 50 μ g/mL kantlex dull and stereotyped, 37 ℃ of overnight incubation, the positive colony that screening is obtained send the order-checking of Hua Da Gene science limited-liability company, obtains meeting the CVN clone pET-28b-CVN of desired design.
(3) express the structure of the recombinant vectors of CVN mutant
The acquisition of goal gene: take pET-28b-CVN as pcr amplification template, F1-mutant/R1-mutant is that primer carries out pcr amplification, and amplification system is: each 2 μ L of primer, pfu mix25 μ L, template 1 μ L, sterilizing ultrapure water 19 μ L; Amplification condition is: 94 ℃ of denaturation 3min of reaction mixture; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min.
Use DNA purification kit (OMEGA) to reclaim the PCR product obtaining, the PCR product obtaining after purifying is cut through DpnI enzyme, the enzyme of cycle pure Kit test kit (OMEGA) purifying is cut product and is directly transformed bacillus coli DH 5 alpha competent cell (Merck), the LB that coating contains 50 μ g/mL kantlex is dull and stereotyped, the positive colony that screening is obtained send the order-checking of Hua Da Gene science limited-liability company, the clone who contains coding CVN mutant 1 nucleotide sequence who obtains meeting desired design is pET-28b-CVN-M1.
Embodiment 2
(1) preparation of expression strain:
1. the preparation of e. coli bl21 (DE3) competent cell: preparation process refers to the < < molecular cloning experiment guide > > third edition; [U.S.] J. Sha nurse Brooker work, Huang Peitang translates.
2. expression vector pET-28b-CVN and pET-28b-CVN-M1 are converted into respectively to e. coli bl21 (DE3) competent cell: conversion process refers to the < < molecular cloning experiment guide > > third edition; [U.S.] J. Sha nurse Brooker work, Huang Peitang translates.
(2) CVN and mutation induction thereof are expressed and soluble analysis
1. expression strain CVN-BL21 step (1) being obtained and CVN-M1-BL21 are inoculated into respectively 20mL containing in the LB substratum of 50 μ g/mL kantlex content, and 37 ℃, 180rpm cultivation, work as OD
600=0.8 o'clock, add IPTG, final concentration is 1mM, after 37 ℃ of abduction delivering 4h, measures respectively OD
600, guarantee volume * OD when CVN and mutant thereof are received bacterium
600value be identical, the centrifugal 10min of 5000g, 4 ℃ collect thalline.Thalline 20mmol/L Tris-HCl(pH8.0,0.15mol/L NaCl) damping fluid is resuspended, high pressure (1000bar) homogeneous smudge cells, 18000g, 4 ℃ of centrifugal 30min, upper cleer and peaceful precipitation keeps sample respectively and treats that follow-up SDS-PAGE electrophoresis (5% concentrated glue, 12% separation gel) and Western blot analyze.
BCA test kit (green the skies Bioisystech Co., Ltd) is measured total protein content in CVN and the centrifugal supernatant of mutant bacterial cell disruption thereof, guarantee that albumen applied sample amount is identical, western blot(experimental procedure is shown in < < fine works molecular biology experiment guide > > the 5th edition; (U.S.) Ao Sibai chief editor, Jin Youxin translates) analyze the content of CVN albumen in supernatant.Result shows (Fig. 2), and the amount of CVN mutant solubility expression is significantly higher than CVN.
(3) CVN and mutant shake flask fermentation and purifying
Expression strain CVN-BL21, the CVN-M1-BL21 that step (1) is obtained is inoculated into respectively 1L, kantlex content is in the LB substratum of 50 μ g/mL, by aforesaid expression condition, carries out shake flask fermentation induction.4 ℃, the centrifugal collection thalline of 6000 * g, 10min, then by bacterial sediment by volume 1:10 ratio Eddy diffusion in NTA-10 damping fluid, high pressure (1000bar) homogeneous smudge cells.4 ℃, the centrifugal collection supernatant of 25000 * g, 30min.
In the Ni-NTA affinity column that supernatant loading to column volume is 20mL, flow velocity 0.6mL/min, NTA-10 damping fluid is washed back baseline, and flow velocity is 1mL/min, and NTA-40 damping fluid is washed foreign protein, NTA-200 buffer solution elution target protein; CVN albumen after purifying is concentrated through the super filter tube of the de-imidazoles of Sephadex G-25 molecular sieve and 3KDa, the purity of the CVN albumen of SDS-PAGE electrophoresis purification Identification.
