CN103626878A - Newcastle disease virus F protein and enterotoxin LTB fusion protein and application thereof - Google Patents
Newcastle disease virus F protein and enterotoxin LTB fusion protein and application thereof Download PDFInfo
- Publication number
- CN103626878A CN103626878A CN201310652273.XA CN201310652273A CN103626878A CN 103626878 A CN103626878 A CN 103626878A CN 201310652273 A CN201310652273 A CN 201310652273A CN 103626878 A CN103626878 A CN 103626878A
- Authority
- CN
- China
- Prior art keywords
- newcastle disease
- disease virus
- protein
- fusion protein
- parts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to newcastle disease virus F protein and enterotoxin LTB fusion protein and the application thereof. The amino acid sequence of the fusion protein is SEQ ID NO:1. The fusion protein provided by the invention is used for preparing newcastle disease virus genetic engineering subunit vaccines. According to the invention, partial sequences of F protein of newcastle disease virus genotype VIId strains are connected with the enterotoxin LTB protein with the immunological enhancement through the Lingker sequence to obtain the fusion protein, and the fusion protein is further prepared to obtain the vaccine. The animal experiment results show that the prepared genetic engineering subunit vaccine is excellent in immunogenicity, and the immune response of chickens can be efficiently caused.
Description
Technical field
The invention belongs to biological technical field, be specifically related to fusion rotein and the application of a kind of newcastle disease virus F albumen and enterotoxin LTB.
Background technology
Newcastle disease (Newcastle disease, NDV) be one of bird transmissible disease the most serious in world today ，Bei OIE (OIE) classify as must report transmissible disease.NDV is the negative burst RNA viruses of strand, 15586 Nucleotide of whole genome total length, and molecular weight is about 51 ~ 57 KD.The NDV 6 kinds of structural protein of encoding, respectively nucleocapsid protein (Nucleocapsid protein, NP), phosphorprotein (Phosphate protein, P), stromatin (Matrix, M), RNA polymerase (the Large protein of fusion rotein (Fusionprotein, F), hemagglutinin neuraminidase (Haemagglutinin Neuraminidase Protein, HN) and high molecular, L), it is sequentially 3 '-NP-P-M-F-HN-L-5 '.Along with present cultivation is intensive, the development of mass-producing; Avian pneumo-encephalitis virus variation is very fast; popular strain be take newcastle disease genotype VIId as main clinically in recent years; the vaccine strains such as existing Lasota cannot provide effective protection to clinical wild poison; the case of immuning failure happens occasionally, and is badly in need of Development of New Generation vaccine.F albumen is to form one of pathogenic molecular basis of Avian pneumo-encephalitis virus (NDV), is the main protection antigen of Avian pneumo-encephalitis virus, is often used as the candidate gene of newcastle disease virus gene engineered vaccine.Albumen being formed by 553 amino acid of F protein gene coding, comprise signal sequence (SS), be positioned near hydrophobic membrane spaning domain (TM) and the tenuigenin structural domain (CT) being comprised of 25 ~ 30 amino acid of carboxyl terminal, its 3 main antigenic determinants are positioned at 72,161,343.The bird pox virus live vector seedling commercialization of nineteen ninety-five USDA official approval recombinant Newcastle disease virus F gene, this live recombined vaccines immune effect is suitable with conventional ND vaccine, and primary immune response can be protected the attack of the strong poison of chicken opposing NDV.Excessive because of Avian pneumo-encephalitis virus F albumen, in protokaryon, be difficult to express, and the cost of eukaryotic expression system is too high, for the genetic engineering subunit vaccine of Avian pneumo-encephalitis virus F albumen development, does not slowly realize commercialization.Therefore, Avian pneumo-encephalitis virus F protein structure is predicted, screening Avian pneumo-encephalitis virus F albumen Main Antigenic is expressed a focus that becomes the exploitation of Avian pneumo-encephalitis virus viral genetic engineering subunit vaccine.Wang Jie etc. (2013) adopt intestinal bacteria to realize high efficient expression to the Avian pneumo-encephalitis virus F protein part sequence that contains Main Antigenic, and further the vaccine of preparation can be realized protection to immune chicken group, but its protection ratio is on the low side, is only 50%.
Producing Enterotoxigenic Escherichia coli (ETEC) is the modal pathogenic escherichia coli that a class causes people and cub diarrhoea, it produces heat-labile toxin (heat-labile enterotoxin, LT) not only there is toxic action, but also there is good immunogenicity and immunoadjuvant function.LT is oligomeric protein, by an A Asia (28 KD) and 5 B subunits (11.5 KD) through non covalent bond combination.B subunit (LTB) is the immunogenicity position of LT, is receptor binding site, has good immunoadjuvant function, existing many pieces of its immunological adjuvants for vaccine of bibliographical information.Li Runcheng etc. (2009) carry out amalgamation and expression by enterotoxin LTB protein gene and foot and mouth disease VP1 protein gene, find that LTB can effectively promote the immune effect of foot and mouth disease VP1 albumen, and synergy is obvious.
The present invention designs based on the good immunoadjuvant function of enterotoxin LTB and the good immunogenicity of newcastle disease virus strain F albumen.
Summary of the invention
The present invention relates to fusion rotein and the application of a kind of newcastle disease virus F albumen and enterotoxin LTB, soon the F protein part sequence of the strain of the newcastle disease virus genotype VIId of screening is connected with the enterotoxin LTB albumen with immuno-potentiation the fusion rotein obtaining by Lingker sequence, and using this fusion rotein as vaccine, is used for immunne response.
One aspect of the invention relates to a kind of fusion rotein, and its aminoacid sequence is SEQ ID NO:1.
Fusion rotein of the present invention is for the preparation of newcastle disease virus subunit vaccine.
The subunit vaccine of above-mentioned preparation, its preparation method is as follows: 4 parts of tween 80s of 96 parts of fusion roteins and sterilizing are uniformly mixed as water; By 94 parts of injection white oils, 80,2 parts of aluminum stearates of 6 parts of Jia Siben, mix, after autoclaving as oil phase; In water and oil phase volume ratio 1:3 ratio mixing and emulsifying, can prepare newcastle disease virus genetic engineering subunit vaccine.
Subunit vaccine of the present invention is for the immunne response to chick.
The present invention designs based on the good immunoadjuvant function of enterotoxin LTB and the good immunogenicity of newcastle disease virus strain F albumen.It has following advantage: the newcastle disease virus of 1, selecting is separated from the sick chicken of domestic clinical cultivation, the domestic popular newcastle disease genotype VIId strain in recent years that belongs to domestic and foreign literature report, the vaccine specific aim of preparing with it is stronger, curative effect is more definite; The partial sequence of the newcastle disease virus F albumen of 2, expressing, the Main Antigenic that had not only comprised F albumen but also the high efficient expression of having realized protokaryon, greatly reduce production cost; 3, the present invention is connected the newcastle disease virus F protein gene containing Main Antigenic of screening to obtain fusion rotein by Lingker sequence with the enterotoxin LTB protein gene with immuno-potentiation.Primary immune response operation just can make chick can obtain efficient immunoprotection.
embodiment:
The present invention relates to a kind of newcastle disease virus F albumen of brachymemma and the fusion rotein of enterotoxin LTB.Wherein 108 amino acid of enterotoxin LTB albumen 3 ' end couple together by Lingker sequence GGGGS with 5 amino acid of newcastle disease virus F protein 14 containing Main Antigenic, and its aminoacid sequence and sequence that has that sequence is SEQ ID NO:1 is the nucleotide sequence of SEQ ID NO:2.Described fusion rotein can be prepared by the method for gene recombination well-known to those skilled in the art.
The fusion rotein of the newcastle disease virus F albumen of restructuring preparation and enterotoxin LTB is made to the sub-vaccine of newcastle disease virus genetically engineered through white-oil adjuvant emulsification.By the method for inspection of regulations, carry out proterties, steriling test, safety verification all qualified.By the vaccine immunity SPF chick of preparation, result shows that the vaccine immunogenicity of preparation is good, can effectively cause the immunne response of chick again.
Below in conjunction with embodiment, further describe the present invention, but these examples are only exemplary, scope of the present invention are not formed to any restriction.It will be understood by those skilled in the art that in the situation that not departing from technical scheme essence of the present invention and can the details of technical scheme of the present invention and form be modified or be replaced, but these modifications and replacement all fall in protection domain of the present invention.