According to the relation between CVN protein domain and translation time-out, in CVN structural domain, introduce the CVN mutant that translation suspends, under 37 ℃ of conditions, after abduction delivering, from bacterial cell disruption, centrifugal supernatant, can detect CVN mutant protein (Fig. 2 b) with Western blot.Without the native sequences CVN optimizing, because the amount of solubility expression is extremely low, the amount of purified acquisition CVN albumen is extremely low, to such an extent as to can not detect with coomassie brilliant blue staining; And optimize CVN mutant later (being designated CVN-M1) in Fig. 3, although do not have aminoacid sequence to change, can be purified into a large amount of CVN albumen (Fig. 3).This explanation suspends by rationally introduce translation in CVN structural domain the translation speed that site reduces CVN, promotes that the solubility expression of CVN is practicable.
Embodiment 3
CVN resisiting influenza virus A/HK/8/68 (H3N2) activity research
Dog renal epithelial cell mdck cell (U.S. ATCC) is after the pancreatin solution digestion of mass volume ratio 0.25%, with 2.5 * 10
5cells/well adds (MEM substratum in 96 porocyte culture plates, the calf serum that contains volume percent 10%), after growing up to individual layer, abandons in cell growth media, with maintenance medium (MEM substratum, not containing calf serum) by medicine CVN albumen, (preserve in laboratory respectively, can be CN101638435 by publication number, name is called " a kind of blue-green algal virus protein N mutant, its modified derivative and application " disclosed step is prepared) and the CVN mutant protein that obtains of embodiment 2 purifying be diluted to 6 series concentration (100, 50, 25, 12.5, 6.25, 3.125 μ M), each extent of dilution is established 3 multiple holes, establish normal cell control group simultaneously, positive drug (ribavirin) control group, 37 ℃, 5%CO
2cultivate 48h in incubator, every day observation of cell variation, mtt assay is surveyed each porocyte OD value, calculating median toxic concentration TC50.
Within the scope of non-toxic concn, (TC50>50 μ M) becomes different concns by drug dilution, each the 50 μ L of thing diluent that get it filled, human influenza strain A/HK/8/68 (H3N2) (ATCC company, Influenza A virus (H3N2), ATCC
vR-1679
tM)) viral dilution liquid (100TCID50) 50 μ L be directly added on individual layer mdck cell after mixing, 3 multiple holes of each concentration, establish positive drug group, virus control group, negative control group.Be placed in 37 ℃, 5%CO
2, cultivate after 48h, add the MTT solution that 10 μ L concentration are 5mg/mL, continue to cultivate 4h, careful suction abandoned supernatant liquor, and every hole adds 100 μ L DMSO lucifuge shaking tables and places 15min, and microplate reader (Bio-Rad550) reads OD value, measures wavelength 490nm, reference wavelength 630nm.
Calculate the inhibiting rate %=(OD medicine group-OD virus control group under each drug level)/(OD cell control group-OD virus control group).
The active result of CVN and mutant resisiting influenza virus H3N2 thereof (Fig. 4) shows: CVN and mutant thereof have significant restraining effect to human influenza strain A/HK/8/68 (H3N2), and CVN mutant is better than CVN to the restraining effect of human influenza strain A/HK/8/68 (H3N2), the relation that this explanation utilizes protein domain and translation to suspend, in protein domain, rationally introducing translation suspends, and utilizing translation to suspend theory redesigns and optimizes CVN nucleotide sequence, not only can promote the solubility expression of CVN, and can obtain active better CVN albumen.
In sum, the CVN mutant that the present invention builds, express successfully, and the amount of solubility expression is significantly higher than CVN in e. coli bl21 (DE3); Overcome CVN and easily formed the shortcomings such as inclusion body, purification difficult.The active result of the anti-human influenza strain of CVN and mutant thereof A/HK/8/68 (H3N2) shows: the activity of CVN mutant is better than CVN.
Above-described embodiment is preferably embodiment of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and principle, substitutes, combination, simplify; all should be equivalent substitute mode, within being included in protection scope of the present invention.
Claims (8)
1. an encoding sequence for expression amount height and active strong CVN mutant, is characterized in that: as shown in SEQ ID NO.1.
2. the CVN mutant that expression amount is high and activity is strong, is characterized in that: by encoding sequence claimed in claim 1, prepared.
3. the CVN mutant that expression amount according to claim 2 is high and activity is strong, is characterized in that preparing by the following method: encoding sequence claimed in claim 1 is cloned on expression vector, obtains recombinant vectors; Recombinant vectors is transformed in host cell and is expressed, and purifying, obtains the CVN mutant that expression amount is high and activity is strong.