One, screening and the prokaryotic expression of the newcastle disease virus F albumen of brachymemma
Include following step:
1, first applicant inoculates 9 age in days SPF chicken embryos from the pathological material of disease of the doubtful newcastle disease of clinical separation is processed, pcr amplification F gene of Newcastle disease virus after blind passage three generations, and primer sequence is as follows:
P1: 5′-- GTTAGAAAAAACACGGGTAGAAGA --3′
P2： 5 ′-- TCCAAATAGGTGGCACGCATA --3′
The condition of amplification is as follows: 94 ℃ of 5min sex change, and 94 ℃ of 30S, 55 ℃ of 30S, 72 ℃ of 1min, 30 circulations, 72 ℃ are extended 10min.
Amplified production checks order, and gene order part is Blast comparison on NCBI, and homology is up to 100%, and the evolutionary tree of foundation shows that it belongs to newcastle disease virus gene VIId type, is domestic clinical epidemic isolates in recent years.
2, by biosoftware analysis, choose the partial sequence of separated newcastle disease virus F protein gene, this sequence is positioned at F gene N end, the Main Antigenic that contains F albumen, and this section of albumen and immunological adjuvant LTB albumen are coupled together by Lingker sequence GGGGS, its aminoacid sequence and sequence that has that sequence is SEQ ID NO:1 is the nucleotide sequence of SEQ ID NO:2.5 of the antigen-4 fusion protein gene of acquisition ' end and 3 ' end is added respectively to BamH I and Hind III restriction enzyme site ，Song genome company carry out full gene and synthesize.
3, by being connected into the corresponding restriction enzyme site of pET30a carrier after the synthetic gene double digestion obtaining, build pET30a/NDV-LTB expression vector.Use CaCl
2method is transformed into e. coli bl21 (DE3) by pET30a/NDV-LTB expression vector, coats the agar plate containing 50 μ g/ml kantlex, 37 ℃ of incubated overnight.Choose 10 single bacterium colonies and extract plasmids, BamH I and Hind III double digestion are verified the evaluation of further checking order of positive bacterium colony.Positive colony after sequence verification fermentation culture to 0.6～0.8 o'clock in LB substratum is added to 0.3mM IPTG induction 4～5 hours, and centrifugal collection thalline runs SDS-PAGE electrophoresis, sets up simultaneously and does not induce thalline in contrast.After result induction, positive colony has more a protein band than contrast bacterium at 33KD place, and consistent with recombinant protein theoretical molecular, expression amount is about more than 32%.Through the calibrating of Avian pneumo-encephalitis virus F protein antibodies immunoblotting, show positive reaction.The positive colony that proof obtains is the engineering bacteria of efficient expressing gene engineered protein.
the preparation of two, fermentation, purifying and newcastle disease virus genetic engineering subunit vaccine
1, recombinant protein fermentation and purifying
1) LB substratum is as seed culture medium, containing 5g/L glucose and 5g/L MgSO
47H
2the LB substratum of O is as fermention medium, and feed supplement is glucose 400g/L, peptone 24g/L, yeast extract 10 g/L, NaCl 5 g/L, MgSO
47H
2o 5 g/L.
2) fermenting process
The concentration that the engineering bacteria that picking was identified is inoculated in containing kantlex is the LB substratum of 50 μ g/ml, and 37 ℃ of shaking culture 8 hours, as seed liquor.Seed liquor is inoculated in fermentor tank by 2% inoculum size, regulates each parameter, 37 ℃, 200 turn, and dissolved oxygen is controlled at more than 20%.Ferment and start flow feeding after 4 hours, after fermenting 6 hours, add 0.3mmol/L IPTG to carry out abduction delivering, express latter 6 hours fermentation ends.
3) ni-sepharose purification, desalination
4) affinity chromatography
Adopt nickel ion metal chelate chromatography post, recombinant protein can be washed with the elutriant containing 350mmol/L imidazoles, and purity reaches more than 92%
5) desalination
The recombinant protein elutriant of collecting is put into dialysis tubing, and PBS liquid is as extracellular fluid dialysis, and dialysis desalting obtains heavily
Histone liquid.
2, the preparation of newcastle disease virus genetic engineering subunit vaccine
96 parts of the recombinant proteins of preparation are fully uniformly mixed as water with 4 parts of tween-80s of sterilizing.Simultaneously injection white oil is 94 parts, add 6 parts department this 80,2 parts of aluminum stearates, mix, after autoclaving as oil phase.In water and oil phase 1:3 ratio mixing and emulsifying, can prepare newcastle disease virus genetic engineering subunit vaccine.By the method for inspection of regulations, carry out proterties, steriling test, safety verification all qualified.
three, the immunity test of newcastle disease virus genetic engineering subunit vaccine
The newcastle disease virus genetic engineering subunit vaccine of preparation, through intramuscular inoculation 20 age in days SPF chick 20 plumages, is separately got to 20 plumages and injected aseptic PBS in contrast.Blood sampling in 0,7,14,21,28,60 day after immunity, the HI that surveys newcastle disease in serum tires.Result immune group is tired and is maintained 8 ~ 9 left and right after 21, and chicken group antibody titers is evenly distributed, and control group whole process maintains 3 ~ 4 left and right.The newcastle disease virus gene engineered subunit immune effect of proof preparation is good.
four, the challenge test of newcastle disease virus genetic engineering subunit vaccine
The newcastle disease virus genetic engineering subunit vaccine of preparation, through intramuscular inoculation 20 age in days SPF chick 20 plumages, is separately got to 20 plumages and injected aseptic PBS in contrast.Immunity was carried out challenge test, oral Virulent Newcastle Disease Virus Beijing Strain, 10 after 28 days in negative pressure isolator
5eID
50/ plumage, observes 14.Result control group chicken group all falls ill, death, and cuing open inspection has a typical newcastle disease virus infection symptom, immune group chicken inoculation position, spirit, searches for food normally, has no considerable change, and protection ratio reaches 100%.Result shows that the recombinant protein immunogenicity of preparation is good, and its newcastle disease virus genetic engineering subunit vaccine of further preparing can cause the immunne response of chick, can effectively protect the attack of chick opposing Virulent Newcastle Disease Virus Beijing Strain.
SEQUENCE LISTING
<110> Qingdao Agricultural University
Fusion rotein and the application of <120> newcastle disease virus F albumen and enterotoxin LTB
<130> no.2
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 258
<212> PRT
<213> protein sequence
<400> 1
Ala Pro Gln Thr Ile Thr Glu Leu Cys Ser Glu Tyr Arg Asn Thr Gln
1 5 10 15
Ile Tyr Thr Ile Asn Asp Lys Ile Leu Ser Tyr Thr Glu Ser Met Ala
20 25 30
Gly Lys Arg Glu Met Val Ile Ile Thr Phe Lys Ser Gly Glu Thr Phe
35 40 45
Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys Lys Ala
50 55 60
Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Thr Tyr Leu Thr Glu Thr
65 70 75 80
Lys Ile Asp Lys Leu Cys Val Trp Asn Asn Lys Thr Pro Asn Ser Ile
85 90 95
Ala Ala Ile Ser Met Lys Asn Val Pro Gly Val Gly Gly Gly Gly Gly
100 105 110
Ser Gln Thr Gly Ser Ile Ile Val Lys Leu Leu Pro Asn Met Pro Arg
115 120 125
Asp Lys Glu Ala Cys Ala Lys Ala Pro Leu Glu Ala Tyr Asn Arg Thr
130 135 140
Leu Thr Thr Leu Leu Thr Pro Leu Gly Asp Ser Ile Arg Lys Ile Gln
145 150 155 160
Gly Ser Val Ser Thr Ser Gly Gly Arg Arg Gln Lys Arg Phe Ile Gly
165 170 175
Ala Val Ile Gly Ser Val Ala Leu Gly Val Ala Thr Ala Ala Gln Ile
180 185 190
Thr Ala Ala Ala Ala Leu Ile Gln Ala Lys Gln Asn Ala Ala Asn Ile
195 200 205
Leu Arg Leu Lys Glu Ser Ile Ala Ala Thr Asn Glu Ala Val His Glu
210 215 220
Val Thr Asp Gly Leu Ser Gln Leu Ser Val Ala Val Gly Lys Met Gln
225 230 235 240
Gln Phe Val Asn Asp Gln Phe Asn Asn Thr Ala Arg Glu Leu Asp Cys
245 250 255
Ile Lys
<210> 2
<211> 774
<212> DNA
<213> gene sequence
<400> 2
gctccccaga ctattacaga actatgttcg gaatatcgca acacacaaat atatacgata 60
aatgacaaga tactatcata tacggaatcg atggcaggca aaagagaaat ggttatcatt 120
acatttaaga gcggcgaaac atttcaggtc gaagtcccgg gcagtcaaca tatagactcc 180
cagaaaaaag ccattgaaag gatgaaggac acattaagaa tcacatatct gaccgagacc 240
aaaattgata aattatgtgt atggaataat aaaaccccca attcaattgc ggcaataagt 300
atgaaaaacg ttcccggggt aggtggcggc ggcggcagcc agacggggtc aatcatagtc 360
aagttgctcc cgaatatgcc cagagataaa gaggcatgtg caaaagcccc attggaggca 420
tataacagaa cactgactac tctgctcact cctcttggcg actccatccg caagattcaa 480
gggtctgtgt ccacgtctgg aggaaggaga caaaaacgct ttataggtgc tgttattggc 540
agtgtagctc ttggagttgc aacagcagca cagataacag cagctgcggc cctaatacaa 600
gccaaacaga atgctgccaa catcctccgg cttaaggaga gcattgctgc aaccaatgaa 660
gctgtgcatg aagtcaccga cggattgtca caactatcag tggcagttgg gaagatgcag 720
cagtttgtca atgaccagtt taataatacg gcgcgagaat tggactgtat aaaa 774
Claims (4)
1. a fusion rotein of newcastle disease virus F albumen and enterotoxin LTB, its aminoacid sequence is SEQ ID NO:1.
2. the application of fusion rotein claimed in claim 1 in preparing newcastle disease virus genetic engineering subunit vaccine.
3. a newcastle disease virus genetic engineering subunit vaccine, its preparation method is as follows: 4 parts of tween 80s of 96 parts of fusion roteins claimed in claim 1 and sterilizing are uniformly mixed as water; By 94 parts of injection white oils, 80,2 parts of aluminum stearates of 6 parts of Jia Siben mix again, after autoclaving as oil phase; In making subunit vaccine after water and oil phase volume ratio 1:3 ratio mixing and emulsifying.
4. subunit vaccine claimed in claim 3 is for the immunne response to chick.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310652273.XA CN103626878B (en) | 2013-12-09 | 2013-12-09 | Newcastle disease virus F protein and enterotoxin LTB fusion protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310652273.XA CN103626878B (en) | 2013-12-09 | 2013-12-09 | Newcastle disease virus F protein and enterotoxin LTB fusion protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103626878A true CN103626878A (en) | 2014-03-12 |
| CN103626878B CN103626878B (en) | 2015-03-18 |
Family
ID=50208353
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310652273.XA Expired - Fee Related CN103626878B (en) | 2013-12-09 | 2013-12-09 | Newcastle disease virus F protein and enterotoxin LTB fusion protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103626878B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328135A (en) * | 2014-10-23 | 2015-02-04 | 青岛农业大学 | Duck Tembusu virus E protein-LTB fusion protein and application thereof |
| CN114456240A (en) * | 2022-03-04 | 2022-05-10 | 青岛农业大学 | African swine fever virus genetic engineering subunit oral vaccine |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023042164A1 (en) * | 2021-09-19 | 2023-03-23 | Salmanian Ali Hatef | Chimeric proteins for immunization against newcastle disease virus (ndv) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768211A (en) * | 2009-05-12 | 2010-07-07 | 中国人民解放军第四军医大学 | HN protein and F protein of newcastle disease virus Italien strain and application thereof in gene therapy medicament |
| CN102533675A (en) * | 2011-12-21 | 2012-07-04 | 中国农业科学院哈尔滨兽医研究所 | Recombinant newcastle disease virus LaSota vaccine strain for expressing nipah encephalitis virus F protein |
-
2013
- 2013-12-09 CN CN201310652273.XA patent/CN103626878B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768211A (en) * | 2009-05-12 | 2010-07-07 | 中国人民解放军第四军医大学 | HN protein and F protein of newcastle disease virus Italien strain and application thereof in gene therapy medicament |
| CN102533675A (en) * | 2011-12-21 | 2012-07-04 | 中国农业科学院哈尔滨兽医研究所 | Recombinant newcastle disease virus LaSota vaccine strain for expressing nipah encephalitis virus F protein |
Non-Patent Citations (2)
| Title |
|---|
| SIM J.S.等: "Expression and characterization of Synthetic Heat-Labile Enterotoxin B Subunit and Hemagglutinin-Neuraminidase-Neutralizing Epitope Fusion Protein in Escherichia coli and tobacco Chloroplasts", 《PLANT MOLECULAR BIOLOGY REPORTER》 * |
| 王杰: "截短的NDVF蛋白表达及其免疫原性研究", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328135A (en) * | 2014-10-23 | 2015-02-04 | 青岛农业大学 | Duck Tembusu virus E protein-LTB fusion protein and application thereof |
| CN114456240A (en) * | 2022-03-04 | 2022-05-10 | 青岛农业大学 | African swine fever virus genetic engineering subunit oral vaccine |
| CN114456240B (en) * | 2022-03-04 | 2023-08-15 | 青岛农业大学 | African swine fever virus genetic engineering subunit oral vaccine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103626878B (en) | 2015-03-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103585625B (en) | A kind of porcine epizootic diarrhea recombinant baculovirus genetic engineering subunit vaccine and preparation method thereof and application | |
| CN113512096A (en) | Weever rhabdovirus recombinant G2 protein and application thereof | |
| CN106139140B (en) | A kind of Muscovy duck parvovirus subunit vaccine | |
| CN101015691B (en) | Recombinant phages influenza vaccine | |
| CN104974249B (en) | Riemerellosis Anatipestifer OmpA/MotB truncates recombinant protein, its antibody and preparation method and application | |
| CN102994518A (en) | Method for preparing porcine circovirus 2 open reading frame 2 (ORF2) protein | |
| CN103626878B (en) | Newcastle disease virus F protein and enterotoxin LTB fusion protein and application thereof | |
| CN113603754B (en) | Waterfowl H5N8 subtype influenza virus HA recombinant protein and preparation method and application thereof | |
| CN107488234A (en) | Aviadenovirus Hexon and chicken infectivity bursa of Fabricius virus VP 2 fused antigen, subunit vaccine and preparation method thereof | |
| CN104530230B (en) | A kind of duck hepatitis A virus VP1 GFPs and its application | |
| CN107936123B (en) | Swine transmissible gastroenteritis virus fusion protein and preparation method and application thereof | |
| CN104250304B (en) | The vaccine combination of a kind of fusion protein and its coding and application | |
| CN110124025A (en) | A kind of bird flu and 4 type bigeminy genetic engineering subunit vaccine of aviadenovirus and preparation method thereof | |
| CN104610455B (en) | A kind of duck tembusu virus genetic engineering subunit vaccine | |
| CN102813918A (en) | Porcine circovirus 2 type recombinant subunit vaccine and preparation method thereof | |
| CN102643348A (en) | Recombinant chimeric protein carrying rotavirus antigen epitope and preparation thereof | |
| CN102827289B (en) | Porcine circovirus type 2 Cap protein and thymosin alpha1 fusion protein and application | |
| CN102827259A (en) | Porcine circovirus type 2 (PCV2) Cap protein gene and application thereof | |
| CN104448005B (en) | The fusion rotein antigen of duck hepatitis A virus (HAV) 3 type VP1 albumen and LTB and application thereof | |
| CN102993310B (en) | Fusion protein of IBD (Infectious Bursal Disease) VP2 and IL (Interleukin)-2 and application thereof | |
| CN113827714B (en) | H7N9 subtype avian influenza virus-like particle vaccine preparation, preparation and application | |
| CN112891528B (en) | Vaccine strain for infectious bronchitis | |
| CN108359682A (en) | A kind of Wdwardsiella tarda outer membrane protein PagC with immanoprotection action | |
| CN108410784B (en) | Streptococcus suis delta CPS/SsnA-mSly (P353L) -SC19 engineering bacteria and application thereof in vaccines | |
| CN114058524A (en) | Bursal disease subviral particle vaccine and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150318 Termination date: 20151209 |
|
| EXPY | Termination of patent right or utility model |