4. the CVN mutant that expression amount according to claim 3 is high and activity is strong, is characterized in that: described expression vector is pET-28b; Described host cell is intestinal bacteria (Escherichia coli) BL21 (DE3).
5. the application of the encoding sequence of expression amount height claimed in claim 1 and active strong CVN mutant in preparation CVN mutant, is characterized in that comprising following steps:
(1) design following primer:
F-sumo：5’-GGAATTCCATATGGGCATGTCGGACTCAGAAGTC-3’；
R-CVN：5’-TTCCGCGGCCGCTATGGCCGACGTCGACTTCGTATTTCAGGGTACCGTC-3’；
F1-mutant：5’-GACGACCACATCGCTAACATAGACGGTACACTAAAATACGAATGATGAGTCGAC-3’；
R1-mutant：5’-GTCGACTCATCATTCGTATTTTAGTGTACCGTCTATGTTAGCGATGTGGTCGTC-3’；
(2) pcr amplification for the first time: take pET-3c-SUMO-CVN plasmid as template, take F-sumo/R-CVN as primer carries out pcr amplification, use NdeI and SalI double digestion after the PCR product purification obtaining; Carrier pET-28b by the PCR product after double digestion with process NdeI and SalI double digestion, connects; Connect product and transform intestinal bacteria (Escherichia coli) DH5 α competent cell, screening, obtains recombinant vectors pET-28b-CVN;
(3) pcr amplification for the second time: take pET-28b-CVN as pcr amplification template, F1-mutant/R1-mutant is that primer carries out pcr amplification, the PCR product purification obtaining is cut through DpnI enzyme, the enzyme of cycle pure Kit test kit purifying is cut product and is directly transformed bacillus coli DH 5 alpha competent cell, screening, obtains recombinant vectors pET-28b-CVN-M1;
(4) abduction delivering: recombinant vectors pET-28b-CVN-M1 is proceeded to e. coli bl21 (DE3), obtain expression strain; Then use the LB substratum that contains kantlex to cultivate under 37 ℃, the condition of 180～200rpm this expression strain, at OD
600=0.8 o'clock, add IPTG, the final concentration of IPTG is 1mM, after 37 ℃ of abduction delivering 4h, collects thalline;
(5) purifying: by bacterial sediment by volume 1:10 ratio Eddy diffusion after NTA-10 damping fluid, thalline is carried out to fragmentation, centrifugal, collect supernatant; In supernatant loading Ni-NTA affinity column, first use NTA-10 damping fluid to wash back baseline, then wash foreign protein with NTA-40 damping fluid, finally use NTA-200 buffer solution elution, obtain target protein CVN mutant; Wherein, NTA-10 damping fluid consist of 20mmol/LTris-HCl, pH8.0+0.15mol/L NaCl+10mmol/L imidazoles, NTA-40 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+40mmol/L imidazoles, NTA-200 damping fluid consist of 20mmol/L Tris-HCl, pH8.0+0.15mol/L NaCl+200mmol/L imidazoles.
6. the application of the encoding sequence of expression amount height according to claim 5 and active strong CVN mutant in preparation CVN mutant, is characterized in that: the PCR condition described in step (2) is 94 ℃ of denaturation 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 2min, carry out 28 circulations; 68 ℃ are extended 5min;
PCR condition described in step (3) is 94 ℃ of denaturation 3min; 94 sex change 1min, be annealed to 55 ℃ and keep 1min, 68 ℃ to extend 12min, carry out 18 circulations; 68 ℃ are extended 5min;
The final concentration of the kantlex described in step (4) is 50mg/L;
Centrifugal condition described in step (5) is 4 ℃, 25000g, 30min.
7. the high and active strong CVN mutant of expression amount claimed in claim 2 prevents and/or treats the application in antiviral in preparation.
8. the high and active strong CVN mutant of expression amount according to claim 7 prevents and/or treats the application in antiviral in preparation, it is characterized in that: described virus is influenza virus or virus of AIDS.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310164451.4A CN103255151B (en) | 2013-05-07 | 2013-05-07 | Coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and application of coded sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310164451.4A CN103255151B (en) | 2013-05-07 | 2013-05-07 | Coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and application of coded sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103255151A CN103255151A (en) | 2013-08-21 |
| CN103255151B true CN103255151B (en) | 2014-12-03 |
Family
ID=48959364
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310164451.4A Active CN103255151B (en) | 2013-05-07 | 2013-05-07 | Coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and application of coded sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103255151B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103266105B (en) * | 2013-05-07 | 2015-02-11 | 暨南大学 | Method for improving protein soluble expression through rational translation pause sequence redesigning |
| CN110894242B (en) * | 2019-11-29 | 2021-05-04 | 湖北大学 | Recombinant CL7-CVN protein and preparation method and application thereof |
| CN111454350B (en) * | 2020-06-01 | 2020-12-29 | 广东丸美生物技术股份有限公司 | Recombinant fibronectin mutant and application thereof |
-
2013
- 2013-05-07 CN CN201310164451.4A patent/CN103255151B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| Cyanovirin-N inhibits hepatitis C virus entry by binding to envelope protein glycans;Helle F等;《 J Biol Chem》;20061231;第281卷(第35期);第25177-25183页 * |
| Helle F等.Cyanovirin-N inhibits hepatitis C virus entry by binding to envelope protein glycans.《 J Biol Chem》.2006,第281卷(第35期),第25177-25183页. * |
| 杨辉等.蓝藻抗病毒蛋白-N 衍生物的克隆、发酵与纯化.《生物技术通报》.2012,(第5期),第116-120页. * |
| 蓝藻抗病毒蛋白-N 基因的克隆、表达、纯化及活性鉴定;陈伟等;《生物工程学报》;20100425;第26卷(第4期);第538-544页 * |
| 蓝藻抗病毒蛋白-N 衍生物的克隆、发酵与纯化;杨辉等;《生物技术通报》;20121231(第5期);第116-120页 * |
| 陈伟等.蓝藻抗病毒蛋白-N 基因的克隆、表达、纯化及活性鉴定.《生物工程学报》.2010,第26卷(第4期),第538-544页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103255151A (en) | 2013-08-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103255151B (en) | Coded sequence CVN (Cyanovirin-N) mutant with high expression quantity and high activity and application of coded sequence | |
| MX2009008118A (en) | Papillomavirus e2 polypeptide used for vaccination. | |
| KR20140031912A (en) | Canine influenza recombinant virus, preparation method therefor and application thereof | |
| CN101879312B (en) | Broad spectrum type influenza vaccine and preparation method thereof | |
| CN102397559B (en) | Broad spectrum type influenza vaccine and preparation method thereof | |
| CN103266105B (en) | Method for improving protein soluble expression through rational translation pause sequence redesigning | |
| CN102633867A (en) | Antigenically-changed enterotoxin C2 mutant, coding gene thereof, preparation thereof and application thereof | |
| CN102018956A (en) | F-gene type attenuated live mumps vaccine and preparation method and application thereof | |
| CN103966191B (en) | The tryptic preparation method of a kind of recombinant bovine source property | |
| CN108531468A (en) | Encode gene, Yolk antibody and the application of recombinant helicobacterpylori serine protease | |
| RU2010125695A (en) | GENES ENCODING THE MAIN CAPSIDE PROTEIN L1 OF HUMAN PAPILLOMA VIRUS AND THEIR APPLICATION | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN104673764B (en) | A kind of thioether monooxygenase PMO 3546 and its application | |
| CN101457219A (en) | Method for preparing enterotoxin C2 protein | |
| CN102898511A (en) | Purification method in preparation of methicillin staphylococcus aureus-resistant recombinant genetic engineering vaccine candidate antigen I12C | |
| CN103570835B (en) | Streptococcus aureus ITC fusion rotein and preparation method and application | |
| CN110357970A (en) | A kind of hEGF's fusion protein and its nucleic acid molecules, a kind of hEGF's preparation method for being easy to purify | |
| CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
| CN101560248A (en) | Attenuated enterotoxin C2 superantigen mutant protein, preparation method and application thereof | |
| CN105504052B (en) | The scFv antibody of infections chicken cloacal bursa virus resisting is treating or preventing the application in Bursal Disease preparation | |
| CN104829691B (en) | Smoothing wrinkle small peptide and preparation method thereof | |
| CN1724663A (en) | Method of preparing natural human thymosin a1 using series expression mode | |
| CN103740632B (en) | One strain recombination bacillus coli and the application in the N-glucoprotein vaccine of the anti-O157:H7 of preparation thereof | |
| CN102212120A (en) | Salmonella paratyphi A PagC subunit vaccine and preparation method thereof | |
| CN113501866A (en) | Duck tembusu virus inhibitor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |